Final Exam Lab PDF

Lab Equipment\ **Accuracy vs Precision\ **Accuracy is how close a measured value is to the actual (true) value.**\ **Precision is how close the measured values are to each other.**\ **What is the meniscus?**\ **It is the curve of the liquid when it touches another material.\ A **beaker** is for stir...

Lab Equipment\ **Accuracy vs Precision\ **Accuracy is how close a measured value is to the actual (true) value.**\ **Precision is how close the measured values are to each other.**\ **What is the meniscus?**\ **It is the curve of the liquid when it touches another material.\ A **beaker** is for stirring, mixing and transferring solutions.\ A **flask** is used for running reactions in or mixing or heating. Due to long neck and small opening less likely to spill out\ A **graduated cylinder** has many lines of measurement and is more precise\ Pipettes are used as a tool for transferring fluids. They can be graduated for measurement of small volumes of material.\ **Aspirate** - to draw up the sample.\ **Dispense** - to deliver the sample.\ **Blow-out** - to empty the tip completely. Science And the Scientific Method\ Definition of science: An active, dynamic, objective process of gathering and organizing information about the physical/natural world using observation and experimentation.\ THE CLASSIC GOAL OF SCIENCE IS TO GAIN KNOWLEDGE ABOUT THE NATURAL WORLD. - Scientists seek to accumulate knowledge and aim to explain the natural world.\ MODERN SCIENTIFIC RESEARCH IS OFTEN GOAL DIRECTED -- APPLIED TECHNOLOGY\ **Hypothesis** -- explanation limited in scope apply to narrow range of phenomena\ Based on prior information/experience/education, primary observations and logic\ **Theory** -- powerful explanation that applies to broad range of phenomena.\ A theory must be thoroughly tested, accurate, and able to predict something that happens in the natural world.\ No scientific idea is [never] once and for all "proved".\ Science looks at the natural world and finds natural explanations, NOT opinions, judgments, beliefs or values\ Science only deals with natural phenomena and explanations. Can't support or deny the supernatural.\ Science does not make moral judgements. It attempts to understand and explain the natural world.\ Science doesn't tell us what to do with the knowledge we gain about the natural world.\ Individual scientists may not be completely objective. By sharing and reviewing each other's scientific work the scientific community helps to balance biases.\ **[Steps of the Scientific Method\ ]**Make an **observation**\ Ask a **question** based upon the observation\ Suggest a **hypothesis** that could be an answer or explanation to the question\ Make a **prediction** based on the hypothesis\ Test the hypothesis via **experimentation or discovery**\ **Analyze your data** and determine if your data supports or rejects your hypothesis\ Make a **conclusion based on the data**.\ Independent Variable-is the variable that is changed, this change influences the dependent variable.\ Dependent Variable-responds to the change in the independent variable\ Treatment groups- groups that are manipulated by the independent variable\ Control groups-groups that are not manipulated by the independent variable\ Replication-experiments should be repeatable and should be reproducible\ Qualitative: This kind of data include qualities such as color, smell and taste.\ Quantitative: These kinds of data include qualities that can be measured objectively such as weight, volume, length and temperature. Microscopy and types of cells\ 3-part cell theory: All life is composed of cells\ Cells are the functional units of life.\ All cells come from preexisting cells.\ Scanning electron microscope: Visualize cell surface, requires thin layer of metal coating the cell.\ High-resolution, three-dimensional images\ Focus beams of energetic electrons rather than photons\ Transmission electron microscope: Visualize internal cell structures\ Produce high-resolution, two-dimensional images\ Electrons replace photons\ Electromagnetic lenses replace glass lenses\ Images viewed on a screen not through an eyepiece.\ Microscope Usage\ Slide has not been left on the stage\ The scanning lens - 4x is "clicked" in place (the shortest lens)\ The light source is at lowest intensity using rheostat.\ The light source is turned off.\ The power cable is properly secured with velcro strap\ Magnification makes an object appear larger than it is in real life.\ Resolution -- means the ability to determine objects that are close together as two separate objects.\ This is the limiting factor of any microscope, magnification makes little difference if you cannot resolve two objects\ Features of plant cells\ Plant cells have some of the same organelles as an animal cell\ Plant cells also have some unique structures that are absent in animal cells:\ -Cell Wall-outer layer made of cellulose\ -Chloroplast -- Energy production via photosynthesis\ -Vacuole-in cytoplasm, stores water, pigment and waste\ Eukaryotic cells have common features enclosed by a plasma membrane\ Organelles are membrane-bound structures (e.g. nucleus, mitochondria and endoplasmic reticulum) that are found in eukaryotes\ Endoplasmic reticulum (ER) is a network of membrane that is continuous with the nuclear membrane of the nucleus, consists of both rough (protein synthesis) and smooth ER (lipid and hormone processing)\ Ribosomes are machinery for protein synthesis\ The nucleolus inside of the nucleus, site of synthesis of components of the ribosome from DNA and RNA translation\ The Golgi apparatus organelle involved in protein processing The Golgi apparatus organelle involved in protein processing\ \ **Streptococcus:** Circular and in chains\ **Staphylococcus:** Circular and in clusters\ **Streptobacillus:** Rod like and in chains Organic Molecules\ An organic molecule contains both carbon and hydrogen\ Methane is a simple organic molecule\ Living organisms primarily consist of four carbon-based compounds:\ Carbohydrates, proteins, and fats are common in our diets.\ Nucleic acids include DNA and RNA.\ These molecules contain genetic information.\ A monomer is a single unit of a carbohydrate, protein, or nucleic acid. Monomers join to form polymers.\ Carbohydrates include simple sugars and polysaccharides. Monosaccharides are the monomers of carbohydrates\ Disaccharides -- consist of two monosaccharides, example --sucrose, lactose and maltose\ Polysaccharides are long chains of carbohydrates\ Dehydration synthesis binds two amino acids, forming a dipeptide.\ Hydrolysis separates dipeptides into amino acids.\ An unsaturated fatty acid contains at least one double bond, so at least two carbons are only bonded to three other atoms.\ Double bonds create "kinks" in the fatty acids that prevent them from packing close together. Unsaturated fats like oils are therefore liquids at room temperature\ There are five types of nucleotides. DNA and RNA both incorporate adenine, cytosine, and guanine into their strands. Only DNA uses thymine. Only RNA uses uracil.\ **Benedict's** test will test for the presence of reducing sugars (simple sugars)\ **Lugol's** test will test for the presence of starch but not detect mono- or disaccharides\ **Biuret Reagent** will test for the presence of proteins but should not detect free amino acids\ **Brown Paper** will test for presence of lipids based on residue left behind. Membrane Transport\ Passive transport\ Simple Diffusion -- O2, CO2, & polar molecules\ Osmosis -- diffusion of water across semi-permeable membrane. The importance of water to living organisms resulted in a special name for the diffusion of water.\ Aquaporins -- proteins embedded in phospholipid bilayer that function as water channels\ Facilitated diffusion -- assisted but does not require energy\ Active transport -- energy cost to move substances across membrane against concentration gradient\ Exocytosis -- process of transporting large materials such as cell products or waste out of a cell and into the extracellular fluid outside the cell.\ Endocytosis -- Similar to exocytosis but moves materials including liquids into a cell by surrounding them with the cell's plasma membrane.\ Specific types of endocytosis -\ Pinocytosis -- liquids\ Phagocytosis -- larger solid substances\ Osmosis- movement of water molecules\ Simple: Small molecules\ Facilitated: Large or charged molecules down concentration gradient\ Active: against concentration gradient, requires energy Cellular Respiration\ Without ATP cells would die\ All organisms, from trees to whales to bacteria, use some form of cellular respiration to make ATP.\ The potential energy stored in glucose is extracted and that energy is put into ATP.\ \ In glycolysis, glucose is split in half, forming pyruvate. Some of the energy is transferred to electrons; some is used to form ATP.\ The Krebs cycle, occurs in the inner mitochondrial matrix where a derivative of pyruvate is oxidized; CO2 is released. More energy is transferred to electrons.\ In the electron transport chain (ETC), energy from electrons is used to form ATP. Oxygen is the final electron acceptor.\ Cellular respiration releases energy from glucose, one bond at a time, in a series of many steps.\ If all the energy were released at once, much of it would be lost as heat.\ The small steps allow cells to store more of the released energy in ATP.\ Glycolysis always occurs in the cytosol.\ In prokaryotic cells, the Krebs cycle takes place in the cytosol, and the ETC is found in the cell membrane.\ Eukaryotic cells contain mitochondria, specialized organelles where the Krebs cycle and electron transport chain are located.\ During glycolysis, one molecule of glucose is split into two three-carbon molecules of pyruvate.\ These reactions convert two molecules of ADP into ATP.\ Electron carrier NAD+ picks up electrons, forming two molecules of NADH.\ The potential energy from electrons is used to produce a proton (H+) gradient.\ H+ ions move through the enzyme ATP synthase, releasing energy.\ ATP synthase uses the energy to generate ATP. Photosynthesis\ Autotrophs make their own food, do not eat or decompose other organisms. They are producers. (auto = "self", troph = "nourishing")\ Photoautotrophs -- specific type of autotroph that is capable of capturing light energy then will undergo photosynthesis to produce glucose. (photo = "light")\ Heterotrophs must "consume" food from other sources and are thus classified as consumers. (hetero = "other")\ Green pigments are mainly responsible for absorbing light energy. They absorb violet, blue & red light better than light of other colors. Chlorophyll a and b reflect green light so plant leaves appear green to us. Chlorophyll A Chlorophyll B Auxiliary pigments such as carotenoids and anthocyanins absorb light in different ranges\ Carotenoids reflect yellows & oranges, absorb blue\ Anthocyanins reflect reds, purple & crimson, recover nutrients in the leaves before they fall off\ A photosystem is a large protein structure in the thylakoid membrane.\ Stage 1 -- Light Reactions or Photophosphorylation in the thylakoid\ Reactants - Light & water\ Products - ATP, NADPH & oxygen (waste)\ Stage 2 -- Dark Reactions/Carbon Reactions or Calvin Cycle in the stroma\ Reactants -- CO2 , NADPH & ATP\ Products -- Glucose DNA, cell cycle and mitosis\ Cell theory\ All cells come from other cells\ All organisms are composed of one or more cells\ The cell is the smallest unit that possesses the characteristics of life\ **3 Main Components of A Nucleotide**: - 5 carbon sugar - Phosphate group - Nitrogenous base - Pyrimidines --**Cytosine** (C), **Uracil** (U) and **Thymine** (T) - Purines -- **Adenine** (A) and **Guanine** (G) and **RNA contains Uracil (U) in place of Thymine**\ DNA stores instructions in the form of genes for traits or characters that enables an organism to develop, survive and reproduce.\ Stored in the form of DNA sequences known as a gene\ AGGTCTCCGGAATCCCTATT\ Code is converted to a message (mRNA)\ Message is used to produce proteins and RNA\ Proteins -- Do most of the work in cells of an organism\ Required for structure, function and regulation\ DNA provides a mechanism for passing hereditary information to next generation\ The cell cycle lasts from the beginning of one cell division until the beginning of the next.\ It includes the time when cells are dividing (mitosis) and the time when cells are not dividing (interphase).\ During interphase, cells are carrying out their normal everyday functions unrelated to cell division.\ For instance, cells express their genes, carry out active transport, and perform life's chemical reactions.\ In G1 phase, the cell grows and functions normally.\ Protein synthesis or Gene Expression occurs. (Central Dogma of Biology)\ If the cell is getting ready to divide, it will move into S phase. If not, it stays in G1.\ In S phase, the cell replicates its DNA, copying its entire genome---every chromosome.\ Now it is committed to divide. There is no going back after replication begins.\ During G2 phase, the cell produces organelles & other molecules that are needed for the two daughter cells.\ Cells leaving G2 phase enter mitosis, the division of the nucleus, which is followed by cytokinesis, the division of the cell itself.\ At the end of mitosis, two new daughter cells have exactly the same DNA as the parent cell.\ Prophase - chromosomes condense, spindle fibers grow from centrioles, nucleus breaks down & spindle fibers attach to centromere on chromosomes.\ Metaphase -- centrioles using spindle fibers will line up the sister chromatids along the equator (metaphase plate) of the cell\ Anaphase - sister chromatids are pulled apart by spindle fibers to opposite sides of the cell & cell stretches\ Telophase - chromosomes begin to unwind, the nucleus reforms\ Cytokinesis splits the cell\ The cytoplasm and the two nuclei are distributed into the two forming daughter cells, which then physically separate.\ After telophase, the cell will pinch off the cell membrane so that it forms a cleavage furrow between the two newly formed nuclei and will eventually divide the original single cell into two new daughter cells Meiosis\ Purpose is to make daughter cells with exactly half as many chromosomes as the starting cell.\ Normal human somatic (body) cells have 23 pairs of chromosomes.\ Each pair consists of one copy of entire genome from each parent. 23 from mother + 23 from father for a total of 46 chromosomes.\ After replication, the total number of chromatids = 92\ After cell division or mitosis each daughter cell needs to have exactly 46 chromosomes\ Gametes are haploid sex cells\ Haploid cells only have one set of chromosomes\ When two haploid cells fuse at fertilization, one diploid zygote is formed. A zygote is the first cell of a new organism\ The chromosomes of a homologous pair look alike and carry the same sequence of genes for the same traits.\ Members of a homologous pair may carry different alleles, which are alternative versions of the same gene.\ In Meiosis, DNA Replicates Once, but the Nucleus Divides Twice to Produce Gametes\ Crossing Over -- When does it occur in meiosis? Prophase I\ Independent Assortment or Orientation of Chromosomes -- When does it occur in meiosis? Metaphase I\ Random Fertilization -- When does it occur? When the egg is fertilized by the sperm\ During crossing over, two homologous chromosomes exchange genetic material during prophase I.\ Fraternal; two sperm cells fertilize two separate egg cells, and the offspring might look very different. Genetics and Inheritance part 1\ Phenotype- physical appearance, traits that are visible. How it looks.\ Genotype-actual genes present. The genes the organism carries.\ Trait- alternative forms are known as alleles, found at same place on a chromosome (example: blue or brown eyes) Homozygous-alleles are the same, (may be either dominant or recessive-PP, pp, TT, tt)\ Heterozygous-alleles are different---Pp, Tt\ Dominant alleles are written as upper case letters that represent the allele trait that "masks" or dominates over the other allele\ One copy of the dominant allele is enough for it to appear as a trait. This means that it can come from just one parent\ Recessive alleles are designated as lower-case letters, represent the allele trait that is hidden by the dominant allele\ Two recessive alleles must be inherited in order to appear as a trait.\ P = parent generation, True Breeding pair\ F1 = first generation (first filial)\ F2 = second generation (second filial)\ Mendel reasoned the white trait was not gone in the F1 but was being masked by the more dominant purple trait since it "reappeared" in F2 generation.\ Complete Dominance\ 1. One allele was not expressed in the F1 hybrids, although it reappeared in some F2 individuals. The trait that "disappeared" must therefore be latent (present but not expressed) in the F1 individuals.\ 2. Self-fertilization of F1 generation both alleles were represented in offspring of F2 generation.\ 4. These alternative traits were expressed in the F2 generation in the ratio of ¾ dominant to ¼ recessive. This characteristic 3:1 segregation is referred to as the Mendelian ratio for a monohybrid cross. Genetics and inheritance part 2\ Karyotyping - A method used to study abnormalities in chromosomes.\ Chromosomes are arranged\ based on size (arm length)\ position of the centromere\ pattern of the chromosome banding.\ Scientists look for missing, extra chromosomes or incomplete chromosomes\ Only gives a general idea, further molecular testing is required.\ Principle of Dominance: In a cross of parents that are pure (homozygous) for different traits, only one phenotype of the trait will appear in the next generation. Offspring that have a hybrid genotype will only exhibit the dominant trait.\ Principle of Segregation: During the formation of gametes the two alleles responsible for a trait separate from each other during meiosis. Alleles for the trait are "recombined" at fertilization, producing the genotype for the traits of the offspring.\ Principle of Independent Assortment: Inheritance of one trait, seed color has no effect on the inheritance of another trait, seed shape. The possible assortments can be determined by completing a dihybrid cross. All parts labeled