Biomolecules and Central Dogma PDF

THE BIOLOGICAL MOLECULES JAIRA ANGELINE T. BALISI DES, COS, TSU ELEMENTS VS. COMPOUND Elements Compound are pure substances which are are substances which are formed by two or more different types of com...

THE BIOLOGICAL MOLECULES JAIRA ANGELINE T. BALISI DES, COS, TSU ELEMENTS VS. COMPOUND Elements Compound are pure substances which are are substances which are formed by two or more different types of composed of only one type of elements that are united chemically in atom. fixed proportions. ORGANIC VS. INORGANIC Organic compounds are generally complex molecules derived from or produced by living organisms and have carbon- hydrogen bonds. Inorganic compounds are generally more simple molecules derived from nonliving components, like metals, and have no carbon-hydrogen bonds. THE LEVEL OF BIOLOGICAL ORGANIZATION Subatomic Particles: Proton, Neutron, and Electrons Atoms Molecules Elements vs. compounds Organic vs. inorganic Macromolecules (Proteins, Nucleic Acid, Lipids, and Carbohydrates) Cell Organelles (Major and Minor Parts of the Cell) CARBOHYDRATES Short-term energy storage Often found first and in majority in plants/autotrophs (due to creation of own food, such as photosynthesis) CO2 + H20 + Sunlight = C6H12O6 + O2 Monosaccharides – subunit of sugar; (Greek: sakcharon = sugar) Often bond with glycosidic bond Disaccharide, Polysaccharide, Oligosaccharide (3-10), etc.  SUGARS Glucose – foods rich in carbohydrates, like bread, potatoes, and fruit. Fructose - found naturally in fruits, fruit juices, some vegetables and honey. Galactose - found in dairy products, avocados, sugar beets, other gums and mucilages. Raffinose - t can be found in beans, cabbage, brussels sprouts, broccoli, asparagus, other vegetables, and whole grains. Starch - eaten in the form of wheat, rice, potatoes, LIPIDS (Also known as Fats) Long-term energy storage Fatty acid – subunit of Lipids Often bond with Ester bond LIPIDS AMPHIPHILIC water is a polar molecule = insoluble. In the human body, these molecules can be synthesized in the liver and are found in oil, butter, whole milk, cheese, fried foods and in some red meats.  CLASSIFICATION OF LIPIDS: Nonsaponifiable VS Saponifiable Lipids Nonsaponifiable Lipids - cannot be disintegrated into smaller molecules through hydrolysis (E.g., cholesterol, prostaglandins, etc.) Saponifiable Lipids - one or more ester groups, enabling it to undergo hydrolysis in the presence of a base, acid, or enzymes, including waxes, triglycerides, sphingolipids and phospholipids.  CLASSIFICATION OF LIPIDS: Polar VS NonPolar Nonpolar lipids - namely triglycerides, are utilized as fuel and to store energy. Polar lipids - could form a barrier with an external water environment, are utilized in membranes (E.g., sphingolipids and glycerophospholipids).  CLASSIFICATION OF LIPIDS: Simple VS Complex Lipids Simple Lipids - Esters of fatty acids with various alcohols. Fats: Esters of fatty acids with glycerol (Oils are fats in the liquid state). Waxes: Esters of fatty acids with higher molecular weight monohydric alcohols Complex Lipids - Esters of fatty acids containing groups in addition to alcohol and fatty acid. Phospholipids: fatty acids and alcohol with phosphate group. They frequently have nitrogen-containing bases and other substituents; heads contain a positively charged group that is linked to the tail by a negatively charged phosphate group. Glycolipids: (glycosphingolipids): Lipids containing a fatty acid, sphingosine and carbohydrate; heads contain an oligosaccharide with 1-15 saccharide residues. Sterols: whose heads contain a planar steroid ring, for example, cholesterol. Other complex lipids: Lipids such as sulfolipids and amino lipids. Lipoproteins may also be placed in this category. Precursor and Fatty Acids - carboxylic acids (organic Derived Lipids: Fatty acid), usually with long aliphatic tails. Acid Saturated fatty acids - Lack of carbon- carbon double bonds; Have higher melting points corresponding size due to their ability to pack their molecules together thus leading to a straight rod-like shape (E.g., butter). Unsaturated fatty acids - Unsaturated fatty acid is indicated when a fatty acid has more than one double bond (E.g., margarine as trans-fat). NUCLEIC ACIDS Nucleotides – subunit of Nucleic Acid Often bond with Phosphodiester and Hydrogen bond Main function: transfer of genetic information and synthesis of proteins by processes known as translation and transcription. Deoxyribonucleic Acid (DNA) and Ribonucleic Acid (RNA) The instruction the cell uses to build proteins PROTEINS Amino Acid – subunit of Proteins Often bond with Peptide bond (a kind of covalent bond) The highly variable macromolecules that make each organisms unique.  THE STRUCTURE OF PROTEINS Primary - sequence of amino acids in the polypeptide chain; Secondary - polypeptide chains form a helix or a pleated sheet structure; Tertiary - coiling of the polypeptide, combining helices and sheet forms; Quaternary - the association of two or more polypeptides in space  PROTEINS: Structural vs. Functional Structural – these make-up the physical body of an organism Functional (enzymes) – these are the “machinery” the cell uses, to build other things (e.g., other biomolecules), as well as the large products that may be combinations of the four macromolecules and other molecules and elements  The activity and function of protein depends on the exact order of the four macromolecules (the primary structure of proteins) One different amino acid can completely POLYMER – “Chain- change a protein’s like molecule” shape and function Biomolecule - building /Carbohydrates - monosaccharides - glycosidic bond block - bonding (commonly) /Proteins - Amino Acid - Peptide bond (a kind of covalent bond) /Nucleic Acid - Nucleotide - phosphodiester and hydrogen bond /Lipids - Fatty Acid - Ester bond THE CENTRAL DOGMA THE CENTRAL The central dogma of molecular biology is a theory stating that genetic information flows only in one direction, from DNA, to RNA, to protein, or RNA DOGMA directly to protein.  DNA Replication DNA as Nucleic Acid with building block of Nucleotides (repeating subunit); It is composed of a phosphate group (with negative charges), a pentose sugar portion, and an N(itrogenous)- base. Deoxyribonucleic acid is a repository of genetic information; sequence of bases encodes the blueprint for life processes. The two-carbon nitrogen ring bases (adenine and guanine) are purines, while the one-carbon nitrogen ring bases (thymine/uracil and cytosine) are pyrimidines.  DNA Replication Lagging (3’ – 5’) and Leading (5’ – 3’) = anti=parallel Enzymes in replication are as follows: 1. Helicase - enzymes that are able to unwind DNA by the use of the energy-equivalent ATP. 2. Gyrase 1. Topoisomerase 1 – enzyme that creates a tiny cut in a single strand of DNA to allow the second strand to unwind itself and then ligates this break in the strand (does not require ATP). 2. Topoisomerase 2 - cleaves both strands of DNA to allow the newly synthesized strand to pass through in order to avoid tangles  DNA Replication 3. SSB (single strand binding proteins); 4. primase - catalyze the synthesis of short RNA molecules used as primers for DNA polymerases DNA polymerase I and II - repair, removing the primer and filling the gaps. DNA polymerase III - main enzyme responsible for replication. 5. DNA ligase - joining breaks in the phosphodiester backbone of DNA that occur during replication and recombination, and because of DNA damage and its repair.  RNA Transcription RNA - Ribonucleic acid; transcripts; link between the gene and the gene product (protein) DNA is the template copied into RNA by base pairing: G with C; A with U. An RNA polymerase makes RNA in the 5’ to 3’ direction.  RNA Transcription Re-writing DNA to RNA (Transcription literally means writing again): Information in the form of base sequence is transformed (transcribed) into mRNA, tRNA and rRNA. RIBOSOMES: Biological machines inside cell that makes proteins by linking amino acids in the right order to make specific proteins Every three “letters” on the DNA represents one amino acid.  PROTEINS (Translation) Proteins are large, complex molecules that play many critical roles in the body; functional products; executors of cellular functions. At the end of gene, there are codes that tell what the ribosomes will do once it is read to make proteins.  START CODON – AUG (Methionine) STOP CODON – UAA, UAG, and UGA Genetic Factors: Abnormal Chromosome Structure Deletion - a mutation in which a part of a chromosome or a sequence of DNA is lost during DNA replication. Duplication or Repeats - It can be defined as any duplication of a region of DNA that contains a gene. Inversion - segment of a chromosome is reversed end to end. Translocation - rearrangement of parts between nonhomologous chromosomes. Genetic Factors: Abnormal Chromosome Structure Missense: Nucleotide Change leads to amino acid change (often C to T) Nonsense: Change leads to stop codon Insertion: Addition of nucleotide that leads to frameshift mutation Splice site: Changes in RNA splicing Expansion of repeating units  Genetic Factors: Genetic Mutations Microlesions: Base Pair Substitution -A base-pair substitution is the replacement of one nucleotide and its partner in the complementary DNA strand with another pair of nucleotides Frameshift Mutation: Insertions and deletions are additions or losses of one or more nucleotide pairs in a gene. Such mutations can result in an entirely new set of amino acids (extensive missense) and probably also premature termination (nonsense). VIRAL REPLICATION  EXAMPLE Given the coding sequence for DNA: 5’ ATGCATAGATTAGGATATCCCAGATAG 3’, provide the (1) sequence of the complementary (template) sequence, (2) complementary coding sequence into an mRNA transcript (3) mRNA transcript into a polypeptide sequence. 1. Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ 2. Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ 3. Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C NOTE: Antiparallel orientation of the coding and non-coding strands of DNA (relative positions of the 5’ and 3’ ends). The mRNA transcript has almost the same sequence as the coding sequence (DNA), but the thymines are replaced to Uracil.  LABORATORY ACTIVITY NO. 1: CELL OBSERVATION TO BRING BY GROUP: -ALCOHOL -TOOTHPICK -GLASS SLIDES AND COVER SLIP -NEWSPAPER -SCISSORS -SCOTCH TAPE - TISSUE TO BORROW AT SCHOOL: -COMPOUND MICROSCOPE -METHYLENE BLUE  REVIEW: THE PARTS AND FUNCTION OF A MICROSCOPE