BIOL 112 Practice Questions Spring 2024 PDF
Document Details
Uploaded by ChampionChrysoberyl
University of British Columbia
2024
Tags
Summary
This document provides practice questions for BIOL 112 Unit 2, covering nucleic acids, DNA assembly, and organization, in addition to biological information flow and transcription, for spring 2024. The questions are organized by topic and include study questions, exam-style questions, and open-response questions (ORQs).
Full Transcript
BIOL 112: Unit 2 Practice Questions Up dated Spring 2024 T his document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you co...
BIOL 112: Unit 2 Practice Questions Up dated Spring 2024 T his document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you could answer each objective if it was in the form of a question. There are different levels of questions provided: 1. S tudy questions: these are questions on your directknowledge of the topics, so essentially covers the basics & helps you practice to make sure you get the fundamentals. Work with these questions first to build up your skills. 2. Exam Style questions: Can be multiple choice, multipleanswers: these are the types of questions you are likely to see on the exam – various levels of application of the fundamental knowledge and skills for each topic area. 3. Open response questions (ORQs): a few examplesto give you an idea of the kinds of short answer questions you will see on the exams. _____________________________________________________________________ nit 2-1: Nucleic Acids - Structure, DNA assembly and U organization Unit 2-1: Study questions: 1. W hat interactions serve to stabilize/hold DNA together in its secondary structure? Explain how this stabilizes DNA in its aqueous environment. ydrogen bonds between strands (base pairing), stacking interactions (mostly ID-ID) above and below H in the same strand. The stacking interactions allow for the hydrophobic surfaces to be excluded from water, allowing water to have more motional freedom and thereby increasing stability. 2. B y convention how is the directionality of a DNA molecule written? 5’ to 3’ 3. B y convention how is the directionality of a protein molecule written? N to C 4. Which linkage forms the backbone of a nucleic acid? A. A base-phosphate linkage B. A Sugar-phosphate linkage C. A sugar-base-phosphate linkage D. A sugar-base linkage 5. In describing DNA or RNA, you will see the term 5’ to 3’ (verbally, this is “5-prime to 3-prime” or “3’-prime to 5-prime”). The terms 5’ and 3’ (or 3’ to 5’) apply to which of the statement(s) below? Choose all that apply. A. One of the two DNA strands. B. The sequence of the bases in the DNA or RNA. C. The direction of the strands. D. Particular carbon atoms on the ribose or deoxyribose ring. E. The linkage between the ribose ring and the base. Unit 2-1: Exam Style Questions: 6. In a bacterium, 14% of the DNA nucleotides were found to be Thymine. What proportions of the bases would be Guanine? A. 28% G B. 36% G C. 14% G D. 58% G E. Cannot be determined. 7. In normal double-stranded DNA, purines base pairs with only certain types of pyrimidines. This is because… A. a purine-purine pair would be too small, and a pyrimidine-pyrimidine pair would be too large B. the number of A must equal the number of T and the number of G must equal the number of C C. the strongest stacking interactions are found between purines and pyrimidines, making the DNA more stable D. purine-pyrimidine pairs maximize the number of hydrogen bonds, making the DNA more s table. E. all Watson-Crick purine-pyrimidine base pairs have the same geometries 8. T wo strands of a short DNA molecule with 3 base pairs are shown below. The dotted lines indicate hydrogen bonds. Five atoms are labelled from 1 to 5. Indicate which label correctly points to one of the 5’ ends of one of the DNA strands. . A 1 B. 2 C. 3 D. 4 E. 5 9. D NA is double stranded and the two strands are said to run in an antiparallel fashion. The term antiparallelrefers to which observation? . O A ne strand of DNA is identical to the other but is simply the mirror image B. One strand of DNA is complementary to the other but they both run in the same direction from 5’ to 3’ C. One strand of DNA runs 5’ to 3’ while the other strand runs in the opposite direction from 3’ to 5’ 10.Anti-parallel strands of DNA form complementary base pairing by hydrogen bonds. Which of the following statements is false regarding base pairing? A. A denine always base pairs with thymine while guanine forms three hydrogen bonds with cytosine. B. A purine will always base pair with a pyrimidine to correctly align the bases to maintain a uniform DNA double helix. C. One set of the complementary base pairs has stronger interactions via H bonds. D. Adenine is always linked to a thymine by a phosphodiester bond. Unit 2-1: Open Response (ORQ) Style Questions 1.Label the ends of the two strands of DNA below to indicate their directionality. 1 Assuming this small segment of DNA was part of a larger segment of DNA not shown, indicate where a new nucleotide would be added if either of these strands were extended further. A new nucleotide would be added to the 3’ end of the strand with a free OH group. Unit 2-2: Biological information flow Unit 2-2 Study Questions: 1. Transcription is the process of copyingDNAtoRNA 2. Translationis the synthesis ofproteinfrom mRNA. 3. D escribe the general difference between DNA replication and Protein synthesis. When does the cell use either of these processes? Are there similarities? Unit 2-3 Transcription-Gene structure Unit 2-3 Study Questions: 1. Transcription comparison: ompare/contrast… C E ukaryotes acteria B Chromosome structure Contains histones Does not contain histones (nucleosomes) S ite of transcription Nucleus ytoplasm C What is the promoter structure? TATA box, 25 bp upstream -35 box and -10 box What are the proteins involved General transcription factors Sigma contacting the promoter? Tata Binding Protein (TBP) Is splicing (removal of introns) Yes No required? Capping and tailing of mRNA? Y es o N Site of translation Cytoplasm Cytoplasm Can translation occur while No Yes transcription is still occurring? 2. In transcription, which structural elements of a gene correspond to a typical bacteria vs. eukaryotes? What is the function of each? Gene structure Bacteria Eukaryotic Description and Function l Gene? Gene? √ √ romoter P √ √ inds the RNA Polymerase B Introns √ Sequence that are cut out in RNA processing/splicing Stop codon Does not function in transcription, only TRANSLATION! Codes for the end of protein synthesis. ’ CAP 5 √ Added to mRNA once the 5’ end is synthesized. TATA box √ sequence on Euk promoter, TBP/general transcription factors bind here - 10 and -35 box √ sequence on Bac promoter, sigma binds here Template strand √ √ DNA strand that Codes for the mRNA Transcription √ (+1 √ First base that is transcribed into mRNA start site site) Bac = ~10 bases from -10 box Euk = ~25 bases from TATA box Terminator √ √ Terminates transcription – (hairpin) Bac = hairpin loop, Euk – multiple repeat sequences + 1 site √ √ F irst base that is transcribed into mRNA Start codon Does not function in transcription, only TRANSLATION! Exons √ Coding regions that may be spliced out or kept in a mRNA transcript. ibosomal R Does not function in transcription, only TRANSLATION! binding site Non-template √ √ pposite strand of the template but often used to read O /coding the code! (Same sequence as the mRNA except with T’s instead of U’s. Poly A tail √ Added after mRNA made in Euk. Unit 2-3 Exam Style Questions: S ee the Mastery Learning Modules Activities for Practice Problems on this unit. This can be found on the BIOL 112 Tutorial Canvas site under Mastery Learning Modules Unit 2-4: Transcription-Mechanism of transcription Unit 2-4 Study Questions: 1. T ranscript initiation and processing comparison: Compare and contrast E ukaryote B acteria s S plicing (yes or no) Yes No Site of initiation for transcription (promoter structure) TATA box -35 and -10 box NA has 5’cap (yes or no) R yes no RNA has 3’ poly A tail (yes or no) yes no Unit 2-4 Exam Style Questions: 2. T ranscription factors only bind specific DNA sequences. What part of the DNA molecule would you predict is most important forspecificinteractionsbetween a transcription factor like Sigma and the promoter sequence it binds? A. Deoxyribose B. The phosphate group C. The bases D. The major and minor grooves 3. What determines where theE. coliRNA Polymeraseinitiates transcription? A. The binding of the RNA Pol to the single unique origin of transcription downstream on the E. colichromosome. B. The binding of the sigma subunit to the DNA binding sequences upstream of the transcription start site. C. The binding of the sigma subunit to the DNA binding sequences downstream of the transcription start site. D. At the RNA stem loop that forms at a DNA binding sequence 5’ of the transcription start s ite. E. RNA Pol initiates transcription at the first AUG codon of each gene. . What features of a DNA binding protein are required to recognize the correct binding site on 4 DNA? 1. They can make specific ionic interactions with the phosphodiester backbone of the DNA only at that sequence. 2. They make specific non-covalent interactions with the exposed bases of the DNA only at that sequence. 3. Part of their 3D structure is the right size/ shape/charge/polarity to interact with the major and minor grooves of that sequence of DNA. A. 1 and 2 . B 2 and 3 C. 1 and 3 D. 3 only E. All 3. Which of the following describes the comparison of typical bacterial and eukaryotic mRNAs? A. Eukaryotic mRNAs have 5’ untranslated regions, but bacterial mRNAs do not. B. Eukaryotic mRNAs are spliced before translation but bacterial mRNAs are not. C. Eukaryotic mRNAs have several open reading frames, but bacterial mRNAs have only one. D. Bacterial RNA polymerases are the same as RNA polymerases in eukaryotes. E. Eukaryotic mRNAs can accommodate several ribosomes, but bacterial mRNAs cannot. 4. The fact that translation is not simultaneous with transcription in eukaryotes is primarily due to: A. the fact that introns are spliced from eukaryotic mRNAs before translation. B. the fact that eukaryotic mRNAs need a polyA tail to be translated. C. the fact that eukaryotic mRNAs need a 5' cap to be translated. D. the fact that the processed mRNA needs to be exported to the cytoplasm for translation. E. the fact that the DNA must be decondensed in the nucleus before transcription. 5. W hich of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells? 1. Sigma factor. 2. General transcription factors. 3. RNA Polymerase. 4. TATA Binding Protein. . A and 3 1 B. 1, 2, 3 C. 2, 3, 4 D. 2 and 3 only E. 3 and 4 only 6. Which of the following statements about alternative splicing are true? 1. introns are spliced out and exons are joined together. 2. exons are spliced out and introns are joined together. 3. is a form of post-translational control of gene expression. 4. reduces the number of genes needed to express different proteins. . A only. 2 B. 1, 3 and 4. C. 3 and 4. D. 1 and 4. E. 1 and 3. 7. W hat would happen to an mRNA strand in a eukaryotic cell if during RNA processing the poly A tail is not added? CHOOSE ALL THAT APPLY A. Nothing. The tail is just a way to mark the 3’ ends of the mRNA strand. B. T he mRNA strand would not be able to leave the nucleus as the tail is necessary to pass through the nuclear membrane. C. The mRNA strand would no longer be protected by the poly A tail and would be more easily degraded by ribonucleases. D. The mRNA strand would be transported into the mitochondria where poly A tails are not required from translation. E. The mRNA would be translated in the nucleus. 8. An intron is _______________________; and an exon is typically _________________. A. RNA that is removed during the processing of an mRNA molecule and leaves the nucleus; part of an intact, mature mRNA that stays in the nucleus. B. a peptide sequence that is spliced out post-transcriptionally; a peptide sequence spliced out post-translationally. C. RNA that is removed during the processing of an mRNA molecule and degraded in the nucleus; part of an intact, mature mRNA that leaves the nucleus. D. part of a tRNA that binds to the codon during translation; part of mRNA that has the ORF. E. part of an rRNA that becomes part of the ribosomes; part of the mRNA that has the ORF. Unit 2-4 Open Response Style (ORQ) Questions: 9. Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predictwhat would be the effect on the protein-DNAbinding. See next page… ould this replacement have an effect on transcription of this gene?Explainyour reasoning for your C prediction. If Serine were in the protein there would be a substantial decrease in R-group size, and there would be no possibility for ionic bonds, decreasing the strength and frequency of protein-DNA binding. This would likely result in less frequent transcription. ompared to the original situation: In the DNA sequence, if guanine were replaced by thymine C (shown at right),predictwhat would be the effecton the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explainyour reasoning for your prediction. ith a base substitution, different non-covalent interactions will be possible between W the protein and the side of the base. i.e. from purine to pyrimidine structures This could also perturb the regular structure of the DNA. For both of these reasons, it is likely that the frequency of protein-DNA binding will decrease. This would likely result in less frequent transcription 10.The cartoon below represents the process of transcription as observed in an electron micrograph. On the diagram below indicate the directionality (5’ or 3’) in the boxes against the structure. Unit 2-5: Translation Unit 2-5 Study Questions: 1. H ow is translation initiated in bacteria? What part of the mRNA transcript does the ribosome bind to? How does this differ in Eukaryotes? 2. What specific sequence or region leads to transcription termination and translation termination? The terminator sequence mediates transcription termination. Translation is terminated by the stop codon. 3. If a given tRNA has an anticodon of 5’-ACU-3’, what is the mRNA codon, what is the template s trand DNA sequence, and which amino acid does it carry? (3points) tRNA 3’ UCA 5’ or 5’ ACU 3’ mRNA: 5’- AGU-3’ or 3’-UGA-5’ template strand: 5’-ACT-3’ or 3’-TCA-5’ Amino acid: Ser Unit 2-5 Exam Style Questions: 4. G iven that there are 61 codons for the 20 amino acids, which of the following is good evidence for the wobble hypothesis? A. The genetic code is a triplet. B. There are three different termination codons but only one start codon. C. The tRNAs are the main translators of protein synthesis. D. Wobble controls the number of proteins translated from each mRNA. E. The fewer than 60 different types of tRNA in a cell. 5. T he DNA sequence below (the template strand) is partof the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines) ' – ACG|ATT|CTT|TGC - 5 3 5’ - UGC UAA (stop) . A - alanine - lysine - asparagine - arginine - C N B. N - cysteine - asparagine - valine - serine - C C. N - threonine - isoleucine - leucine - cysteine - C D. N - cysteine – C E. More information is needed to answer this question. 6. A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The s equence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA? . 1 ’-CAATTTAGCAGA-5’ 3 2. 3’-AGTCGGTTCGAT-5’ 3. 3’-AGACGATTTAAC-5’ 4. 3’-GTTAAATCGTCT-5’ 5. 3’-TCTGCTAAATTG-5’ 6. 3’-AGACGATTCGAC-5’ . A only 1 B. 4 only C. 1, 4 and 5 only D. 2 and 3 only E. 2, 3, and 6 only 7. Shown below is a portion of an mRNA stretch, starting at the start codon: AUG GGG AGU AAA UUU The DNA encoding this region would be correctly written as: A. 3’ ATGGGGAGTAAATTT 5’ 5’ TACCCCTCATTTAAA 3’ B. 5’ ATGGGGAGTAAATTT 3’ 3’ TACCCCTCATTTAAA 5’ C. 5 ’ TTTAAATGAGGGGAT 3’ 3’ AAATTTACTCCCCTA 5’ D. 3 ’ TTTAAATGAGGGGAT 5’ 5’ AAATTTACTCCCCTA 3’ 8. What is the function of aminoacyl-tRNA synthetases? A. They catalyze the folding of the tRNA into a cloverleaf structure. B. They catalyze the modification of the bases in tRNAs. C. They catalyze the correct alignment of the mRNA codon with a tRNA anticodon. D. They catalyze peptide-bond formation between two amino acids. E. They catalyze the covalent attachment of an amino acid to the correct tRNA. 9. Which of the following statements about translation in bacteria are TRUE? 1. Proteins called initiation factors contribute to the interaction between the RNA in ribosome s mall subunit at the 5’ cap. 2. An internal sequence in the mRNA specifies where the ribosome binds. 3. Complementary sequences in the tRNAs translate mRNA sequence into protein sequence. 4. Some regions of the mRNA are removed before translation. 5. A release factor ends protein synthesis by binding to the stop codon and to trigger the release of the polypeptide chain. . A , 2 and 3. 1 B. 1, 3 and 4. C. 2 and 4. D. 2, 3 and 5. E. 2, 3, 4 and 5. 10.Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell? 1. There are more places to control protein synthesis. 2. More proteins can be produced in a given time period. 3. Resolves the problem of the ribosomes being too large to interact with DNA. 4. DNA does not need to have the sequence for the ribosome binding sites (RBS). . A and 2. 1 B. 2 and 3. C. 3 and 4. D. 1, 2 and 3. E. 2, 3 and 4. Unit 2-5 Open Response Style (ORQ) Questions: 11.Not all mutations in aprotein coding regioncausea change in phenotype. Explain giving 2 examples. Example: If say a silent mutation will result in no change in phenotype then you must add that there is no change in the polypeptide and/or no change in the shape and function of the protein. If you use base-substitution mutations for both examples then you must explain 2differentways this can result in no change in phenotype. Some examples…The genetic code is degenerate – some amino acids have more than one codon and a mutation in a codon can result in the same amino acid and no change in the protein. Amino acid substitutions of similar types might not lead to a change in protein function or the s ubstitution is present in the polypeptide chain that does not change the protein shape (folding) or function. 12.Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. T he nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. (F) The nitrogenous base thymine is present in DNA while uracil is present in RNA in place of thymine. B. A hydrogen atom is present on the 3’ carbon of the “ribose” of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. (F) A hydrogen atom is present on the 2′ carbon the ribose of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. C. Ribosomes transcribe RNA and RNA polymerase translates RNA. (F) Ribosomes translate RNA and RNA polymerase transcribes DNA into RNA. 13.The antibiotic called streptomycin is known to bind to the ribosome. Streptomycin distorts the ribosome structure so the ribosome does not stabilize the correct codon-anticodon base pairs. Instead, the ribosome stabilizes incorrect codon-anticodon base pairs. onsider a ribosome where streptomycin is present during translation. Compared to normal C translation, do you predict that the proteins being translated by the streptomycin-bound ribosome will have: (circle one) fewermistakes thesame number ofmistakes moremistakes E xplain your choice in one short sentence. Students should state the result when the ribosome stabilizes the wrong codon-anti-codon: Eg The wrong tRNA will be able to H-bond (or recognize) the mRNA in the ribosome and this may add the wrong amino acid. Therefore, mistakes will be observed due to incorrect amino acids in the protein’s polypeptide sequence. OTE: Zero points for only re-stating “ribosome stabilizes incorrect codon-anticodon base N pairs” as this is information given in the question. 14.The following DNA sequence is part of a transcribed region of a gene, and has a start codon in one of the strands only: ’ GCGTAATTG 5 C CG CAT TTCAATAA 3’ 3’ CGCATTAACGGCGTAAAGTTATT 5’ . W A hich is the template strand? TOP [3’ TAC 5’on the template strand] B. Which is the coding strand? BOTTOM C. Write out the mRNA sequence that will be synthesized from this sequence. 5’-UUAUUGAAAUGCGGCAAUUACGC-3’ D. Translate the mRNA sequence to protein:N-Met-Arg-Gln-Leu-Arg-C E. In the above sequence, if the underlined cytosine on the top strand is changed to G, what would happen to the product of transcription, and what would happen to the product of translation? The transcript would contain a C instead of a G at that position. No change to the protein product as the codons 5’-CGG-3’ and 5’-GGC-3’ both code for Arginine. F. W hat is meant when we say the genetic code is redundant? Explain with an example of a s pecific codon. Redundant: More than one codon can specify the addition of the same amino acid. E.g. Tyrosine has at least two codons. Or, the above example with Arginine. Unit 2-6: DNA mutations Unit 2-6 Study Questions: . 1 Practice the effects of a point mutation by using an example of a DNA coding region (any s hown in these practice questions). a. What is the effect of deleting one base? Two bases? Three bases? b. What is the effect of changing one base to another on the template strand e.g. G to C? c. What is the effect of changing the sequence of the three bases within one codon? Three bases that span over two codons? e.g. the third base of one codon and the first 2 bases of the next codon. Unit 2-6 Exam Style Questions: . 2 One of the DNA replication proteins/enzymes is altered in a way that it results in an increased rate of mismatched bases in the newly synthesized DNA strand. Which function is most likely to be disrupted? A. the unwinding function of helicase B. the winding stress relief function of topoisomerase II C. the fragment joining function of DNA ligase D. the proofreading function of DNA polymerase E. the strand separation function of single-stranded binding protein . The following nucleotide sequence encodes the C terminus region of a wild type (also called 3 “native” or “normal” or wildtype) protein. The stop codon is underlined. Native: 5'-GCCTCT A AAATCAGGAGAACACAC TAA -3' 3’-CGGAGA T TTTAGTCCTCTTGTGTGATT-5' The highlighted bases are mutated to the form below: Mutant: 5'-GCCTCT T AAATCAGGAGAACACACTAA-3' 3’-CGGAGA A TTTAGTCCTCTTGTGTGATT-5' Predict the consequence of this base change from A to T on the protein produced. A.The mutation would result in a shorter protein. B.The mutation would result in a different amino acid being inserted into the protein. C.The mutation would result in a longer protein. D.The mutation would not change the amino acid sequence of the protein. E. The mutation would change all the amino acid sequence in this region. Unit 2-6 Open Response Style (ORQ) Questions: 5. Explain what the difference is between an error in DNA replication and a mutation. Mutation: A mutation is any permanent change in theDNA sequence. Mutations that change the DNA sequence are heritable and/or passed down to daughter cells. Error in DNA Replication: An error in DNA replicationis when the DNA polymerase makes a mistake in the synthesis of the daughter DNA strand (newly synthesized strand). For example, DNA polymerase can skip a base, or add the wrong nucleotide (mismatch). This error, however only exists on one of the DNA strands, as the template strand maintains the correct sequence. This error can potentially be repaired through DNA repair mechanisms. If it persists through a second round of DNA replication, then one of the daughter cells will possess the changed sequence in both strands. This is how mutations can arise from errors in DNA replication. . Not all mutations in aprotein coding regioncausea change in phenotype. Explain giving 2 6 examples. Example: If it’s a silent mutation (i.e. one codonchanges to another codon coding for the same amino acid) there will be no change in phenotype because there is no change in the shape or f unction of the protein. then you must add that there is no change in the polypeptide and/or no change in the shape and function of the protein. Example: If there is a missense mutation and the aminoacid that is swapped in is of a similar type (similar non-covalent interactions are possible, the size is similar) this means protein folding and function is less likely to be affected. Unit 2-7: Regulating gene expression:the bacterialmalandlacoperons as examples PERON MUTATION QUESTION are part of Mastery Learning Module 3 -see your B112 Tutorial O Canvas site for Mastery Activity Worksheets and Mastery Enrichment Worksheets. Unit 2-7 Study Questions: 1. MalT is a ______ regulator of themalPQoperon . A ositive P B. Negative . Compare these two gene expression systems. 2 lacoperon aloperon m Regulates breaking down of: lactose maltose hat binds to the operator & W T he LacI repressor protein T he MalT-maltose activator when does this occur? binds to the operator when complex binds to the operator lactose levels in the cells are when maltose levels in the cells low. are high. High levels of what High levels of lactose induce High levels of maltose induce the s ubstance affects the operon, the operon, by binding to LacI operon, by binding to MalT and and how? and removing its repression. enabling its activation function of the operon. Is this positive regulation or T his isnegativeregulation This ispositiveregulation negative regulation? Why? because the repressor protein, because the activator protein, LacI, inhibits the gene MalT, enhances/promotes gene expression. expression. Unit 2-7 Exam Style Questions: 3. C onsider the basic structure of an operon. Each protein coding sequence within that operon would have: . 1 Its own promoter. 2. Its own transcription terminator. 3. Its own start codon. 4. Its own stop codon. . A only. 3 B. 1 and 2. C. 2 and 3. D. 3 and 4. E. All of the above. . 4 The genes for the arginine operon are located on a bacterial chromosome. The proteins produced by the operon are used tosynthesizetheamino acid arginine. If the operon is controlled negatively by a regulatory protein ArgR, what would be the role ofarginine? A. To bind to ArgR, which will then bind to the operator region in the operon. B. To bind to the ArgR which will then not bind to the operator region in the operon. C. To bind to the operator region and block RNA polymerase from binding to the promoter region of the operon. D. To bind to RNA polymerase to make it capable of binding to the promoter region of the operon. 5. W hich of the following statements is an accurate description of regulation of thelacoperon? A. When lactose is present in the growth medium, LacI binds to the DNA with very low affinity** and the operon is transcribed at high levels. B. When lactose is present in the growth medium, LacI binds to the DNA with high affinity** and the operon is transcribed at high levels. C. When lactose is present in the growth medium, LacI binds to the DNA with high affinity and the operon is not transcribed. D. When lactose is absent from the growth medium, LacI binds to the DNA with high affinity and the operon is transcribed at high levels. E. When lactose is absent from the growth medium, LacI binds to the DNA with very low affinity and the operon is not transcribed. **High affinity binds really well/strongly to the operator -LacI when not bound to lactose i.e. Repressor ** Low affinity binds weakly - LacI bound to lactose (rarely binds or not at all) 6. In thepresenceof the signal molecule that bindsto the regulatory protein,the fundamental difference between the regulatory proteins LacI and MalT can be stated as: A. LacI will bind downstream of the promoter and MalT will not bind to the operator upstream of the promoter. B. LacI will bind upstream of the promoter and MalT will bind downstream of the promoter. C. LacI binds DNA efficiently and MalT does not. D. L acI prevents transcription of the genes in the operon, but MalT promotes the transcription of the genes in the operon. E. MalT binds DNA efficiently and LacI does not. 7. W hich of the following statements about regulation of thelacoperon ofE. coliare correct? CHOOSE ALL THAT APPLY A. The LacI protein binds to the operator and inhibits transcription of thelacoperon. B. When grown in media with no lactose,E. coliproducehigh levels oflacZY mRNA. C. The LacI protein will change shape in the presence of lactose. D. Cells that contain a mutant LacI protein that cannot bind lactose are unable to metabolize lactose. E. When cells are grown in medium that contains lactose, the LacI protein, after binding to lactose, will bind near the promoter for thelacoperon. Unit 2-7 Open Response Style (ORQ) Questions: 8. T he diagram below represents an operon found on the genome of a bacterial cell. The light blue lines represent double stranded DNA. The boxed areas represent 4 different protein coding regions (protein 1, protein 2, protein 3 and protein 4). P = promoter (orange), T= terminator (green). hich statements about this operon are true or false (T or F)? W T or F Statement T The template strand for this operon is the bottom strand. F Each protein coding region within the operon will have its own +1 site. T Each protein coding region within the operon will have its own start codon. F The terminator sequence will stop translation for all 4 proteins. F One ribosomal binding site is shared by all 4 protein coding regions. F Four different RNA polymerases are required to transcribe the operon. F Translation of the proteins further downstream (e.g. proteins 3 and 4) depends on the successful translation of the upstream proteins 1 and 2. T All four proteins can be translated simultaneously as each have their own ribosomal binding site. 9. C onsider thelacoperon. What happens if lactoselevels are low? Put the following list in order of when they occur (1-6) starting with low levels of lactose. 4 Lactose from the environment enters the cell and binds to LacI, which leads to a conformational change in LacI. 3 When RNA polymerase tries to bind to the promoter, it cannot get past the LacI repressor protein, therefore RNA polymerase is mostly blocked from transcribing the genes for the lactose metabolizing enzymes. 1 The enzymesβ-galactosidase and permease, coded forbylacZandlacY, are not required by the cell at low levels of lactose, hence they are transcribed at low levels. 6 Without LacI bound to the operator, RNA polymerase is able to bind to the promoter and transcribe the lac operon. 5 LacI bound to lactose is no longer able to bind to the operator with high affinity. 2 The LacI protein binds to the operator with high affinity. 1 and 2 can be reversed as well. 10. Consider themaloperon. What happens if maltoselevels are high? Put the following list in order of when they occur (1-4). 3 “MalT-maltose” complex– binds the operator with a greater affinity. 2 Maltose binds to MalT and this changes the conformation of MalT. 4 RNA polymerase binds more effectively to themalPQpromoter, leading to high levels of malPQtranscription. 1 Maltose is transported into the cell from the environment. PERON MUTATION QUESTION are part of Mastery Learning Module 3 -see your B112 Tutorial O Canvas site for Mastery Activity Worksheets and Mastery Enrichment Worksheets. See also Chocolate Operon Worksheet BIOL 112: Unit 3 Practice Questions Up dated 2023-2024T2 T his document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you could answer each objective if it was in the form of a question. There are different levels of questions provided: 1. S tudy questions: these are questions on your directknowledge of the topics, so essentially covers the basics & helps you practice to make sure you get the fundamentals. Work with these questions first to build up your skills. 2. Exam Style questions: Can be multiple choice, multipleanswers: these are the types of questions you are likely to see on the exam – various levels of application of the fundamental knowledge and skills for each topic area. 3. Open response questions (ORQs): a few examplesto give you an idea of the kinds of short answer questions you will see on the exams. _____________________________________________________________________ Unit 3-1: DNA replicationin vivo– inside cells Exam Type Questions 1. Which of the following statements about DNA synthesis is TRUE? A. Nucleotides are added in a random fashion to single-stranded DNA B. DNA polymerase adds dNTP monomers in the 3’ to 5’ direction C. Primers are short sequences that allow the initiation of DNA synthesis D. As DNA polymerase moves along the template strand, each new nucleotide provides a 5’ hydroxyl group for the next reaction to occur. 2. T he leading strand is the daughter strand that has its ____ end pointed toward the replication fork and is therefore synthesized ______. A. 3’; discontinuously B. 3’; continuously C. 5’; discontinuously D. 5’; continuously E. 5’; away from the fork 3. What catalyzes DNA synthesis? A. DNA polymerase B. RNA polymerase C. Ligase D. Primase E. Helicase 4. Which of the following choices describes the function of DNA Polymerase? A. Opens up double-stranded DNA to make it single stranded. B. Re-winds the old and new strand together after replication. C. Catalyzes the linking of dATP, dCTP, dGTP and dTTP in a specific order, using single stranded DNA as a template. D. Fuses intermediate length DNA segments into longer segments. 5. A defect occurs during replication where DNA replication proceeds without the RNA primers being removed and replaced with DNA. Which enzyme is most likely to be defective in this system? A. RNA primase B. helicase C. s ingle strand binding protein D. a DNA polymerase (technically DNA Polymerase I) E. DNA ligase 6. In a DNA double helix an adenine of one strand always pairs with a(n)______ of the complementary strand, and a guanine of one strand always pairs with a(n)______ of the complementary strand. A. guanine...adenine B. cytosine...uracil C. cytosine...thymine D. uracil...cytosine E. thymine...cytosine 7. A fter DNA replication is complete, ________. A. Each new DNA double helix consists of two new strands B. One DNA double helix consists of two old strands and one double helix consists of two new s trands. C. There are four double helices D. Each of the four DNA strands consist of some old strand parts and some new strand parts. E. Each new double helix consists of one old DNA strand and one new DNA strand. 8. A parental DNA strand is used as a ________________ for the assembly of a new daughter DNA s trand. A. Primer B. Complement C. Model D. Source of nucleotides E. Template 9. When we say that DNA replication is semiconservative, we mean that: A. only half of an organism’s DNA is replicated during each cell division. B. when DNA is replicated, each new double helix contains one parental strand and one newly synthesized daughter strand. C. when DNA is replicated, one double helix contains both parental strands and one contains two newly synthesized daughter strands. D. parental DNA stays in the parent cell and daughter DNA ends up in the daughter cell. ORQ-Style Questions 10.Put the following steps of DNA replication on the lagging strand in chronological order. . Single-stranded binding proteins attach to the DNA strands. A B. Hydrogen bonds between base-pairs of the DNA strands are broken. C. Primase binds to the single strand DNA. D. DNA polymerase elongates the primer. E. A short RNA primer is created. B, A, C, E, D - D escribe three major challenges faced by both bacteria and eukaryotic cells in replicating their DNA, and how the challenges are overcome. - Challenge 1: Strand separation – separation of thedouble stranded DNA by breaking the H-bonds, to allow DNA Pol to bind to the single-stranded template DNA and synthesize the complementary daughter strand. This is achieved by specialized proteins (enzymes) called Helicases. - Challenge 2: DNA Polymerase needs a primer to startsynthesis – dealt with by the enzyme RNA Polymerase (Primase) synthesizing RNA primers that the DNA Pol can use to extend. - Challenge 3: DNA replication machinery makes mistakesintroducing mutations – dealt with by having proof reading capacity and DNA repair machinery. 11.Making connections: Comparing DNA Polymerase vs. RNA polymerase DNA polymerase RNA polymerase Are primers required? yes no Type of nucleotide required DNA nucleotides: ATCG RNA nucleotides: AUCG Direction of movement eads the template from R eads the template from R 3’to 5’ 3’ to 5’ Process starts at which end: 3’ 3’ nit 3-2: DNA replication in vitro – Polymerase chain reaction U (PCR) Study exercise: earning Objective: Describe the three key steps in polymerase chain reactions; denaturation, L annealing, and extension, and explain what role these play in the replication of DNA in a test tube 1. Fill in your answers in the empty boxes beside the questions: PCR Step What occurs during this step? Why is this step important for DNA replication? Denaturation eat breaks the hydrogen bonds H his step mimics what helicase does T holding double-stranded DNA during DNA replicationin vivoby together and separates it into single separating the double-stranded DNA strands of DNA into single strands, which allows other proteins to bind Annealing rimers bind to their complementary P NA polymerase cannot synthesize D sequence on the strands of the DNA without a primer template DNA Extension NA polymerase adds dNTPs to the D NA polymerase must bind to the D 3’ ends of the primers that is correct region and read the template complementary to the template DNA DNA correctly in order to replicate the region of interest earning Objectives: List the components needed (in a test tube) to start a PCR amplification L experiment and describe the role of the four deoxyribonucleoside triphosphates (dNTPs) used in DNA synthesis (dATP, dGTP, dCTP, dTTP). 2. Fill in your answers in the empty boxes beside the questions: ist the 4 components L Describe its function in a PCR: required for a PCR: DNA template erves as a “template” for DNA polymerase in order to replicate S the region of interest ll four deoxynucleoside A re added to the 3’ end of the primer by DNA polymerase and is A triphosphates (dNTPs) complementary to the template DNA DNA polymerase eads the template DNA and extends the primer by adding R dNTPs that are complementary to the template DNA Primers ind near to (flank) the region of interest and is required for DNA B polymerase to start synthesis The remaining learning objectives will be addressed using the following example: 3. Y ou are a graduate student in a lab and your supervisor has asked you to replicate a specific region of interest (highlighted in yellow) in a sample of bacterial DNA shown below. AATTCGGATGCGC C GCGTTAATAATG CTCGTGACTAGTCGTTA GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT hat information is missing from the sample of DNA that you need in order to design the right W primers? The directionality of the DNA i.e. the location of the 5’ and 3’ ends Your supervisor gives you one end of the DNA as shown below. Label the rest of the ends. ’ 3 – CAATTCGGATGCGC GCGTTAATAATG CTCGTGACTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ earning Objective: Construct a representation of template DNA, primers, and their orientation L to each other using the directionality of DNA and predict what primers would be needed to amplify a given piece of double-stranded DNA 4. N ow that you know the directionality of the DNA, highlight in blue the bases of DNA that would be best for your primers (about 7 bases long) to bind in order to amplify the region of interest? (Hint: Remember primers are oriented with their 3’ ends towards each other) ’ – CAATTCG 3 GATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACT GATCAGCAAT – 3’ hat are the sequences of the primers (about 7 bases long) that could be used in this experiment and W their directionality? (Hint: Remember primers bind antiparallel and complementary to the DNA strand) Primer 1: 5’ - CTACGCG - 3’ Primer 2: 3’ - CTCGTGA - 5’ OR 5’ - AGTGCTC - 3’ earning Objectives: Identify the structural “end” of a DNA molecule where dNTPs are added L during DNA synthesis and predict what products of an amplification reaction given locations of primers on a DNA 5. Y our supervisor now asks you to run the PCR experiment. Draw what the DNA would look like after the denaturation step. Strands would be separated. Regions of interest are highlighted in yellow. 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ Now draw what the DNA would look like after the annealing step (Hint: where do the primers bind?): Primers are highlighted in blue. ’- 5 CTACGCG -3’ 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ 3’- CTCGTGA -5’ inally, what would the DNA look like after the extension step (Hint: how far along the template DNA F does DNA polymerase extend the primers?): Primers are highlighted in blue. Extended DNA is highlighted in pink. ’- 5 CTACGCG CGCAATTATTACGAGCACTGATCAGCAAT -3’ 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ 3’- CAATTCGGATGCGCGCGTTAATAATG CTCGTGA -5’ iven the products (DNA sequences) generated from the first cycle of a PCR experiment, what G products (DNA sequences) would you expect to find in the next cycle of a PCR experiment? gain show what would happen during the denaturation step (Hint: use the DNA sequences you drew A after the extension step): rimer sequences are highlighted in blue. Regions of interest are highlighted in yellow. Extended P DNA from the first cycle of PCR is highlighted in pink. 5’- CTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT -3’ 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ 3’- CAATTCGGATGCGC GCGTTAATAATG CTCGTGA -5’ raw what would happen during the annealing step (Hint: would the primers bind to every strand of D DNA?): Primer sequences are highlighted in blue. ’- 3 CTCGTGA -5’ 5’- CTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT -3’ ’- 5 CTACGCG -3’ 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ ’- 3 CTCGTGA -5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ ’- 5 CTACGCG -3’ 3’- CAATTCGGATGCGC GCGTTAATAATG CTCGTGA -5’ What about the extension step?: Extended DNA from the second cycle of PCR is highlighted in orange. ’- 3 GATGCGCGCGTTAATAATG CTCGTGA -5’ 5’- CTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT -3’ ’- 5 CTACGCG CGCAATTATTACGAGCACTGATCAGCAAT -3’ 3’ – CAATTCGGATGCGC GCGTTAATAATG CTCGTGA CTAGTCGTTA – 5’ ’- 3 CAATTCGGATGCGCGCGTTAATAATG CTCGTGA -5’ 5’ – GTTAAGCCTACGCG CGCAATTATTAC GAGCACTGATCAGCAAT – 3’ 5’- CTACGCG CGCAATTATTACGAGCACT -3’ 3’- CAATTCGGATGCGC GCGTTAATAATG CTCGTGA -5’ hat products (DNA sequences) would you expect to find at the end of the PCR (e.g. after 30 cycles) W experiment (Hint: are the primer sequences included in the final product of PCR?): Regions of interest are highlighted in yellow. Primers are highlighted in blue. ’ – GATGCGC 3 GCGTTAATAATG CTCGTGA – 5’ 5’ – CTACGCG CGCAATTATTAC GAGCACT – 3’ MCQ Exam Style Questions: eating a polymerase chain reaction (PCR) to 95oC 1. H in each cycle eliminates the need for which of the following proteins involved in DNA replication in a cell? . Single stranded binding proteins 1 2. RNA primase 3. Helicase 4. Topoisomerase 5. Ligase . 1, 2, 3. A B. 1, 3, 4. C. 2, 4, 5. D. 3, 4, 5. E. 4, 5. 2. T he diagram below shows a DNA region containing a gene in a bacterium. The PCR primer positions (numbered 1, 2, 3, 4, 5) are shown.The numbers of bases in this region are indicated starting at the +1 site for transcription. The arrows indicate the 5’ to 3’ direction of the primers. If you wanted to amplify the promoter region for this gene, which pair of primers would you use? +1 =start of transcription [JaKS2] .1, 2. A B.1, 3. C.1, 4. D.2, 4. E.4, 5. 3. A graduate student wants to use PCR to amplify thepromoter and coding regionof theABC gene to do further experiments. Which pair of primers should she pick to amplify theABC gene? .2 & 6 A B.2 & 5 C.1 & 6 D.1 & 5 E.1 & 4 4. A graduate student wants to use PCR to amplify thepromoterof theABCgene to do further experiments. Which pair of primers should she pick to amplify theABCgene promoter? A.2 & 6 .2 & 5 B C.1 & 6 D.1 & 5 E.1 & 4 5. W hich of the following statements isFALSEaboutbothRNA polymerase and DNA polymerase? (Alternate wording suggestion: Comparing RNA Polymerase and DNA Polymerase, which of the following statements isFALSE?) . A oth synthesize a nucleic acid strand antiparallelto the template strand. B B. Both require a primer to begin synthesis. C. Both require a template for synthesis D. Both move along the template strand in the 3' to 5' direction. E. Both synthesize a new nucleic acid strand in the 5' to 3' direction. BIOL 112: Unit 4 Practice Questions & Answers Updated April 2024 T his document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you could answer each objective if it was in the form of a question. There are different levels of questions provided: 1. S tudy questions: these are questions on your directknowledge of the topics, so essentially covers the basics & helps you practice to make sure you get the fundamentals. Work with these questions first to build up your skills. 2. Exam Style questions: Can be multiple choice, multipleanswers: these are the types of questions you are likely to see on the exam – various levels of application of the fundamental knowledge and skills for each topic area. 3. Open response questions (ORQs): a few examplesto give you an idea of the kinds of short answer questions you will see on the exams. Unit 4-1: Metabolism overview – Energy and chemical reactions Unit 4-1 Exam Type Questions: 1. W hat characteristic of this molecule (ATP) is responsible for its high energy level compared to AMP? A. the nitrogen atoms in adenine B. the phosphorus atoms in the phosphate groups C. the C—H bonds of the ribose sugar D. the closely spaced negative charges associated with the phosphate groups Unit 4-1 Open Response Questions (ORQ): 2. Gibb’s free energy: Fill in the following table. Reaction type S ign of ∆G eaction is R E xplanation for the sign of ∆G (positive/negative) s pontaneous or non-spontaneou s ? Exergonic (in general) Negative s pontaneous En ergy is released by the system. So the ΔG is negative Endergonic (in general) Positive Non-spontaneo Energy input is required by the us system. So the ΔG is positive Electron movement along Negative s pontaneous Energy is produced as the ETC electrons move from a carrier to carrier with decreasing energy (free energy) in the ETC until being accepted by the TEA. Production of ATP by ATP Positive Non- Energy input is required for ATP synthase s pontaneous synthesis – the potential energy stored in the H+ gradient provides the energy to drive ATP synthesis by ATP Synthase. Unit 4-2: Cellular respiration overview and redox reactions Unit 4-2 Exam Type Questions: 1. A glucose molecule has a great deal of energy in its ________. A. C-H bonds . B -N bonds C C. number of oxygen atoms D. polar structure 2. W hich of the following is true of oxidation-reduction (redox) reactions? A. They involve the transfer of one or more carbon atoms from one molecule to another. B. They allow organisms to harness energy from large macromolecules and convert it to a useable form for the cell. C. They allow organisms to harness energy from photons of light and convert it to a useable for the cell. D. B and C are true of redox reactions. E. A, B, and C are true of redox reactions. Unit 4-3: Glycolysis and Fermentation Unit 4-3 Exam Type Questions: 1. In the energy-yielding phase of glycolysis, energy is extracted in the form of: A. pyruvate. B. carbon dioxide. . C ADH and ATP. N D. phosphorylated intermediates. 2. Which reactant molecule becomes reduced in the following chemical reaction? Glyceraldehyde phosphate + NAD+ → diphosphoglycerate + NADH + H+ . A g lyceraldehyde phosphate B. the electrons C. NAD+ . D NADH E. phosphate 3. Glycolysis involves an energy investment phase, cleavage phase, and an energy pay-off phase. For every glucose molecule that enters the glycolytic path, what is the number of ATP used; the number of ATP produced; and the net ATP yield at the end of glycolysis? A. 2; 4; 2 . B ; 2; 2 4 C. 2; 4; 6 D. 4; 4; 8 E. 4; 2; 4 . **Note this question has been modified. It originally asked about anaerobic respiration in 4 bacteria, which is not in our learning objectives in 2023-2024. hich of the following statements describing the difference between fermentation and aerobic W respiration isFALSE? A. Aerobic respiration uses inorganic molecules as an electron acceptor whereas fermentation uses organic molecules. B. Aerobic respiration involves electron transport chain whereas fermentation does not. C. Aerobic respiration results in large energy production whereas only small amounts of energy are produced from fermentation pathways. D. Aerobic respiration involves membrane-bound proteins whereas fermentation pathways all occur in the cytoplasm. E. Aerobic respiration depends on oxygen to donate electrons whereas electrons in fermentation are donated from NADH to organic compounds. 5. Which of the following are true with respect to fermentation? 1. During electron transport, the pyruvate reduces NAD+. 2. Fermentation takes place in the presence of oxygen. 3. NAD+ is regenerated. 4. Allows ATP to be produced via substrate-level phosphorylation in the reactions of glycolysis. 5. Only certain inorganic ions can function as electron donors. A. All 5. B. 1, 2, 3 and 4. C. 1, 3 and 5. . D and 4. 3 E. 2, 3 and 4. 6. Why are fermentation reactions important for cells? A. They produce alcohol used in alcoholic beverages. B. They regenerate NAD+ so that glycolysis can continue. C. T hey utilize oxygen. . D They generate oxygen 7. During lactic acid fermentation, one molecule of glucose is c onverted to 2 molecules of lactic acid (shown on the right). In lactic acid, which of the carbons (numbered 1 to 6 in glucose) have become reduced and which have become oxidized, compared to glucose? A. C1 and C3 reduced; C4 and C6 oxidized B. C2 and C5 reduced; C1 and C6 oxidized C. C1 and C6 reduced; C3 and C4 oxidized . D 3 and C4 reduced; C2 and C5 oxidized C E. C1, C2, C3 are reduced; C4, C5, C6 are oxidized Unit 4-4: Acetyl-coA synthesis and the citric acid cycle Unit 4-4 Exam Type Questions: 1. Which of the following describe the role of the TCA/Krebs/Citric Acid Cycle in cellular respiration? 1. To produce ATP by chemiosmotic synthesis. 2. To produce water. 3. To produce NADH for oxidative phosphorylation. 4. To extract electrons from carbon atoms. A. 1 and 4. B. 2 and 3. C. 3 and 4. . D , 3 and 4. 1 E. 1, 2, 3 and 4. . By the end of the Citric Acid cycle, the carbon skeleton of glucose has been broken down to 2 CO2. Most of the energy from the original glucose at that point is still in the form of A. ATP B. CO2 C. H2 O D. NADH 3. T here are many potential "catabolic reactions" that could be used to make ATP by substrate level phosphorylation. Regardless of what other chemicals are in such reactions, the reactions would include: A. molecular oxygen B. ATP C. pyruvate D. glucose E. an organic high-energy molecule containing phosphate group. 4. ATP synthesis by substrate level phosphorylation requires which of the following? . 1 n organic high-energy molecule containing a phosphate. A 2. An electron transport chain. 3. Oxygen. 4. ADP. 5. Inorganic phosphate. A. All 5 B. 1, 3, 5 C. 1 and 4 . D , 2, 4 1 E. 2, 3, 5 5. W hat electron carrier(s) function in the TCA cycle? A. CO2 B. NAD+ only C. both NAD+ and FAD . D t he electron transport chain E. FAD only 6. S ubstrate-level phosphorylation occurs within a metabolic pathway where sufficient energy is released by a given chemical reaction to drive the synthesis of ATP from ADP and phosphate. Substrate-level phosphorylation is seen in which metabolic pathway(s)? A. glycolysis B. citric acid cycle C. electron transport chain D. both glycolysis and the citric acid cycle E. ll of the above pathways involve steps where substrate level phosphorylation takes A place. 7. A fter glycolysis, but before the Citric Acid/TCA cycle and the electron transport chain (oxidative phosphorylation), most of the energy from the original glucose is in the form of which molecule? A. ATP B. CO2 C. H2O D. NADH E. Pyruvate AD+ and FAD are important in cellular respirationprocess because: 8. N A. They accept electrons in the redox reactions of the cellular respiration. . B T hey are reduced in the Electron Transport Chain to generate ATP C. When reduced, they can be used instead of ATP as the main source of energy for cells. D. They transfer electrons from intermediates in glycolysis to intermediates in the TCA cycle. E. They can be used to generate ATP in the absence of a terminal electron acceptor 9. T he last of 8 steps in the Citric Acid (TCA) cycle, catalyzed by the enzyme malate dehydrogenase, is s hown on the right. The carbon atoms of L-malate are numbered 1-4. In this reaction, which of the following comments is correct? A. NAD+ is oxidized and malate carbon 4 is reduced B. NAD+ is oxidized and malate carbon 4 is oxidized C. NAD+ is reduced and malate carbon 2 is reduced D. NAD+ is reduced and malate carbon 2 is oxidized E. NAD+ is oxidized and malate carbon 3 is reduced Unit 4-5: Electron transport chain (ETC) and oxidative phosphorylation Unit 4-5 Exam Type Questions: 1. During oxidative phosphorylation, H2O is formed. Where do the oxygen atoms in the H2O come from? A. carbon dioxide B. molecular oxygen . C g lucose D. fatty acids E. other inorganic molecules not included in this list 2. ATP can be produced during Glycolysis independent of O2 because: A. Oxygen is not required for the reactions in glycolysis. . B lycolysis splits oxygen from glucose providing it to the cell. G C. ATP changes the configuration of the ETC chain in a way that water provides the oxygen for the reaction allowing glycolysis to continue. D. Oxygen is not the only terminal electron acceptor. 3. W hich of the following steps is directly involved in generating ATP via oxidative phosphorylation? . A rocessing of pyruvate to Acetyl CoA. P B. Conversion of NAD+ to NADH. . C assage of protons through the ATP synthase. P D. Passage of electrons through the Electron Transport Chain. 4. A function of the Electron Transport Chain in bacteria is: A. to link inorganic phosphate to ADP. B. to pump protons out of the cytoplasm. . C t o pump electrons out of the cell. D. to reduce ADP to ATP. E. to reduce NAD+. 5. In bacterial cells, aproton gradient is requiredfor chemiosmotic synthesis of ATP. Which of the following accurately describes the proton gradient establishment? A. Protons are moved out of the cytoplasm to the mitochondria. B. Protons are moved out of the mitochondria to the cytoplasm. C. rotons are moved out of the cytoplasm to the space between the cell membrane and P the cell wall. . D rotons are moved along the cytoplasmic membrane from one protein to another. P E. Protons are moved from the nutrient to the electron acceptor. 6. T he coupling of the ETC Proteins and ATP synthase enables an organism to produce energy in the form of ATP. Choose from below all that are needed for this process to work: 1. The formation of an electrochemical gradient. 2. The oxidation of the final electron acceptor. 3. The movement of protons across a membrane in both directions. 4. The reduction of the final electron acceptor. 5. Active transport. 6. Facilitated diffusion. 7. Simple diffusion. A. 1, 3, 4, 5 and 6 . B , 2, 6 and 7 1 C. 1, 3, 5 and 6 D. 1, 2, 4 and 6 E. 1, 2, 3 and5 7. The electron transport chain: A. is a series of redox reactions. . B is a series of oxidation reactions. C. is driven by ATP consumption. D. takes place in the cytoplasm of bacterial cells. 8. In the process of chemiosmotic synthesis of ATP, the overall function of the electron transport chain is to: A. reduce O2. B. reduce an organic molecule. C. extract electrons from organic molecules. D. establish a proton gradient across a membrane to drive the ATP synthase. E. form the bonds between inorganic phosphate and ADP to make ATP 9. T he process of proton movement through the ATP synthase to synthesize ATP would be called: A. passive diffusion B. facilitated diffusion . C a ctive transport D. aerobic respiration E. reduction Unit 4-5 Open Response Questions (ORQ): 10.Provide a label for the boxes in the electron transport chain and oxidative phosphorylation diagram**you do not need to know the names protein& lipid components** 11.Comparison of metabolic pathways: Fill out the tables below for eukaryotes. ellular Respiration C F ermentation Location Cytoplasm, mitochondria Cytoplasm Is oxygen involved? Yes No Production of lactic acid? No Yes E xample of terminal electron Oxygen Organic carbon molecule acceptor (TEA)/electron acceptor Relative amount of energy High; 32 ATP Low; 2 ATP released 12.Cellular respiration locations: eukaryote vs. bacteria: Fill out the table below. S ubcellular location in S ubcellular location in eukaryotes bacteria Glycolysis Cytoplasm Cytoplasm Acetyl-CoA synthesis Mitochondrial matrix Cytoplasm Citric Acid cycle Mitochondrial matrix Cytoplasm Electron transport chain Inner mitochondrial membrane ytoplasmic membrane C 13.Match the letter in the diagram of a mitochondriawith the label: (you may use each letter more than once or not at all) Unit 4-6: Photosynthesis –P hotophosphorylation andthe Calvin Cycle Unit 4-6 Exam Type Questions: 1. In photophosphorylation: A. light is oxidized. B. light is reduced. C. light is the electron source. D. All of the above. E. None of the above. 2. W hich of the following statements about photosynthesis and cellular respiration is TRUE? A. Photosynthesis is a catabolic process; cellular respiration is an anabolic process. B. Photosynthesis occurs in plants and some prokaryotes; cellular respiration occurs in animals, but not plants. C. rganelles are required to carry out photosynthesis and cellular respiration in O eukaryotes. D. Both photosynthesis and cellular respiration require CO2 as an input. 3. H ow are the light-dependent and light-independent reactions of photosynthesis related? A. They cannot occur in the absence of light. B. The products of light-dependent reactions are used in light-independent reactions. C. T he products of light-independent reactions must be present for light-dependent reactions to take place. D. They are not related. 4. T he electron acceptor associated with photosystem I is A. oxygen B. hydrogen ions C. NADP D. water 5. In oxygenic photophosphorylation, the electrons that move through the electron transport chain end up with: A. a light harvesting complex. B. NADPH. C. oxyge
