quiz image

CRISPR-Cas System and Bacteriophages Quiz

UnforgettableConnemara6371 avatar
UnforgettableConnemara6371
·

Start Quiz

Study Flashcards

47 Questions

Los fragmentos del DNA de un bacteriografo es insertado en la sección Crispr del sistema CRISPR-Cas

True

Una de las modificaciones de los snoRAs(Rna pequeños nucleares) amlos tRNAs de la célula en convertir uracilos a pseudoracil.

False

Todas son función de los RNA no codificamte excepto :

Todas la mencionadas son funciones

¿Cuál de las siguientes NO es una característica del codigo genético?

Una secuencia de tres bases (codón) puede codificar para mas de un aminoácido.

Las acetiltransferasas funcionarán directamente en cuál de los siguientes procesos.

acetilación de residuos de lisina en las histonas

Uno de los resultados de la unión de RISC al mRNA durante la interferencia del RNA es inhibir la traducción sin degradar el mRNA.

True

Ambos parentales (macho y hembra) usualmente generan impronta genómica del mismo gen.

False

¿Cuál de las horquillas formadas en el atenuador favorecerá que ocurra regulación por atenuación en el operón de triptófano (terminación del proceso)?

3-4

La impronta genómica es el resultado de:

metilación del DNA

¿Cual de las siguientes es la región donde se coloca la molécula reguladora del operón?

Operador

La formación del cuerpo de Bar permite que ambos sexos expresen cantidades diferantes de las proteinas asociadas a los genes que se encuentran localizados en el cromosoma X.

False

CRISP RNA guía la endonucleasa para que corte ONA extraño

True

La función de la secuencia Shine Delgarno en el mensajero procariota es permitir la alineación correcta entre el RNA mensajero y la subunidad grande del ribosoma.

False

Ocurrio una mutación en el gen que produce el represor del operon de lactosa que evita que el producto del gen se una a alolactosa. ¿Cómo será el nivel de expresión del operón en ausencia de lactosa?

No hay transcripción

EL RNA ribosomal 18S tendrá complementariedad de bases con la secuencia Kozak en eucariotas lo que permitirà la union del mensajero al ribosoma.

True

Las isla de GC están asociadas con

la metilación del DNA

Se requieren 61 diferentes tRNA para la traducción tanto en la célula (in vivo) como en un ensayo (in vitro). Select one:

False

Las bacterias tienen un cRNA llamado Oxys que regulo la traducción al unirse a la secuencia Shine-Dalgerno, prevee que el ribosoma se pegue. ¿Cuál es la función de OxyS?

Bloqueo

La enzima acetiltransferasa está directamente envuelta en

modificar químicamente las histonas

¿ Qué sucederia si una secuencia aislante entre dos genes está austente?

Los factores de transcripción van a activar la expresión de un gen, pero inducirá de manera equivocada la expresión del gen vecino.

La alolactosa funciona como un inductor en el operon de lactosa, mientras que triptófano actúa como un corepresor en el operon de triptófano.

True

La modulación de los factores reguladores de transcripción es mediante una de las siguientes: unión de moléculas efectoras, interacción proteína-proteina o modificaciones covalentes.

True

La impronta genética se considera un ejemplo de regulación epigenética debido a que:

Se altera la expresión de gen ain moditicado su secuencia de bases.

La regulación del operador en el operón de lactosa es un ejeropio de regulacion genética trans.

False

¿Cuál de las siguientes es cierta en relación con los poliribosomas?

Son grupos de ribosomas leyendo el mismo mRNA

piRNA (PIWI-RNA) su función es prever que se muevan elementos de trasposición.

True

LOS HOTAIR es Un NA no codificantes que funcionan en la alteración de la estructura de la cromátida inactivando la transcripción.

True

La peptidil transferasa que esta activo durante el proceso de sintesis de proteinas es una riboenzima.

False

La región o cegiones del tRNA que determinan cuál aminoácido será transportado por él es(son):

El anticodón

¿A qué nivel usted esperaría observar una regulación más eficiente?

Transcripción

Durante el proceso de elongación de la proteina la Peptidil transferasa transfiere el el polipeptido en formación del sitio P y se Transfiere al A del ribosoma

True

El tRNA cuyo anticodón es CCU puede leer los codones GOU, GGC y GGA. Esta situación ilustra:

El fenómeno de bamboleo "wobble* (alta especificidad de las pomeras dos bases).

¿Cuál de las siguientes no es un ejemplo de regulación a nivel de procesamiento del mRNA?

Bloqueo de los tactores acnerales de usnscnacio que permiten la sintesis del mensajero

En una célula que está llevando a cabo el proceso de traducción se colocan cuatro IRNAs que producen la siguiente secuencia de anticodones: 3 UAC6' 3'GCU5* SAUA5 3'CUCE Basado en esta intormación indique la secuenca de codones en el mRNA que es complementaria a la secuencia de tRNA presentada anteriormente

5' AUG CGA UAU GAG 3*

Un gen produce un mensajero que debe tener 400 aminoácidos.En un organismo se produce una mutación que cambio el codón 300 por un codón de terminación usted esperaría que:

Se produzca una terminacion temprana de bi sintesis de la proteína.

¿Cuái de las siguientes no es un ejemplo de regulación traduccional en procanotas?

Fosforilación de la prateina ya formada

El gen responsable de le atenuacion del operón de triptofano es trpl.

True

¿Cuál de las siguientes parejas de moléculas le permitirá regular un gen inducible bajo control negativo?

Represor + inductor

¿Cuál de las siglentes no es considerado un elemento regulador?

Factores de transcripción

Las metilaciones del DNA son realizados por los factores de transcripción de regulación para influenciar la expresión gonética.

False

Una regulación alostérica se genera cuando_______

una molécula pequeña se une al sitio de una enzima que no es el sitio activo

Un gen en particular tiene una mutación en su NFR (regiones libres de nucleosomas) generando una unión anormal con las histonas ¿ Que efecto esperaría tenga esta mutación en la expresión de ese gen?

La expresión del gen sería anormalmente baja o austente.

¿Cuántos amino ácidos tendrá el polipéptido generado por la sigiente secuencia codificante de mRNA: 5- GCCACCAUGCGCGGCCAAUUACGAAGGUUUUGCUGAC CAGGUCAA-3'

9

Se dice que un alelo es paramutagénico cuando este cambia la expresión de otro alelo.

True

¿Cuál de las siguientes es importante en el proceso de impronta ("imprinting") genómico?

La metilación del DNA.

El RNA antisentido_______

se une al mRNA y previene la traducción

Study Notes

CRISPR-Cas System

  • The DNA fragment of a bacteriophage is inserted into the CRISPR section of the CRISPR-Cas system.
  • CRISPR RNA guides the endonuclease to cut the DNA.

RNA Modification

  • One of the modifications of snoRNAs is to convert uracils to pseudouridines in tRNAs.
  • All snoRNAs are non-coding RNAs except for one.

Genetic Code

  • One of the characteristics of the genetic code is not mentioned in the text.
  • Acetyltransferases function directly in one of the following processes.

RNA Interference

  • One of the results of RISC binding to mRNA during RNA interference is to inhibit translation without degrading the mRNA.

Genomic Imprinting

  • Genomic imprinting is the result of differences in gene expression between parental alleles.
  • Both parental alleles (male and female) usually generate genomic imprinting of the same gene.

Operon Regulation

  • The formation of a stem-loop structure in the attenuator favors the occurrence of regulation by attenuation in the tryptophan operon.
  • The regulatory molecule binds to the operator region of the operon.
  • The lac operon is an example of transcriptional regulation.

tRNA and Ribosomes

  • The function of the Shine-Dalgarno sequence in prokaryotic mRNA is to allow correct alignment between the mRNA and the large subunit of the ribosome.
  • The 18S rRNA has complementarity with the Kozak sequence in eukaryotes, allowing the binding of the mRNA to the ribosome.

Transcriptional Regulation

  • The modulation of transcription factors is through one of the following: binding of effector molecules, protein-protein interactions, or covalent modifications.
  • The lac operon is an example of transcriptional regulation, and the trp operon is an example of transcriptional regulation by repression.

Epigenetic Regulation

  • Genomic imprinting is considered an example of epigenetic regulation because it affects gene expression without altering the DNA sequence.
  • The HOTAIR is a non-coding RNA that functions in altering chromatin structure, inactivating transcription.

Protein Synthesis

  • Peptidyl transferase is a riboenzyme that is active during protein synthesis.
  • The region of the tRNA that determines which amino acid will be transported by it is the anticodon.

Translation Regulation

  • One of the following is not an example of translational regulation in prokaryotes.
  • The binding of the regulator molecule to the operator region of the operon is an example of translational regulation.

Regulatory Elements

  • The trpl gene is responsible for the attenuation of the tryptophan operon.
  • The following is not considered a regulatory element: metylation of DNA.

Gene Regulation

  • A mutation in the NFR (nucleosome-free region) of a gene can affect the expression of that gene.
  • The regulation of gene expression can occur at multiple levels, including transcriptional and translational regulation.

Test your knowledge on the insertion of bacteriophage DNA fragments into the Crispr section of the CRISPR-Cas system. Explore how this process impacts genetic engineering and immunity in bacteria.

Make Your Own Quizzes and Flashcards

Convert your notes into interactive study material.

Get started for free

More Quizzes Like This

CRISPR/Cas9 Gene Editing
5 questions
Unleash Your Knowledge
20 questions

Unleash Your Knowledge

EntrancingDravite9639 avatar
EntrancingDravite9639
Genetic Engineering Techniques Quiz
15 questions
Use Quizgecko on...
Browser
Browser