Podcast
Questions and Answers
What interactions serve to stabilize/hold DNA together in its secondary structure? Explain how this stabilizes DNA in its aqueous environment.
What interactions serve to stabilize/hold DNA together in its secondary structure? Explain how this stabilizes DNA in its aqueous environment.
Hydrogen bonds between strands (base pairing), stacking interactions (mostly ID-ID) above and below in the same strand. The stacking interactions allow for the hydrophobic surfaces to be excluded from water, allowing water to have more motional freedom and thereby increasing stability.
By convention how is the directionality of a DNA molecule written?
By convention how is the directionality of a DNA molecule written?
5' to 3'
By convention how is the directionality of a protein molecule written?
By convention how is the directionality of a protein molecule written?
N to C
Which linkage forms the backbone of a nucleic acid?
Which linkage forms the backbone of a nucleic acid?
In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime" or "3'-prime to 5-prime"). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.
In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime" or "3'-prime to 5-prime"). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.
In a bacterium, 14% of the DNA nucleotides were found to be Thymine. What proportions of the bases would be Guanine?
In a bacterium, 14% of the DNA nucleotides were found to be Thymine. What proportions of the bases would be Guanine?
In normal double-stranded DNA, purines base pairs with only certain types of pyrimidines. This is because...
In normal double-stranded DNA, purines base pairs with only certain types of pyrimidines. This is because...
Two strands of a short DNA molecule with 3 base pairs are shown below. The dotted lines indicate hydrogen bonds. Five atoms are labelled from 1 to 5. Indicate which label correctly points to one of the 5' ends of one of the DNA strands.
Two strands of a short DNA molecule with 3 base pairs are shown below. The dotted lines indicate hydrogen bonds. Five atoms are labelled from 1 to 5. Indicate which label correctly points to one of the 5' ends of one of the DNA strands.
DNA is double stranded and the two strands are said to run in an antiparallel fashion. The term antiparallel refers to which observation?
DNA is double stranded and the two strands are said to run in an antiparallel fashion. The term antiparallel refers to which observation?
Anti-parallel strands of DNA form complementary base pairing by hydrogen bonds. Which of the following statements is false regarding base pairing?
Anti-parallel strands of DNA form complementary base pairing by hydrogen bonds. Which of the following statements is false regarding base pairing?
Transcription is the process of copying ______ to ______.
Transcription is the process of copying ______ to ______.
Label the ends of the two strands of DNA below to indicate their directionality. Assuming this small segment of DNA was part of a larger segment of DNA not shown, indicate where a new nucleotide would be added if either of these strands were extended further.
Label the ends of the two strands of DNA below to indicate their directionality. Assuming this small segment of DNA was part of a larger segment of DNA not shown, indicate where a new nucleotide would be added if either of these strands were extended further.
Translation is the synthesis of ______ from ______.
Translation is the synthesis of ______ from ______.
Describe the general difference between DNA replication and protein synthesis. When does the cell use either of these processes? Are there similarities?
Describe the general difference between DNA replication and protein synthesis. When does the cell use either of these processes? Are there similarities?
Transcription factors only bind specific DNA sequences. What part of the DNA molecule would you predict is most important for specific interactions between a transcription factor like Sigma and the promoter sequence it binds?
Transcription factors only bind specific DNA sequences. What part of the DNA molecule would you predict is most important for specific interactions between a transcription factor like Sigma and the promoter sequence it binds?
What determines where the E. coli RNA Polymerase initiates transcription?
What determines where the E. coli RNA Polymerase initiates transcription?
What features of a DNA binding protein are required to recognize the correct binding site on DNA?
What features of a DNA binding protein are required to recognize the correct binding site on DNA?
Which of the following describes the comparison of typical bacterial and eukaryotic mRNAs?
Which of the following describes the comparison of typical bacterial and eukaryotic mRNAs?
The fact that translation is not simultaneous with transcription in eukaryotes is primarily due to:
The fact that translation is not simultaneous with transcription in eukaryotes is primarily due to:
Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells?
Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells?
Which of the following statements about alternative splicing are true?
Which of the following statements about alternative splicing are true?
What would happen to an mRNA strand in a eukaryotic cell if during RNA processing the poly A tail is not added? CHOOSE ALL THAT APPLY
What would happen to an mRNA strand in a eukaryotic cell if during RNA processing the poly A tail is not added? CHOOSE ALL THAT APPLY
An intron is ______; and an exon is typically ______
An intron is ______; and an exon is typically ______
Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. See next page...
Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. See next page...
Compared to the original situation: In the DNA sequence, if guanine were replaced by thymine (shown at right), predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.
Compared to the original situation: In the DNA sequence, if guanine were replaced by thymine (shown at right), predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.
The cartoon below represents the process of transcription as observed in an electron micrograph. On the diagram below indicate the directionality (5' or 3') in the boxes against the structure.
The cartoon below represents the process of transcription as observed in an electron micrograph. On the diagram below indicate the directionality (5' or 3') in the boxes against the structure.
How is translation initiated in bacteria? What part of the mRNA transcript does the ribosome bind to? How does this differ in Eukaryotes?
How is translation initiated in bacteria? What part of the mRNA transcript does the ribosome bind to? How does this differ in Eukaryotes?
What specific sequence or region leads to transcription termination and translation termination?
What specific sequence or region leads to transcription termination and translation termination?
If a given tRNA has an anticodon of 5-ACU-3′, what is the mRNA codon, what is the template strand DNA sequence, and which amino acid does it carry? (3points)
If a given tRNA has an anticodon of 5-ACU-3′, what is the mRNA codon, what is the template strand DNA sequence, and which amino acid does it carry? (3points)
Given that there are 61 codons for the 20 amino acids, which of the following is good evidence for the wobble hypothesis?
Given that there are 61 codons for the 20 amino acids, which of the following is good evidence for the wobble hypothesis?
The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines)
The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines)
A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA?
A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA?
Shown below is a portion of an mRNA stretch, starting at the start codon: AUG GGG AGU AAA UUU The DNA encoding this region would be correctly written as:
Shown below is a portion of an mRNA stretch, starting at the start codon: AUG GGG AGU AAA UUU The DNA encoding this region would be correctly written as:
What is the function of aminoacyl-tRNA synthetases?
What is the function of aminoacyl-tRNA synthetases?
Which of the following statements about translation in bacteria are TRUE?
Which of the following statements about translation in bacteria are TRUE?
Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell?
Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell?
Not all mutations in a protein coding region cause a change in phenotype. Explain giving 2 examples.
Not all mutations in a protein coding region cause a change in phenotype. Explain giving 2 examples.
Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for:
A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA.
B. A hydrogen atom is present on the 3' carbon of the “ribose” of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides.
C. Ribosomes transcribe RNA and RNA polymerase translates RNA.
Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. B. A hydrogen atom is present on the 3' carbon of the “ribose” of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. C. Ribosomes transcribe RNA and RNA polymerase translates RNA.
In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime” or “3'-prime to 5-prime”). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.
In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime” or “3'-prime to 5-prime”). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.
Transcription is the process of copying___ to ___.
Transcription is the process of copying___ to ___.
Translation is the synthesis of ___ from ___.
Translation is the synthesis of ___ from ___.
Transcription comparison: Is splicing (removal of introns) required?
Transcription comparison: Is splicing (removal of introns) required?
Transcription comparison: Is capping and tailing of mRNA?
Transcription comparison: Is capping and tailing of mRNA?
Transcription comparison: Site of translation?
Transcription comparison: Site of translation?
Transcription comparison: Can translation occur while transcription is still occurring?
Transcription comparison: Can translation occur while transcription is still occurring?
What features of a DNA binding protein are required to recognize the correct binding site on DNA? 1. They can make specific ionic interactions with the phosphodiester backbone of the DNA only at that sequence. 2. They make specific non-covalent interactions with the exposed bases of the DNA only at that sequence. 3. Part of their 3D structure is the right size/ shape/charge/polarity to interact with the major and minor grooves of that sequence of DNA.
What features of a DNA binding protein are required to recognize the correct binding site on DNA? 1. They can make specific ionic interactions with the phosphodiester backbone of the DNA only at that sequence. 2. They make specific non-covalent interactions with the exposed bases of the DNA only at that sequence. 3. Part of their 3D structure is the right size/ shape/charge/polarity to interact with the major and minor grooves of that sequence of DNA.
Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells? 1. Sigma factor. 2. General transcription factors. 3. RNA Polymerase. 4. TATA Binding Protein.
Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells? 1. Sigma factor. 2. General transcription factors. 3. RNA Polymerase. 4. TATA Binding Protein.
Which of the following statements about alternative splicing are true? 1. introns are spliced out and exons are joined together. 2. exons are spliced out and introns are joined together. 3. is a form of post-translational control of gene expression. 4. reduces the number of genes needed to express different proteins.
Which of the following statements about alternative splicing are true? 1. introns are spliced out and exons are joined together. 2. exons are spliced out and introns are joined together. 3. is a form of post-translational control of gene expression. 4. reduces the number of genes needed to express different proteins.
Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.
Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.
The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines) 3' ACG|ATT|CTT|TGC 5' 5' UGC UAA (stop)
The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines) 3' ACG|ATT|CTT|TGC 5' 5' UGC UAA (stop)
A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA? 1. 3′-CAATTTAGCAGA-5’ 2. 3'-AGTCGGTTCGAT-5′ 3. 3'-AGACGATTTAAC-5′ 4. 3'-GTTAAATCGTCT-5′ 5. 3'-TCTGCTAAATTG-5′ 6. 3′-AGACGATTCGAC-5′
A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA? 1. 3′-CAATTTAGCAGA-5’ 2. 3'-AGTCGGTTCGAT-5′ 3. 3'-AGACGATTTAAC-5′ 4. 3'-GTTAAATCGTCT-5′ 5. 3'-TCTGCTAAATTG-5′ 6. 3′-AGACGATTCGAC-5′
Which of the following statements about translation in bacteria are TRUE? 1. Proteins called initiation factors contribute to the interaction between the RNA in ribosome small subunit at the 5' cap. 2. An internal sequence in the mRNA specifies where the ribosome binds. 3. Complementary sequences in the tRNAs translate mRNA sequence into protein sequence . 4. Some regions of the mRNA are removed before translation. 5. A release factor ends protein synthesis by binding to the stop codon and to trigger the release of the polypeptide chain.
Which of the following statements about translation in bacteria are TRUE? 1. Proteins called initiation factors contribute to the interaction between the RNA in ribosome small subunit at the 5' cap. 2. An internal sequence in the mRNA specifies where the ribosome binds. 3. Complementary sequences in the tRNAs translate mRNA sequence into protein sequence . 4. Some regions of the mRNA are removed before translation. 5. A release factor ends protein synthesis by binding to the stop codon and to trigger the release of the polypeptide chain.
Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell? 1. There are more places to control protein synthesis. 2. More proteins can be produced in a given time period. 3. Resolves the problem of the ribosomes being too large to interact with DNA. 4. DNA does not need to have the sequence for the ribosome binding sites (RBS).
Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell? 1. There are more places to control protein synthesis. 2. More proteins can be produced in a given time period. 3. Resolves the problem of the ribosomes being too large to interact with DNA. 4. DNA does not need to have the sequence for the ribosome binding sites (RBS).
Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. (F)
Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. (F)
The antibiotic called streptomycin is known to bind to the ribosome. Streptomycin distorts the ribosome structure so the ribosome does not stabilize the correct codon-anticodon base pairs. Instead, the ribosome stabilizes incorrect codon-anticodon base pairs. Consider a ribosome where streptomycin is present during translation. Compared to normal translation, do you predict that the proteins being translated by the streptomycin-bound ribosome will have:
The antibiotic called streptomycin is known to bind to the ribosome. Streptomycin distorts the ribosome structure so the ribosome does not stabilize the correct codon-anticodon base pairs. Instead, the ribosome stabilizes incorrect codon-anticodon base pairs. Consider a ribosome where streptomycin is present during translation. Compared to normal translation, do you predict that the proteins being translated by the streptomycin-bound ribosome will have:
Explain your choice in one short sentence.
Explain your choice in one short sentence.
The following DNA sequence is part of a transcribed region of a gene, and has a start codon in one of the strands only: 5′ GCGTAATTGCCGCATTTТСААТАА 3’ 3' CGCATTAACGGCGTAAAGTTATT 5' A. Which is the template strand? TOP [3' TAC 5' on the template strand] B. Which is the coding strand? BOTTOM C. Write out the mRNA sequence that will be synthesized from this sequence. D. Translate the mRNA sequence to protein: N-Met-Arg-Gln-Leu-Arg-C E. In the above sequence, if the underlined cytosine on the top strand is changed to G, what would happen to the product of transcription, and what would happen to the product of translation? F. What is meant when we say the genetic code is redundant? Explain with an example of a specific codon.
The following DNA sequence is part of a transcribed region of a gene, and has a start codon in one of the strands only: 5′ GCGTAATTGCCGCATTTТСААТАА 3’ 3' CGCATTAACGGCGTAAAGTTATT 5' A. Which is the template strand? TOP [3' TAC 5' on the template strand] B. Which is the coding strand? BOTTOM C. Write out the mRNA sequence that will be synthesized from this sequence. D. Translate the mRNA sequence to protein: N-Met-Arg-Gln-Leu-Arg-C E. In the above sequence, if the underlined cytosine on the top strand is changed to G, what would happen to the product of transcription, and what would happen to the product of translation? F. What is meant when we say the genetic code is redundant? Explain with an example of a specific codon.
Practice the effects of a point mutation by using an example of a DNA coding region (any shown in these practice questions). a. What is the effect of deleting one base? Two bases? Three bases? b. What is the effect of changing one base to another on the template strand e.g. G to C? c. What is the effect of changing the sequence of the three bases within one codon? Three bases that span over two codons? e.g. the third base of one codon and the first 2 bases of the next codon.
Practice the effects of a point mutation by using an example of a DNA coding region (any shown in these practice questions). a. What is the effect of deleting one base? Two bases? Three bases? b. What is the effect of changing one base to another on the template strand e.g. G to C? c. What is the effect of changing the sequence of the three bases within one codon? Three bases that span over two codons? e.g. the third base of one codon and the first 2 bases of the next codon.
One of the DNA replication proteins/enzymes is altered in a way that it results in an increased rate of mismatched bases in the newly synthesized DNA strand. Which function is most likely to be disrupted?
One of the DNA replication proteins/enzymes is altered in a way that it results in an increased rate of mismatched bases in the newly synthesized DNA strand. Which function is most likely to be disrupted?
The following nucleotide sequence encodes the C terminus region of a wild type (also called “native” or “normal” or wildtype) protein. The stop codon is underlined. Native: 5'-GCCTCTAAAATCAGGAGAACACAСТАА-3' 3'-CGGAGATTTTAGTCCTCTTGTGTGATT-5' The highlighted bases are mutated to the form below: Mutant: 5'-GCCTСТТАААТCAGGAGAACACAСТAA-3' 3'-CGGAGAATTTAGTCCTCTTGTGTGATT-5' Predict the consequence of this base change from A to T on the protein produced.
The following nucleotide sequence encodes the C terminus region of a wild type (also called “native” or “normal” or wildtype) protein. The stop codon is underlined. Native: 5'-GCCTCTAAAATCAGGAGAACACAСТАА-3' 3'-CGGAGATTTTAGTCCTCTTGTGTGATT-5' The highlighted bases are mutated to the form below: Mutant: 5'-GCCTСТТАААТCAGGAGAACACAСТAA-3' 3'-CGGAGAATTTAGTCCTCTTGTGTGATT-5' Predict the consequence of this base change from A to T on the protein produced.
Explain what the difference is between an error in DNA replication and a mutation.
Explain what the difference is between an error in DNA replication and a mutation.
MalT is a ______ regulator of the malPQ operon
MalT is a ______ regulator of the malPQ operon
Flashcards
What interactions stabilize DNA's secondary structure?
What interactions stabilize DNA's secondary structure?
Interactions between complementary bases (A-T, G-C) and stacking interactions between bases in the same strand stabilize DNA's double helix structure.
How is the directionality of a DNA molecule written?
How is the directionality of a DNA molecule written?
The direction of a DNA molecule is written from the 5' end (phosphate group) to the 3' end (hydroxyl group).
How is the directionality of a protein molecule written?
How is the directionality of a protein molecule written?
The direction of a protein molecule is written from the N-terminus (amino group) to the C-terminus (carboxyl group).
What linkage forms the backbone of a nucleic acid?
What linkage forms the backbone of a nucleic acid?
Signup and view all the flashcards
What do the terms 5' and 3' refer to in DNA or RNA?
What do the terms 5' and 3' refer to in DNA or RNA?
Signup and view all the flashcards
What is Chargaff's rule?
What is Chargaff's rule?
Signup and view all the flashcards
Why do purines and pyrimidines pair in DNA?
Why do purines and pyrimidines pair in DNA?
Signup and view all the flashcards
Which label points to the 5' end of one of the DNA strands?
Which label points to the 5' end of one of the DNA strands?
Signup and view all the flashcards
What does it mean that DNA strands are antiparallel?
What does it mean that DNA strands are antiparallel?
Signup and view all the flashcards
What is false about complementary base pairing in DNA?
What is false about complementary base pairing in DNA?
Signup and view all the flashcards
What is transcription?
What is transcription?
Signup and view all the flashcards
What is translation?
What is translation?
Signup and view all the flashcards
What is the difference between DNA replication and protein synthesis?
What is the difference between DNA replication and protein synthesis?
Signup and view all the flashcards
What is the difference in chromosome structure between eukaryotes and bacteria?
What is the difference in chromosome structure between eukaryotes and bacteria?
Signup and view all the flashcards
Where does transcription occur in eukaryotes and bacteria?
Where does transcription occur in eukaryotes and bacteria?
Signup and view all the flashcards
What is the difference in promoter structure between eukaryotes and bacteria?
What is the difference in promoter structure between eukaryotes and bacteria?
Signup and view all the flashcards
Do eukaryotes and bacteria require splicing?
Do eukaryotes and bacteria require splicing?
Signup and view all the flashcards
Do eukaryotes and bacteria modify their mRNA transcripts?
Do eukaryotes and bacteria modify their mRNA transcripts?
Signup and view all the flashcards
Where does translation occur in eukaryotes and bacteria?
Where does translation occur in eukaryotes and bacteria?
Signup and view all the flashcards
Can translation occur simultaneously with transcription in eukaryotes and bacteria?
Can translation occur simultaneously with transcription in eukaryotes and bacteria?
Signup and view all the flashcards
What are transcription factors and what do they do?
What are transcription factors and what do they do?
Signup and view all the flashcards
What determines the start site for transcription in E. coli?
What determines the start site for transcription in E. coli?
Signup and view all the flashcards
How do DNA binding proteins recognize their specific binding sites?
How do DNA binding proteins recognize their specific binding sites?
Signup and view all the flashcards
What is the difference between bacterial and eukaryotic mRNAs?
What is the difference between bacterial and eukaryotic mRNAs?
Signup and view all the flashcards
Why is translation not simultaneous with transcription in eukaryotes?
Why is translation not simultaneous with transcription in eukaryotes?
Signup and view all the flashcards
What is alternative splicing?
What is alternative splicing?
Signup and view all the flashcards
What happens to a eukaryotic mRNA without a poly A tail?
What happens to a eukaryotic mRNA without a poly A tail?
Signup and view all the flashcards
What's the difference between introns and exons?
What's the difference between introns and exons?
Signup and view all the flashcards
How is translation initiated in bacteria and eukaryotes?
How is translation initiated in bacteria and eukaryotes?
Signup and view all the flashcards
What sequences terminate transcription and translation?
What sequences terminate transcription and translation?
Signup and view all the flashcards
What is the wobble hypothesis?
What is the wobble hypothesis?
Signup and view all the flashcards
What is the function of tRNAs in translation?
What is the function of tRNAs in translation?
Signup and view all the flashcards
What is the function of aminoacyl-tRNA synthetases?
What is the function of aminoacyl-tRNA synthetases?
Signup and view all the flashcards
What are the steps of translation initiation in bacteria?
What are the steps of translation initiation in bacteria?
Signup and view all the flashcards
Why do cells use a two-step process for synthesizing proteins?
Why do cells use a two-step process for synthesizing proteins?
Signup and view all the flashcards
Why do not all mutations cause a change in phenotype?
Why do not all mutations cause a change in phenotype?
Signup and view all the flashcards
What is the difference between an error in DNA replication and a mutation?
What is the difference between an error in DNA replication and a mutation?
Signup and view all the flashcards
What is MalT's regulatory role in the malPQ operon?
What is MalT's regulatory role in the malPQ operon?
Signup and view all the flashcards
What are the functions of the lac and mal operons?
What are the functions of the lac and mal operons?
Signup and view all the flashcards
What are the regulatory proteins of the lac and mal operons and how do they work?
What are the regulatory proteins of the lac and mal operons and how do they work?
Signup and view all the flashcards
How do high levels of lactose and maltose affect their respective operons?
How do high levels of lactose and maltose affect their respective operons?
Signup and view all the flashcards
What is the type of regulation in the lac and mal operons?
What is the type of regulation in the lac and mal operons?
Signup and view all the flashcards
What features do protein coding regions within an operon share?
What features do protein coding regions within an operon share?
Signup and view all the flashcards
What is the role of arginine in regulating the arginine operon?
What is the role of arginine in regulating the arginine operon?
Signup and view all the flashcards
How does lactose affect the regulation of the lac operon?
How does lactose affect the regulation of the lac operon?
Signup and view all the flashcards
What is the key difference between LacI and MalT?
What is the key difference between LacI and MalT?
Signup and view all the flashcards
What are the correct statements about the regulation of the lac operon?
What are the correct statements about the regulation of the lac operon?
Signup and view all the flashcards
What does it mean that DNA replication is semi-conservative?
What does it mean that DNA replication is semi-conservative?
Signup and view all the flashcards
How do the dNTPs get incorporated into the new DNA strand?
How do the dNTPs get incorporated into the new DNA strand?
Signup and view all the flashcards
Why are primers necessary for DNA synthesis?
Why are primers necessary for DNA synthesis?
Signup and view all the flashcards
What is the difference between the leading and lagging strand of DNA replication?
What is the difference between the leading and lagging strand of DNA replication?
Signup and view all the flashcards
What is the function of DNA ligase in DNA replication?
What is the function of DNA ligase in DNA replication?
Signup and view all the flashcards
What are the major challenges in DNA replication and how are they overcome?
What are the major challenges in DNA replication and how are they overcome?
Signup and view all the flashcards
What is the polymerase chain reaction (PCR)?
What is the polymerase chain reaction (PCR)?
Signup and view all the flashcards
What happens during the denaturation step of PCR?
What happens during the denaturation step of PCR?
Signup and view all the flashcards
What happens during the annealing step of PCR?
What happens during the annealing step of PCR?
Signup and view all the flashcards
What happens during the extension step of PCR?
What happens during the extension step of PCR?
Signup and view all the flashcards
What are the components needed for PCR?
What are the components needed for PCR?
Signup and view all the flashcards
What information is needed to design primers for PCR?
What information is needed to design primers for PCR?
Signup and view all the flashcards
How should primers be designed for a PCR experiment?
How should primers be designed for a PCR experiment?
Signup and view all the flashcards
What are the steps involved in a PCR cycle?
What are the steps involved in a PCR cycle?
Signup and view all the flashcards
What are the products of a PCR experiment?
What are the products of a PCR experiment?
Signup and view all the flashcards
Why does PCR not require helicase?
Why does PCR not require helicase?
Signup and view all the flashcards
Which primers should be used to amplify the promoter region of a gene using PCR?
Which primers should be used to amplify the promoter region of a gene using PCR?
Signup and view all the flashcards
What are the statements that are FALSE about both RNA and DNA polymerase?
What are the statements that are FALSE about both RNA and DNA polymerase?
Signup and view all the flashcards
Study Notes
General Study Notes
- These notes cover various topics, from DNA structure to biological information flow, transcription, and translation.
- The provided material includes study questions, exam-style questions, and short answer questions, aiming to test various levels of understanding.
- The notes highlight interactions, directionality, and linkages within molecules like DNA and proteins.
- Biological information flow, including the processes of transcription and translation, is discussed.
- The relationship between DNA replication and protein synthesis is explored, along with the processes' similarities and differences.
- The text describes transcription, gene structure, and comparison between eukaryotes and bacteria.
- The study notes cover topics relating to antiparallel strands, base pairing, and the components of DNA (nucleotides).
- The notes touch upon the process of transcription and the components essential for its initiation and regulation.
- The provided material details various concepts, including transcription factors, DNA binding sequences, and protein structure.
- The relationship between the type of base pairing and stability is also explored.
- Study notes contain questions relating to the practical application of learning objectives and fundamentals, including examples of transcription and differences between eukaryotic and prokaryotic transcription.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
