Biology Study Notes: DNA and Protein Synthesis

Play an AI-generated podcast conversation about this lesson

What interactions serve to stabilize/hold DNA together in its secondary structure? Explain how this stabilizes DNA in its aqueous environment.

Hydrogen bonds between strands (base pairing), stacking interactions (mostly ID-ID) above and below in the same strand. The stacking interactions allow for the hydrophobic surfaces to be excluded from water, allowing water to have more motional freedom and thereby increasing stability.

By convention how is the directionality of a DNA molecule written?

5' to 3'

By convention how is the directionality of a protein molecule written?

N to C

Which linkage forms the backbone of a nucleic acid?

A Sugar-phosphate linkage (A) Signup and view all the answers

In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime" or "3'-prime to 5-prime"). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.

The direction of the strands. (B), One of the two DNA strands. (C), Particular carbon atoms on the ribose or deoxyribose ring. (D), The sequence of the bases in the DNA or RNA. (E) Signup and view all the answers

In a bacterium, 14% of the DNA nucleotides were found to be Thymine. What proportions of the bases would be Guanine?

14% G (B) Signup and view all the answers

In normal double-stranded DNA, purines base pairs with only certain types of pyrimidines. This is because...

purine-pyrimidine pairs maximize the number of hydrogen bonds, making the DNA more stable. (A), the strongest stacking interactions are found between purines and pyrimidines, making the DNA more stable (C) Signup and view all the answers

Two strands of a short DNA molecule with 3 base pairs are shown below. The dotted lines indicate hydrogen bonds. Five atoms are labelled from 1 to 5. Indicate which label correctly points to one of the 5' ends of one of the DNA strands.

5 (C) Signup and view all the answers

DNA is double stranded and the two strands are said to run in an antiparallel fashion. The term antiparallel refers to which observation?

One strand of DNA runs 5' to 3' while the other strand runs in the opposite direction from 3' to 5' (A) Signup and view all the answers

Anti-parallel strands of DNA form complementary base pairing by hydrogen bonds. Which of the following statements is false regarding base pairing?

Adenine is always linked to a thymine by a phosphodiester bond. (A) Signup and view all the answers

Transcription is the process of copying to .

Signup and view all the answers

Label the ends of the two strands of DNA below to indicate their directionality. Assuming this small segment of DNA was part of a larger segment of DNA not shown, indicate where a new nucleotide would be added if either of these strands were extended further.

A new nucleotide would be added to the 3' end of the strand with a free OH group. Signup and view all the answers

Translation is the synthesis of from .

protein from mRNA Signup and view all the answers

Describe the general difference between DNA replication and protein synthesis. When does the cell use either of these processes? Are there similarities?

DNA replication is the process of copying the entire genome, producing two identical DNA molecules. This occurs before cell division. Protein synthesis is the process of creating a specific protein molecule based on the information in mRNA. This occurs whenever a cell needs to express a particular protein. A similarity between the two is that they both involve the use of a template, either DNA for replication and mRNA for protein synthesis, to guide the construction of the new molecule. Signup and view all the answers

Transcription factors only bind specific DNA sequences. What part of the DNA molecule would you predict is most important for specific interactions between a transcription factor like Sigma and the promoter sequence it binds?

The bases (B) Signup and view all the answers

What determines where the E. coli RNA Polymerase initiates transcription?

The binding of the sigma subunit to the DNA binding sequences upstream of the transcription start site. (D) Signup and view all the answers

What features of a DNA binding protein are required to recognize the correct binding site on DNA?

They can make specific ionic interactions with the phosphodiester backbone of the DNA only at that sequence. (A), They make specific non-covalent interactions with the exposed bases of the DNA only at that sequence. (B), Part of their 3D structure is the right size/ shape/charge/polarity to interact with the major and minor grooves of that sequence of DNA. (C) Signup and view all the answers

Which of the following describes the comparison of typical bacterial and eukaryotic mRNAs?

Eukaryotic mRNAs are spliced before translation but bacterial mRNAs are not. (B), Eukaryotic mRNAs can accommodate several ribosomes, but bacterial mRNAs cannot. (C), Eukaryotic mRNAs have 5' untranslated regions, but bacterial mRNAs do not. (E) Signup and view all the answers

The fact that translation is not simultaneous with transcription in eukaryotes is primarily due to:

the fact that the processed mRNA needs to be exported to the cytoplasm for translation. (E) Signup and view all the answers

Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells?

1, 2, 3 (B) Signup and view all the answers

Which of the following statements about alternative splicing are true?

1, 3 and 4. (E) Signup and view all the answers

What would happen to an mRNA strand in a eukaryotic cell if during RNA processing the poly A tail is not added? CHOOSE ALL THAT APPLY

The mRNA strand would no longer be protected by the poly A tail and would be more easily degraded by ribonucleases. (C), The mRNA strand would not be able to leave the nucleus as the tail is necessary to pass through the nuclear membrane. (D) Signup and view all the answers

An intron is ; and an exon is typically

RNA that is removed during the processing of an mRNA molecule and degraded in the nucleus; part of an intact, mature mRNA that leaves the nucleus. (B) Signup and view all the answers

Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. See next page...

If Serine were in the protein there would be a substantial decrease in R-group size, and there would be no possibility for ionic bonds, decreasing the strength and frequency of protein-DNA binding. This would likely result in less frequent transcription. Signup and view all the answers

Compared to the original situation: In the DNA sequence, if guanine were replaced by thymine (shown at right), predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.

With a base substitution, different non-covalent interactions will be possible between the protein and the side of the base. i.e. from purine to pyrimidine structures This could also perturb the regular structure of the DNA. For both of these reasons, it is likely that the frequency of protein-DNA binding will decrease. This would likely result in less frequent transcription. Signup and view all the answers

The cartoon below represents the process of transcription as observed in an electron micrograph. On the diagram below indicate the directionality (5' or 3') in the boxes against the structure.

Template strand (DNA) read 3' to 5'; transcript (RNA) synthesized 5' to 3' Signup and view all the answers

How is translation initiated in bacteria? What part of the mRNA transcript does the ribosome bind to? How does this differ in Eukaryotes?

In bacteria, translation typically starts when the ribosome binds to the Shine-Dalgarno sequence, located upstream of the start codon. In eukaryotes, translation initiation is more complex, with the ribosome binding to the 5' cap of the mRNA, then scanning until it recognizes the start codon. Signup and view all the answers

What specific sequence or region leads to transcription termination and translation termination?

The terminator sequence mediates transcription termination. Translation is terminated by the stop codon. Signup and view all the answers

If a given tRNA has an anticodon of 5-ACU-3′, what is the mRNA codon, what is the template strand DNA sequence, and which amino acid does it carry? (3points)

tRNA 3'-UCA-5' or 5'-ACU-3' mRNA: 5'-AGU-3' or 3'-UGA-5' template strand: 5'-ACT-3' or 3'-TCA-5' Amino acid: Ser Signup and view all the answers

Given that there are 61 codons for the 20 amino acids, which of the following is good evidence for the wobble hypothesis?

The fewer than 60 different types of tRNA in a cell. (D) Signup and view all the answers

The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines)

N - cysteine - asparagine - valine - serine - C (D) Signup and view all the answers

A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA?

4 only (A), 1, 4 and 5 only (D), 1 only (E) Signup and view all the answers

Shown below is a portion of an mRNA stretch, starting at the start codon: AUG GGG AGU AAA UUU The DNA encoding this region would be correctly written as:

3' ATGGGGAGTAAATTT 5' Signup and view all the answers

What is the function of aminoacyl-tRNA synthetases?

They catalyze the covalent attachment of an amino acid to the correct tRNA. (C) Signup and view all the answers

Which of the following statements about translation in bacteria are TRUE?

2, 3 and 5. (B) Signup and view all the answers

Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell?

1, 2 and 3. (D) Signup and view all the answers

Not all mutations in a protein coding region cause a change in phenotype. Explain giving 2 examples.

Example: If say a silent mutation will result in no change in phenotype then you must add that there is no change in the polypeptide and/or no change in the shape and function of the protein. If you use base-substitution mutations for both examples then you must explain 2 different ways this can result in no change in phenotype. Some examples...The genetic code is degenerate – some amino acids have more than one codon and a mutation in a codon can result in the same amino acid and no change in the protein. Amino acid substitutions of similar types might not lead to a change in protein function or the substitution is present in the polypeptide chain that does not change the protein shape (folding) or function. Signup and view all the answers

Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. B. A hydrogen atom is present on the 3' carbon of the “ribose” of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. C. Ribosomes transcribe RNA and RNA polymerase translates RNA.

A. The nitrogenous base thymine is present in DNA while uracil is present in RNA in place of thymine. B. A hydrogen atom is present on the 2' carbon the ribose of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. C. Ribosomes translate RNA and RNA polymerase transcribes DNA into RNA. Signup and view all the answers

In describing DNA or RNA, you will see the term 5' to 3' (verbally, this is “5-prime to 3-prime” or “3'-prime to 5-prime”). The terms 5' and 3' (or 3' to 5') apply to which of the statement(s) below? Choose all that apply.

The sequence of the bases in the DNA or RNA. (A), The direction of the strands. (B), One of the two DNA strands. (C), Particular carbon atoms on the ribose or deoxyribose ring. (D) Signup and view all the answers

Transcription is the process of copying_ to _.

DNA to RNA Signup and view all the answers

Translation is the synthesis of _ from _.

protein from mRNA Signup and view all the answers

Transcription comparison: Is splicing (removal of introns) required?

yes (A) Signup and view all the answers

Transcription comparison: Is capping and tailing of mRNA?

yes (A) Signup and view all the answers

Transcription comparison: Site of translation?

cytoplasm (A), cytoplasm (B) Signup and view all the answers

Transcription comparison: Can translation occur while transcription is still occurring?

yes (A), no (B) Signup and view all the answers

What features of a DNA binding protein are required to recognize the correct binding site on DNA? 1. They can make specific ionic interactions with the phosphodiester backbone of the DNA only at that sequence. 2. They make specific non-covalent interactions with the exposed bases of the DNA only at that sequence. 3. Part of their 3D structure is the right size/ shape/charge/polarity to interact with the major and minor grooves of that sequence of DNA.

2 and 3 (C) Signup and view all the answers

Which of the following components come together to form the initiation complex so that transcription can begin in eukaryotic cells? 1. Sigma factor. 2. General transcription factors. 3. RNA Polymerase. 4. TATA Binding Protein.

2, 3, 4 (C) Signup and view all the answers

Which of the following statements about alternative splicing are true? 1. introns are spliced out and exons are joined together. 2. exons are spliced out and introns are joined together. 3. is a form of post-translational control of gene expression. 4. reduces the number of genes needed to express different proteins.

1, 3 and 4. (D) Signup and view all the answers

Shown at right is the interaction between an amino acid side chain (Arginine) in the bacterial DNA-binding protein, sigma, and a nucleotide base (guanine) within the promoter of a gene. If Arginine were replaced with by Serine in the protein (both shown below) predict what would be the effect on the protein-DNA binding. Could this replacement have an effect on transcription of this gene? Explain your reasoning for your prediction.

If Serine were in the protein there would be a substantial decrease in R-group size, and there would be no possibility for ionic bonds, decreasing the strength and frequency of protein-DNA binding. This would likely result in less frequent transcription. Signup and view all the answers

The DNA sequence below (the template strand) is part of the coding region of a gene. What would be the sequence of amino acids for this portion of DNA? (the reading frame is indicated by the vertical lines) 3' ACG|ATT|CTT|TGC 5' 5' UGC UAA (stop)

N- cysteine - asparagine - valine - serine - C Signup and view all the answers

A region of DNA is transcribed and the mRNA is translated into a sequence of amino acids. The sequence of amino acids that is encoded by this strand is: NH2 - serine - alanine - lysine - leucine - COOH. What is/are the possible sequence(s) of the corresponding template DNA? 1. 3′-CAATTTAGCAGA-5’ 2. 3'-AGTCGGTTCGAT-5′ 3. 3'-AGACGATTTAAC-5′ 4. 3'-GTTAAATCGTCT-5′ 5. 3'-TCTGCTAAATTG-5′ 6. 3′-AGACGATTCGAC-5′

1, 4 and 5 only (A) Signup and view all the answers

Which of the following statements about translation in bacteria are TRUE? 1. Proteins called initiation factors contribute to the interaction between the RNA in ribosome small subunit at the 5' cap. 2. An internal sequence in the mRNA specifies where the ribosome binds. 3. Complementary sequences in the tRNAs translate mRNA sequence into protein sequence . 4. Some regions of the mRNA are removed before translation. 5. A release factor ends protein synthesis by binding to the stop codon and to trigger the release of the polypeptide chain.

2, 3 and 5. (A) Signup and view all the answers

Cells use a two-step process (transcription and translation) to synthesize proteins from the information carried in the DNA, instead of directly translating information in the DNA to proteins. Which of the following statements could explain why this two-step process might benefit the cell? 1. There are more places to control protein synthesis. 2. More proteins can be produced in a given time period. 3. Resolves the problem of the ribosomes being too large to interact with DNA. 4. DNA does not need to have the sequence for the ribosome binding sites (RBS).

1, 2 and 3. (C) Signup and view all the answers

Each of the statements below is false. Re-write the statements to make them factually correct. You must re-write the statements for full points. Examples of changes we were looking for: A. The nitrogenous base thymine is present in DNA and RNA, while uracil is present only in RNA. (F)

A. The nitrogenous base thymine is present in DNA while uracil is present in RNA in place of thymine. B. A hydrogen atom is present on the 2' carbon the ribose of DNA nucleotides, whereas a hydroxyl group is present at the same position on RNA nucleotides. C. Ribosomes translate RNA and RNA polymerase transcribes DNA into RNA. Signup and view all the answers

The antibiotic called streptomycin is known to bind to the ribosome. Streptomycin distorts the ribosome structure so the ribosome does not stabilize the correct codon-anticodon base pairs. Instead, the ribosome stabilizes incorrect codon-anticodon base pairs. Consider a ribosome where streptomycin is present during translation. Compared to normal translation, do you predict that the proteins being translated by the streptomycin-bound ribosome will have:

more mistakes (C) Signup and view all the answers

Explain your choice in one short sentence.

Eg The wrong tRNA will be able to H-bond (or recognize) the mRNA in the ribosome and this may add the wrong amino acid. Therefore, mistakes will be observed due to incorrect amino acids in the protein's polypeptide sequence. Signup and view all the answers

The following DNA sequence is part of a transcribed region of a gene, and has a start codon in one of the strands only: 5′ GCGTAATTGCCGCATTTТСААТАА 3’ 3' CGCATTAACGGCGTAAAGTTATT 5' A. Which is the template strand? TOP [3' TAC 5' on the template strand] B. Which is the coding strand? BOTTOM C. Write out the mRNA sequence that will be synthesized from this sequence. D. Translate the mRNA sequence to protein: N-Met-Arg-Gln-Leu-Arg-C E. In the above sequence, if the underlined cytosine on the top strand is changed to G, what would happen to the product of transcription, and what would happen to the product of translation? F. What is meant when we say the genetic code is redundant? Explain with an example of a specific codon.

A. Which is the template strand? TOP [3' TAC 5' on the template strand] B. Which is the coding strand? BOTTOM C. Write out the mRNA sequence that will be synthesized from this sequence. 5'-UUAUUGAAAUGCGGCAAUUACGC-3' D. Translate the mRNA sequence to protein: N-Met-Arg-Gln-Leu-Arg-C E. In the above sequence, if the underlined cytosine on the top strand is changed to G, what would happen to the product of transcription, and what would happen to the product of translation? The transcript would contain a C instead of a G at that position. No change to the protein product as the codons 5'-CGG-3' and 5'-GGC-3' both code for Arginine. F. What is meant when we say the genetic code is redundant? Explain with an example of a specific codon. Redundant: More than one codon can specify the addition of the same amino acid. E.g. Tyrosine has at least two codons. Or, the above example with Arginine. Signup and view all the answers

Practice the effects of a point mutation by using an example of a DNA coding region (any shown in these practice questions). a. What is the effect of deleting one base? Two bases? Three bases? b. What is the effect of changing one base to another on the template strand e.g. G to C? c. What is the effect of changing the sequence of the three bases within one codon? Three bases that span over two codons? e.g. the third base of one codon and the first 2 bases of the next codon.

a. What is the effect of deleting one base? Two bases? Three bases? Deleting one or two bases in a coding sequence will cause a frameshift mutation, which changes the reading frame and results in a completely different protein being synthesized. Deleting three bases will remove one codon but the reading frame will not be affected, which may or may not result in functional changes depending on the specific codon that was deleted. b. What is the effect of changing one base to another on the template strand e.g. G to C? Changing one base to another on the template strand can result in a missense mutation, a nonsense mutation, or a silent mutation. Missense mutation: If the change results in a different amino acid being encoded, then it will likely affect the protein's structure and function. Nonsense mutation: If the change results in a stop codon, then the protein will be truncated and may be non-functional. Silent mutation: If the change does not result in a different amino acid being encoded, then the protein will be unchanged. c. What is the effect of changing the sequence of the three bases within one codon? Three bases that span over two codons? e.g. the third base of one codon and the first 2 bases of the next codon? Changing the sequence of the three bases within one codon can result in a missense mutation, a nonsense mutation, or a silent mutation, as explained above. Changing the sequence of the three bases that span over two codons can result in a frameshift mutation, causing a change in the reading frame. Signup and view all the answers

One of the DNA replication proteins/enzymes is altered in a way that it results in an increased rate of mismatched bases in the newly synthesized DNA strand. Which function is most likely to be disrupted?

the proofreading function of DNA polymerase (A) Signup and view all the answers

The following nucleotide sequence encodes the C terminus region of a wild type (also called “native” or “normal” or wildtype) protein. The stop codon is underlined. Native: 5'-GCCTCTAAAATCAGGAGAACACAСТАА-3' 3'-CGGAGATTTTAGTCCTCTTGTGTGATT-5' The highlighted bases are mutated to the form below: Mutant: 5'-GCCTСТТАААТCAGGAGAACACAСТAA-3' 3'-CGGAGAATTTAGTCCTCTTGTGTGATT-5' Predict the consequence of this base change from A to T on the protein produced.

The mutation would result in a shorter protein. Signup and view all the answers

Explain what the difference is between an error in DNA replication and a mutation.

Mutation: A mutation is any permanent change in the DNA sequence. Mutations that change the DNA sequence are heritable and/or passed down to daughter cells. Error in DNA Replication: An error in DNA replication is when the DNA polymerase makes a mistake in the synthesis of the daughter DNA strand (newly synthesized strand). For example, DNA polymerase can skip a base, or add the wrong nucleotide (mismatch). This error, however only exists on one of the DNA strands, as the template strand maintains the correct sequence. This error can potentially be repaired through DNA repair mechanisms. If it persists through a second round of DNA replication, then one of the daughter cells will possess the changed sequence in both strands. This is how mutations can arise from errors in DNA replication. Signup and view all the answers

MalT is a ______ regulator of the malPQ operon

Positive Signup and view all the answers