Pharmacogenetics & Pharmacogenomics PDF

PHARMACOGENETICS & PHARMACOGENOMICS Asst. Prof. Dr. Izzuddin Ahmad Nadzirin Department of Biomedical Science Advanced Pharmacology How do we know if a patient will respond (or have an adverse response) to a drug? Why does drug response vary?  LEARNING OBJECTIVES Define ph...

PHARMACOGENETICS & PHARMACOGENOMICS Asst. Prof. Dr. Izzuddin Ahmad Nadzirin Department of Biomedical Science Advanced Pharmacology How do we know if a patient will respond (or have an adverse response) to a drug? Why does drug response vary?  LEARNING OBJECTIVES Define pharmacogenetics and pharmacogenomics and able to distinguish between those two concepts. Understanding of our genetic code and its relationship to drug efficacy. Discuss on how does the concepts applied for personalized medicine. Discuss several examples of the personalized medicines in selected diseases.  INTRODUCTION Pathogenesis and the severity of the disease being treated. Drug interactions from concomitant treatments (plasma protein binding, metabolism) Individual’s age, gender, lifestyle (including environmental factors), behavior, nutritional state, renal and liver function, and concomitant illnesses. Genetic variation  A patient’s response to a drug may depend on factors that can vary according to the alleles that an individual carries, including Pharmacokinetic factors Absorption Distribution Metabolism Elimination Pharmacodynamic factors target proteins downstream messengers 6  Pharmacogenomics – The science of how the entire genome affect the way people people respond to drugs – How multiple genes collectively affect… …the way our body processes drugs (pharmacokinetics) …the interaction of drugs with receptors (pharmacodynamics) …the treatment efficacy and adverse side effects Pharmacogenetics – A subset of ‘pharmacogenomics’ – The study of how inherited variation on one or a few genes affects drug response and metabolism  PHARMACOGENETICS A study of genetically controlled variations in drug response. Pharmacogenetics is the special area of biochemical genetics that deals with variation in drug response and the contribution of genetics to such variation. It is a subset of Pharmacogenomics and is the study of variations in DNA sequence as related to drug response. 8  Key Concepts and Terms Monogenic: due to allelic variation at a single gene Polygenic: due to variations at two or more genes Polymorphic: frequently occurring monogenic variants occurring at a frequency >1% 9  Normal Distribution Frequency Activity 10 Polymorphic Distribution 11 Genetic polymorphisms in drug metabolizing enzymes al genom 12  Codeine metabolised to morphine for analgesic Warfarin/acenocoumarol – blood thinning, reduced metabolism leads to hemorrhage Isoniazid – antibiotic for TB, reduced metabolism can cause hepatotxicity Antipsychotic drug Mercaptopurine, azathioprine – indicated for cancer and autoimmune disease, reduced metabolism results in myelosuppression (condition in which bone marrow activity is reduced) low RBC, WBC, platelets. Irinotecan – indicated for cancer, antineoplastic enzyme inhibitor interfere with cell communication and growth Interferon/ribavirin – prodrug, reduced metabolism causes low drug bioavailability 13  3 mechanisms on how genetic influences pharmacotherapy 1 - Genetic Polymorphism of genes ➔ which results in Altered metabolism of drugs (metabolism of tricyclic antidepressants) Increased or decreased metabolism of a drug may change its concentration of active, inactive or toxic metabolites. 14 2 – Genetic variants ➔may produce unexpected drug effect (toxicity or it may be lethal to patient) Hemolysis in glucose -6 –phosphate dehydrogenase deficiency 3 – Genetic variation in drug targets May alter the clinical response & frequency of side effects Variants of β –adrenergic receptor alter response to β – agonists in asthmatic patients G6PD deficiency (Glucose-6-Phosphate Dehydrogenase deficiency) is a genetic disorder that affects red blood cells. It is caused by a deficiency in the G6PD enzyme, which is important for protecting red blood cells from damage caused by oxidative stress. Many people with G6PD deficiency have no symptoms until their red blood cells are exposed to certain stressors. These can include infections, certain medications (e.g., some antibiotics, antimalarials, and pain relievers), foods (like fava beans, leading to a condition called favism), exposure to certain chemicals (such as naphthalene in mothballs) β2-adrenergic receptor is primarily found in the lungs and regulates bronchial smooth muscle relaxation. β2-agonists are drugs (like albuterol) that activate the β2-adrenergic receptors, causing the smooth muscles in the airways to relax, leading to bronchodilation. People with the Arg16 variant may experience receptor desensitization after repeated use of β-agonists, meaning the drug may become less effective over time. In contrast, those with the Gly16 variant tend to have better responses to acute β-agonist therapy. Moreover, individuals with the Glu27 variant may have less downregulation of the β2-adrenergic receptor, leading to a more sustained response to β-agonists. Those with the Gln27 variant might be more prone to receptor desensitization. 15  Why is this a good approach? Drugs can be dangerous – Many people have severe adverse reactions to drugs – Many people respond to drugs at different doses – Many drug treatments are horribly unpleasant, painful Drugs are expensive (to take and to make) – Ineffective drugs are a waste of money to take – Drug development needs to account for response variability Genetics provide a priori information – Genetics don’t change (except in cancer) – Genetics can point to the cause not just the symptom  The waaay waaay back…. Pythagoras (the triangle guy) – Ancient Greek mathematician and philosopher Pythagoreanism (his belief system and moral code) forbid eating and even touching of beans Reasons: ‘seed of life,’ looks like genitals, flatulence, damaging (Aristotle) Genetic glucose-6-phosphate dehydrogenase (G6PD) deficiency causes induced hemolytic anemia or ‘favism’ The waaaay back… 1931 - DuPont chemist Arthur Fox PTC (phenylthiocarbamide) Lab accident led to the discovery of ‘taste blindness’ 1959 - Freidrich Vogel coined the term “pharmacogenetics” after discovering polymorphic enzymes  Early studies… Fast increase in awareness CYP2D6 of the interaction of drug 1975 Smith and colleagues and drug response ingest a drug they are testing He had a bad reaction but his Many family studies, twin colleagues did not studies and ‘top-down’ Family studies revealed genetic studies genetic inheritance Very laborious Enzyme discovered and experimental work characterized through the study enzyme Enzyme cDNA sequenced and actions and clinical variants found (1990) observation This family of gene important for many drugs PCR sped things up a bit  The transition to the modern era… Human Genome Project and technological developments expanded the possibilities HGP ran from 1990 to 2003. 20k to 25k genes were identified. A brief aside into modern genetics  SNPs Single Nucleotide Polymorphisms Most common and well studied form of variation Defined by a population frequency > 1% A SNP represents a variation at a single base pair in the DNA sequence. 1. Synonymous SNP (Silent Mutation): This type of SNP occurs in the coding region of a gene but does not change the amino acid sequence of the protein. The change in the DNA sequence is "silent" because the altered codon still codes for the same amino acid due to the redundancy in the genetic code. Example: Both GAA and GAG code for the amino acid glutamic acid, so a change between these codons does not affect the protein. 2. Non-synonymous SNP (Missense Mutation): In this type of SNP, the single nucleotide change alters the amino acid sequence of the protein. This may affect protein function or stability. Example: A change from GAA (glutamic acid) to GCA (alanine) would result in a different amino acid, potentially altering the protein's structure and function. 3. Nonsense SNP: A nonsense SNP introduces a premature stop codon in the sequence, resulting in a truncated (shortened) protein. This type of SNP often leads to a nonfunctional protein or severe loss of function. Example: A change from TGG (tryptophan) to TGA (stop codon) would terminate the translation prematurely. 4. Non-coding SNPs: These occur in regions of the DNA outside of the coding sequences (exons). Although they do not change the protein directly, non-coding SNPs can still affect gene expression and regulation by impacting promoters, enhancers, splicing sites, or other regulatory elements. Example: SNPs in promoter regions can influence the level of gene expression by affecting how transcription factors bind to the DNA. 5. Splice Site SNP: Splice site SNPs occur at splice junctions, where introns are typically removed from the pre-mRNA transcript. These SNPs can result in incorrect splicing, leading to the inclusion or exclusion of certain exons, potentially producing an abnormal protein. Example: A mutation at the splice donor or acceptor site could cause aberrant splicing of the pre-mRNA.  The Technology: Genotyping Uses a microarray to measure a limited predefined set of SNPs Very high throughput (fast) Very inexpensive (cheap) Excellent coverage of common variation (up to Microarray 5,000,000 SNPs) Microarrays are small chips containing thousands to millions of DNA probes that are designed to detect specific predefined SNPs (genetic variants). These probes are complementary to known SNP sequences across the genome. The microarray can only detect the specific SNPs it has been designed to target, which means it cannot identify new or rare variants that are not included in the predefined set. This makes it ideal for studying common SNPs but limited when it comes to discovering new or rare mutations. ATCGAAATGCATGACCTTTGATATGATCGGCTGCAGTCAGC TTCGAAGTGCATGACTTTTGACATGAGCGGCGGCCCACAGC Common Variation Rare Variation No Recorded Variation GWAS (Genome-Wide Association Study) is a research approach used to identify genetic variants (like SNPs) across the entire genome that are associated with specific traits, diseases, or conditions. GWAS typically compares the genomes of individuals with a particular trait or disease (cases) to those without it (controls) to find genetic markers that are more common in the cases. These markers may point to genetic regions involved in the development of that trait or condition.  The Technology: Deep Sequencing Captures every base pair in the genome (3,000,000,000) (Currently) low throughput (slow) (Currently) Very expensive (> 10k) Captures common, rare, and personal variation New and hard to analyze Sequencer Whole-genome sequencing (WGS) sequences every base pair of an individual's DNA, covering all 3 billion base pairs in the human genome. Unlike targeted sequencing approaches (like SNP arrays or exome sequencing), WGS captures both coding and non-coding regions of the genome. While whole-genome sequencing technology has advanced, it remains relatively slower compared to targeted methods like SNP microarrays or exome sequencing. ATCGAAATGCATGACCTTTGATATGATCGGC TGCAGTCAGC TTCGAAGTGCATGACTTTTGACATGAGCGGCGGCCCACAGC Common Variation Rare Variation No Recorded Variati  Back to the drugs… The Impact of pharmacogenetics concept: – Determining appropriate dosing – Avoiding unnecessary toxic treatments – Ensuring maximal efficacy – Reducing adverse side effects – Developing or choosing novel treatments – Can also explain variable response to illicit drugs  Warfarin: A dosage story Most widely used anticoagulant in the world – A “blood thinner” Prescribed doses vary widely (1-40mg / daily) Therapeutic index is very low – High risk of bleeding early in treatment Two genes involved in metabolism: CYP2C9 and VKORC1 CYP2C9 is a gene that encodes the cytochrome P450 2C9 enzyme, which plays a crucial role in the metabolism of warfarin. VKORC1 encodes the Vitamin K epoxide reductase complex subunit 1, a key enzyme in the vitamin K cycle. This enzyme helps regenerate reduced vitamin K, which is necessary for the activation of clotting factors (factors II, VII, IX, and X). Warfarin works by inhibiting VKORC1, thereby reducing the production of active clotting factors and slowing down blood clotting. Homozygous wild-type CYP2C9 and VKORC1 Carrier of CYP2C9 mutant allele Carrier of VKORC1 mutant allele INR stands for International Normalized Ratio, which is a measure of how long it takes for blood to clot. It is commonly used to monitor patients on anticoagulant medications, such as warfarin. The INR helps standardize prothrombin time (PT) results, ensuring that results are comparable across different laboratories. High INR = slower clotting - VKORC1 - Patients with A/A genotype require lower doses of warfarin because they are more sensitive to the drug.Patients with G/G genotype are less sensitive and may require higher doses to achieve the desired anticoagulant effect. CYP2C9 genotype Time to stable dose *1/*1 extensive(normal) metabolizer 4 - 5 days *1/*2 intermediate metabolizer 8 -10 days *1/*3, *2/*2, *3/*3 intermediate or 12-15 days poor metabolizer Plavix: A story about effectiveness Anti-clotting drug Prescribed for coronary artery disease and those who have suffered a heart attack or stroke or have a stent A “pro-drug” – Converted to active form in the liver by CYP2C19 CYP2C19 mutant carriers had reduced presence of the active ingredient (pharmacokinetics) and reduced ‘thinning’ (pharmacodynamics)  Percent difference in AUC: presence of active ingredient (clopidogrel is a prodrug). Mutated CYP2C19 reduces the metabolism of clopidogrel and thus, less active metabolite detected. Absolute difference in MPA: reduction in platelet aggregation. Mutation causes smaller reduction in platelet aggregation compared to normal, which means the effect of clopidogrel is less than normal people.  Pegasys: A toxic treatment story Pegylated Interferon α-2a – Interferons are proteins made in response to virus Treatment for Hepatitis B and C Virus Highly toxic treatment Highly variable response, especially in African Americans Very expensive Pegasys is a type of immunomodulator, meaning it works by boosting the immune system's ability to fight viral infections. It: Enhances the activity of immune cells such as natural killer cells and macrophages. Inhibits viral replication by promoting the production of proteins that interfere with the virus's ability to multiply. Activates genes involved in the antiviral response, which helps the body to control or eliminate viral infections. - Side effects like flu-like symptoms, bone marrow suppression, liver toxicity, and autoimmune reactions - Specific polymorphisms, like the rs12979860 C/T variant of IL28B gene, have been associated with better responses to interferon-based therapy: CC genotype: Associated with a higher likelihood of achieving a sustained virologic response (SVR), meaning the virus is undetectable after treatment, compared to CT or TT genotypes. TT genotype: These patients are less likely to respond to Pegasys treatment.  One mutation in the IL28B gene (a natural interferon) increased efficacy two-fold This mutation is different in different ethnicities and explains half of the ethnic variability in treatment  T/T is normal. C/C is mutated for both alleles. So the mutated has increased response towards pegsys. Also, variation between ethnics also play role. In this case, individual variation of the gene as well as ethnic variabilities play role in dictating the function of IL28B gene. High SVR % indicates treatment is highly effective in eradicating the virus. Cancer Treatments: A story about the future?  Ozzy Osbourne: A story about different drugs John Michael "Ozzy" Osbourne (born 3 December 1948) is an English musician and media personality. He rose to prominence during the 1970s as the lead singer of the heavy metal band Black Sabbath Personalized Medicine What questions lead to Personalized Medicine? Medicine is personal: – We are all different. – Some of our differences translate into how we react to drugs as individuals. – This is why personalized medicine is important to everyone. Why does someone need twice the standard dose to be effective? Why does this drug work for you but not me? Why do I have side-effects and you don’t? Why do some people get cancer and others don’t? Why is anecdotal information irrelevant to your own health and treatment?  How can the knowledge we obtain from sequencing our DNA help in the control of disease? What hypothesis can you come up with in applying the data obtained from sequencing our DNA? How can Pharmacogenetics help in personalized medicine? Explain the relationship between pharmacogenetics and microarray technology. How can we prevent the use of ineffective prescribed medications? What facts would you select to support personalized medicine using pharmacogenetics? What variants in a gene does this patient have? What is this patient’s phenotype high/normal/low metabolizer? What dose of a drug, if any, or of another drug, will work best for a patient? What steps are needed to implement pharmacogenetics as part of personalized medicine? 40  Personalized Medicine There is an emerging goal among ‘translational scientists’ to make medical practice more personalized Pharmacogenetics is an important step towards that goal The effects of this movement are seen in many aspects of society  Variability of Disease Variability of Disease Courtesy Felix W. Frueh The Goal of Personalized Medicine The Right Dose of The Right Drug for The Right Indication for The Right Patient at The Right Time. Courtesy Felix W. Frueh  Purine Analogs: A Case Study in Pharmacogenetics 6-mercaptopurine, 6-thioguanine, azathioprine Used to treat lymphoblastic leukemia, autoimmune disease, inflammatory bowel disease, after transplant Interferes with nucleic acid synthesis Therapeutic index limited by myelosuppression (treatment limited by immune suppression side effect) Azathioprine is the prodrug which will be metabolised into 6-MP. 6-MP will also be activated by converting into 6-thioguanine. In practice, azathioprine is the more frequently prescribed medication, with 6-MP being its active metabolite. 6-mercaptopurine 6-thioguanine azathioprine  Metabolism of 6-MP TPMT - Thiopurine S- methyl Transferase XO - Xanthine Oxidase HPRT - Hypoxanthine- Guanine Phosphoribosyltransferas e IMP - Inosine Monophosphate GMP - Guanosine Monophosphate L Wang and R Weinshilboum, Oncogene 25, 1629-1638 (2006) Pharmacogenetics: A Case Study Courtesy of Michelle Whirl-Carillo Pharmacogenetics: A Case Study Courtesy of Michelle Whirl-Carillo Pharmacogenetics: A Case Study Courtesy of Michelle Whirl-Carillo Thiopurine S-methyl Transferase Activity and Personalized Dosage Eichelbaum et al., Annu. Rev. Med. 2006.57:119-137.  Second Example: Codeine and Cytochrome P450 CYP2D6 Codeine is a commonly used opioid – Codeine is a prodrug – It must be metabolized into morphine for activity Cytochrome P450 allele CYP2D6 is the metabolizing enzyme in the liver 7% of Caucasians are missing one copy of the Cytochrome P450 CYP2D6 gene – codeine does not work effectively in these individuals Courtesy of Michelle Whirl-Carillo Codeine and Morphine Metabolism Courtesy of Michelle Whirl-Carillo  Cytochrome Oxidase P450 Enzymes 57 Different active genes 18 Different families CYP1, CYP2 and CYP3 are primarily involved in drug metabolism. CYP2A6, CYP2B6, CYP2C9 ,CYP2C19, CYP2D6, CYP2E1 and CYP3A4 are responsible for metabolizing most clinically important drugs Polymo rphic Cytoch rome P-450s © 2006 American Medical Association. All rights reserved Effect of Metabolic Rate on Drug Dosage © 2006 American Medical Association. All rights reserved Warfarin: Significant Problems for Rats!  Warfarin: Significant Problems for Humans! Ranks #1 in total mentions of deaths for drugs causing adverse events (from death certificates) Ranks among the top drugs associated hospital emergency room visits for bleeding Overall frequency of major bleeding range from 2% to 16% (versus 0.1% for most drugs) Minor bleeding event rates in randomized control trials of new anticoagulants has been as high as 29% per year. Warfarin: Significant Problems for Humans! Case Report July 2, 2008 – Company director dies of brain hemorrhage after heading a football – Consultant neurosurgeon told the inquest the warfarin effect was probably the cause of the death – It can happen to anyone! Other Warfarin Patients Case Report July 2, 2008 – Joseph Stalin  Why Maintaining Warfarin Therapeutic Range is Critical European Atrial Fibrillation Trial Study Group, N Engl J Med 1995;333:5-10.  Finding Doses to Maintain Therapeutic Anticoagulation is Largely Trial and Error  Warfarin Levels Depend on Two Enzymes – CYP2C9 & VKORC1 PCA – procoagulant activity  Frequency of VKORC1 Alleles in Various Populations Sconce et al. Blood 2005, Yuan et al. Human Mol Genetics 2005, Schelleman et al. Clin Pharmacol Ther 2007, Montes et al Br J Haemat 2006 Genetic Analysis Permits: More rapid determination of stable therapeutic dose. Better prediction of dose than clinical methods alone. Applicable to the 70-75% of patients not in controlled anticoagulation centers. Reduces between 4,500 and 22,000 serious bleeding events annually. Genetic testing now required by FDA 23andMe Drug Response Reports What are Targeted Drugs? Often, drugs are only effective in specific “sub-populations” (responders). Early identification of responders can have a dramatic effect of treatment success. Treatment of non-responders puts these individuals at unnecessary risk of adverse events, while providing no benefit. Personalized Medicine allows the identification of responders and non- responders for targeted therapies. Personalized Drugs Herceptin (breast cancer, target: Her2/neu) Erbitux (colorectal cancer, target: EGFR) Tarceva (lung cancer, target: EGFR) Strattera (attention-deficit/hyperactivity disorder, Metabolism: P4502D6) 6-MP (leukemia, Metabolism: TPMT) Antivirals (i.e. resistance based on form of HIV) etc. and the list is growing rapidly... FDA Requires Genetic Tests for Certain Therapies Courtesy of Michelle Whirl-Carillo Roche Chip for Cytochrome P450 Genes: CYPC19 and CYP2D6 Xie and Frueh, Pharmacogenomics steps toward Personalized Medicine, Personalized Medicine 2005, 2, 325-337  Variability Among Patients Variability Among Patients Courtesy Felix W. Frueh