YR1 Lecture - Genes Envior Diabetes, E O'Connor 2024 PDF

COPYRIGHT COMMONWEALTH OF AUSTRALIA Copyright Regulations 1969 WARNING This material has been reproduced and communicated to you by or on behalf of University of Western Sydney pursuant to Part VB of the Copyright Act 1968 (the Act). The material in this communication may be subject to copyright und...

COPYRIGHT COMMONWEALTH OF AUSTRALIA Copyright Regulations 1969 WARNING This material has been reproduced and communicated to you by or on behalf of University of Western Sydney pursuant to Part VB of the Copyright Act 1968 (the Act). The material in this communication may be subject to copyright under the Act. Any further reproduction or communication of this material by you may be the subject of copyright protection under the Act. Do not remove this notice. 1 Research Genes and the environment in diabetes Dr Elizabeth O’Connor [email protected] Learning objectives Compare linkage and association analysis techniques used in the investigation of polygenic diseases Discuss some of the genes and environmental factors that contribute to Type 1 and Type 2 diabetes mellitus Recognise that there are other types of diabetes that can also be influenced by genetic and environmental factors – Gestational Diabetes and Mature Onset Diabetes in the Young (MODY) Revision Gene: The basic unit of inheritance; a segment of DNA found in a fixed position on a chromosome Homologous pair of chromosomes Allele: One of the different versions of a gene that occur at a given locus Alleles Locus: A fixed position on a chromosome (loci = plural) Heterozygote: individual with two different alleles at a locus Homozygote: individual with two copies of the same allele at a locus Locus Genes Alleles Looking at genetic basis of disease in a population Linkage vs association studies Linkage – looking at familial pedigrees and linking an allele inheritance pattern to a disease pattern Eg. Quantitative trait loci (QTL) Association – comparison of “normal” vs “disease” groups and the frequency of alleles presence in each (what differences are there?) Eg. Genome wide association studies (GWAS) Both can use Single Nucleotide Polymorphisms (SNPs), but traditional QTL uses larger genome regions Single nucleotide polymorphisms (SNPs) A SNP is a single nucleotide change in a DNA sequence (result of mutational event) Common occurrence in humans (~1 every 300 base pairs) – you have ~ 10 million of them Most occur in extragenic regions, some can alter gene structure/function Account for 90% of allelic variation seen in genes SNPs are number with rs# (unique identifier) Haplotype = combination of SNPs along a chromosome ATGGTCTAATCGGCATGCCTAGAT ATGGTCTAATCTGCATGCCTAGAT G > T (Individuals can be GG, TT or GT) Quantitative Trait Loci Quantitative traits are multigenic and on a continuum (eg. height) May also be influenced by environmental factors Matching family pedigrees and phenotypes with genetic variation at the chromosomal locus (marker or SNP) level Statistical analysis to estimate linkage b/w genetic variation and phenotype Correlation not causation PMID: 16252286 Quantitative Trait Loci example Metabolic syndrome phenotypes - 1,137 indiv of 85 families SNP analysis at 3p27 (chr 3, short arm p, region 27) 42 MetS traits inclu AIR (acute insulin response) and WHR (waist-hip ratio) Identified SNPs (mutations) associated with genes (eg. LPP, IGF2BP2) linked to phenotypic traits associated with metabolic syndrome Zhang et al., 2013, Obesity 21(10) 2099-111, PMID: 23418049 Genome wide association studies (GWAS) Looks a large groups – disease and control Measures the presence of SNPs (1 million+) across the genome in each group Reports on statistically significant loci differences between the two groups Gives you risk regions across a population Greater genetic diversity but lower statistical power that QTL Correlation not causation Genome wide association studies (GWAS) Healthy Controls rsXXXXXXX G = 16/32 (50%) T = 16/32 (50%) Diabetes Cases G = 4/32 (12%) T = 28/32 (88%) The “T” SNP (mutation) may be associated with development of diabetes GWAS example Genome-wide SNP scan of ~1200 T2DM and ~1200 control indiv, Indian pop Identified known risk loci (from other pops) and new risk loci (at 2q21) Tabassum et al, 2013, Diabetes 62(3): 977-86, PMID: 23209189 Diabetes in Australia Affects 1.7 million Australians (415 million globally) Type 2 diabetes accounts for 85% Type 1 diabetes accounts for 10% ~10% pregnant women develop gestational diabetes Insulin release Beta cell 1. Glucose is transported into the beta cell by GLUT2 2. Glucose is converted to glucose-6-phosphate 3. ATP is produced in the mitochondria by glucose break down 4. Increase in the ATP:ADP ratio closes ATPgated K+ channels in the beta cell membrane 5. The rise in positive charge inside the beta cell causes depolarization 6. Voltage-gated calcium channels open, allowing Ca2+ ions to enter cell 7. The increase in intracellular calcium concentration triggers the secretion of insulin via exocytosis Insulin action Fat or muscle cell 1. Insulin binds to the alpha subunits on the insulin receptor 2. Induces a conformational change that is transmitted to the beta subunits 3. The beta subunits phosphorylate and initiate a cascade of phosphorylation and dephosphorylation reactions 4. Signals translocation of GLUT4 transporters to the cell membrane 5. Increases the uptake of glucose into the cell http://sigmanutrition.com/wp-content/uploads/2014/05/insulin-action.jpg Type 2 Diabetes Mellitus Type 2 diabetes mellitus Resistance to the normal effects of insulin and/or loss of capacity to produce enough insulin Onset predominantly after 40 years of age Associated with individuals who are overweight or obese Increased prevalence through affected families Managed by diet and increased exercise, insulin and non-insulin drugs Genetics of T2DM Genome wide association studies (GWAS) have identified >75 loci associated with T2DM "Diabetes genes" may show only a subtle variation in the gene sequence, and these variations may be extremely common Each gene variant has a small effect Combinations of these variations likely increase or decrease your risk of developing T2DM Family history of type 2 diabetes in a first-degree relative Ethnicity - Hispanic, Native American, African American, Asian, or Pacific Islander descent Genes associated with T2DM Gene SNP Chr. Probable mechanism PPARG (transcription factor) rs1801282 3 Insulin action KCNJ11 (K+ channel) rs5219 11 β cell function TCF7L2 (transcription factor) rs7903146 10 β cell function WFS1 (membrane protein) rs10010131 4 β cell function IGF2BP2 (binding protein) rs4402960 3 β cell function INSR (insulin receptor) rs2059806 19 Insulin action IRS1 (Insulin receptor substrate) rs2943641 2 Insulin action GCKR (Glucokinase receptor) rs780094 2 β cell function GCK (Glucokinase) rs4607517 7 β cell function RBMS1 (transcription factor) rs7593730 2 Insulin action GLUT2 (Glucose transporter) rs5393 3 Glucose transport FTO (fat mass and obesity) rs8050136 16 Obesity/BMI HHEX (transcription factor) rs1111875 10 β cell development Beta cell K+ channels K+ channels close ATP production Membrane depolarisation Ca2+ Ca2+ entry Ca2+ Glucose Ca2+ channels Glucose-6phosphate GLUT GCK Insulin released Environmental risk factors Diet Exercise Age - Older than 45 years Obesity - Weight >120% of desirable body weight Hypertension (>140/90 mm Hg) Dyslipidemia History of Gestational Diabetes Mellitus Gut microbiota Smoking/alcohol Sleep Stress Why are these environmental factors associated? éObesity éFood êExercise évisceral fat -> chronic éNEFA -> insulin resistance éFFA -> êGLUT2 function -> “starvation” state -> FFA mobilised Smoking -> ??? -> éinsulin resistance Thrifty genotype? Selective advantage Primitive times when food was not abundant these individuals were metabolically thrifty Most populations now have constant supply of calorie dense foods Genetic evidence? CREBRF, Samoan population ABCA1, Native American population PMID: 27455349; PMID: 20418488 http://diabetes.diabetesjournals.org/content/62/9.cover-expansion Genes x Environment Poor diet No exercise Healthy diet and exercise Environment Genes T2DM risk variants Insulin resistance High blood glucose Maintain stable glucose/insulin balance Alters gene expression and biological pathways T2DM Healthy individual Phenotype Summary of T2DM GWAS using SNPs ID’d multiple genetic risk alleles Genes are associated with beta cell function, insulin action, obesity Environmental factors such as diet are highly associated with T2DM Modification of environmental factors can influence disease susceptibility Questions Which of the following will most likely cause you to develop T2DM? A. B. C. D. Ethnicity Poor diet and no exercise Over the counter medications Gestational diabetes Which of the following cellular pathways is most highly associated with susceptibility to T2DM? A. B. C. D. Apolipoprotein E activity Renin activation Aldehyde dehydrogenase activity Glucokinase activity Type 1 Diabetes Mellitus Type 1 Diabetes Autoimmune condition Destruction of pancreatic beta cells Insulin not produced Managed by administering insulin injections Maintain normal blood glucose levels http://www.post-gazette.com/image/2014/02/09/20140210type1-diabetes715 Genetics of T1DM Modified from PMID: 19369670 Human leukocyte antigen HLA class II proteins on surface of APC present antigen Th (T4 helper) binds APC Th stimulate B-cells to produce antibodies specific to that antigen Th also stimulate CTL (T8 cytotoxic) activity PMID: 24133494 T1DM HLA genes Chr 6 HLA region Consist of α and β subunits with many SNPs HLA-DP HLA-DQ α-chain HLA-DPA1 – 38 alleles β-chain HLA-DPB1 – 422 alleles α-chain HLA-DQA1 – 52 alleles β-chain HLA-DQB1 - 664 alleles HLA-DR α-chain HLA-DRA – 7 alleles β-chain HLA-DRB1, DRB3, DRB4, DRB5 – 1540 alleles T1DM risk HLA DR3/DR4 HLA variations account for approximately 40% of the genetic risk for T1DM Haplotype refers to the allelic combination 90% of patients who develop T1D carry a DR3, DR4, DQ2, or DQ8 haplotype DR3/DR4 heterozygosity present in 50% of children who develop T1DM Insulin INS gene located on Chr 11 T1DM locus mapped to VNTR upstream (~500bp) Repeat Region Insulin Gene ACAGGGGTSYGGGG ACAGGGGTSYGGGG ACAGGGGTSYGGGG ACAGGGGTSYGGGG ACAGGGGTSYGGGG ACAGGGGTSYGGGG INS Variable repeat region Three classes of repeats: Class I has alleles that range from 26 to 63 repeats Class II has alleles that average around 80 repeats Class III has alleles ranging from 141 to 209 repeats Class I allele homozygosity (23-60 repeats) is associated with increased risk of TIDM Class III allele (141-209) has been associated with increased risk of T2DM Repeat region is non-coding region and probably affects the transcription of the insulin gene Environmental factors Exposure to viruses and other infections during childhood Infant/childhood diet – breast feeding, [early exposure to cow’s milk] Improved hygiene – child/mother? Stress Migrant children assume the risk of host country PMID: 27302273 Summary of T1DM Autoimmune condition where the immune system attacks the beta cells in the pancreas – no insulin produced Genetic variants in the HLA region are strongly associated with increased T1DM risk, especially HLA-DR3/DR4 heterozygosity Many other genes are also associated with T1DM risk Environmental factors have also been implicated in the development of T1DM Question True or False? If you have both the HLA-DR3 and HLA-DR4 haplotypes, you will develop T1DM “Other” Diabetes Gestational diabetes Abnormal glucose tolerance during pregnancy Affects ~10% pregnancies Treatment – diet and exercise plan, and monitoring of blood glucose levels. Insulin injections necessary in some cases Glucose tolerance usually goes back to normal once the baby is born Associated with higher risk of development of T2DM in later life (mother and child) GDM - Mechanism Hormones affect insulin Blood glucose Blood glucose remains high in mother Foetal Highgrowth glucose levels = Larger foetus (Complications at delivery) = é insulin production by foetus (Low neonatal blood sugar) Insufficient insulinsecretion secretion insulin in mother Associated genes Gene Chr Protein Function IRS1 2 Insulin receptor substrate 1 Insulin action IGF2BP2 3 IGF2 binding protein 2 Insulin signalling pathway GCK 7 Glucokinase Regulation of insulin secretion TCF7L2 10 Transcription factor Insulin secretion signalling MTNR1B 11 Melatonin receptor Insulin secretion KCNJ11 11 Potassium channel http://www.ncbi.nlm.nih.gov/pubmed/?term=26803651 Insulin secretion Environmental risk factors Age - Women older than age 25 are at increased risk Family history of T2D Previous history of gestational diabetes, unexplained stillbirth, or delivering a very large baby Being overweight before pregnancy Ethnicity – African American, Hispanic, American Indian, or Asian are more likely to develop gestational diabetes Maturity onset diabetes of the young (MODY) Monogenic diabetes caused by autosomal dominant mutations Typically non-insulin dependent 0.6 - 2% of all diabetes and affects children and young adults Mutations in HNF1A primary genotype (70%) (MODY 3); also HNF4A and GCK Managed with diet and exercise; sulfonylurea medication PMID: 23878349 HNF1A mutations Beta cell HNF1A is a TF involved in development and function of pancreatic cells HNF1A mutants show ê β cell mass and prolif rate, ê glucose-stim insulin release Within β cell, ê glucose-stim insulin release, mitochondrial activity, insulin production/secretion HNF1A Glucokinase (GCK) mutations Beta cell GCK GCK enzyme catalyses conversion of glucose to glucose-6-phosphate Activity of GCK will depend on the glucose concentration in blood High glucose = high activity Glucose sensor – facilitates insulin release Loss of function mutations = Glycemic threshold for insulin release is higher Summary GDM and MODY Gestational diabetes occurs during pregnancy and resolves after delivery Genes and environmental factors similar to T2DM Increases risk of T2DM later in life MODY caused by monogenic autosomal dominant mutations in HNF1A or GCK Both can managed by diet and exercise Thank you! Please take a moment to complete this anonymous 2023 lecture feedback survey. This link can be used repeatedly to provide feedback on any lectures in Yr1 or 2 Medicine https://surveyswesternsydney.au1.qualtrics.com/jfe/form/SV_bQvYfjHLMvBNRsO