PL1003 Lecture 3.3 - DNA Replication, Transcription, & Translation PDF

DNA replication, transcription and translation Dr. Gemma Barron [email protected] This Photo by Unknown Author is licensed under CC BY-SA-NC Today’s Learning Outcomes At the end of today’s class, you should be able to: Describe the process of DNA replication....

DNA replication, transcription and translation Dr. Gemma Barron [email protected] This Photo by Unknown Author is licensed under CC BY-SA-NC Today’s Learning Outcomes At the end of today’s class, you should be able to: Describe the process of DNA replication. Discuss how DNA is transcribed to RNA and how RNA is translated into a protein. This Photo by Unknown Author is licensed under CC BY-SA-NC Discuss the effects of different types of mutation on DNA and protein structure. Why is this important? Understanding drug mechanisms Pharmacogenomics and personalised medicine Mechanisms of drug resistance Biologic and biopharmaceutical development Understanding adverse drug reactions and toxicology Future innovations and research  DNA replication, transcription and translation DNA replication ·Making an identical DNA copy of a template DNA molecule; essential during cell division Transcription ·Copying the information from DNA into a messenger RNA molecule Translation ·converting or translating the information carried in the mRNA molecule into a sequence of amino acids to form a protein DNA is a ‘biological blueprint’: carries information that will allow proteins to be built 05 September Dhorspool at en.wikipedia, CC BY-SA 3.0 , via 4 2023 Wikimedia Commons  The Central Dogma Genetic information can pass from: ·nucleic acid to nucleic acid ·Nucleic acid to protein ·NOT protein to nucleic acid DNA (transcribed to) → RNA (translated to) → protein Gene expression = production of a functional protein. Multiple levels of control: ·Transcriptional regulation (production of RNA) ·Post-transcriptional regulation (e.g., splicing) ·Translation 05 September Dhorspool regulation at en.wikipedia, CC BY-SA 3.0 , via 4 2023 Wikimedia Commons Genes and genomes Thomas Shafee via Wikimedia commons. This file is licensed under theCreative CommonsAttribution 4.0 5 International license. DNA Replication DNA OpenStax CNX. Access for free athttps://openstax.org/books/microbiology/pages/1-introduction. Textbook 7 content produced by OpenStax is licensed under a Creative Commons Attribution License 4.0 license. Complementary Base Pairing Hydrogen bonds OpenStax CNX. Access for free athttps://openstax.org/books/microbiology/pages/1- introduction. Textbook DNA Replication (1) Takes place before the cell divides (during Interphase of Mitosis and Meiosis) Complementary chains each act as template for one new strand in DNA replication. Synthesis of new strand can only occur in one direction, i.e., 5’ → 3’. Template strand read 3’ → 5’ Semiconservative: each parent strand serves as a template for a new strand, and the two new DNA molecules each have one old and one new strand  DNA Replication (2) ·The double helix is unwound by helicases ·Each new DNA strand grows from its 5′ end to its 3′ end ·Leading strand synthesised continuously by the action of the enzyme DNA polymerase ·Lagging strand is synthesised in chunks called Okazaki fragments, which are joined together by a ligase 05 September Image source: By LadyofHats [Public domain], viaWikimedia Commons 10 2023 Transcription RNA vs DNA Ribose sugar (i.e., hydroxyl group on the 2’ position) Thymine is replaced by uracil Single stranded Types of RNA Messenger RNA (mRNA) Structure: A single strand of ~1000 nucleotides Function: Carrying the genetic code from DNA in the nucleus to ribosome in the cytoplasm Ribosomal RNA (rRNA) Structure: Large and complex, often form a double helix. Ribosomes are made up of rRNA and protein. Function: Responsible for reading the order of the amino acids and linking them together Transfer RNA (tRNA) Structure: Small molecules of ~ 80 nucleotides Function: tRNA bring amino acids to the ribosomes to assemble a protein Transcription Transcription is the process by which mRNA is made in the nucleus Carried out by RNA polymerase mRNA is built from 5’ end to 3’ end RNA is transcribed from a DNA template after the bases of DNA are exposed by unwinding of the double helix (to create a copy of the coding strand) In a given region of DNA, only one of the two strands can act as a template for transcription  Template and coding strands Coding strand: if you want to display the sequence of the gene, this is what you would use (5’-3’). The RNA transcript has the same sequence but with U instead of T. Template strand: Used to make the RNA transcript. RNA polymerase produces an RNA transcript complementary to the template strand. Kep17, CC BY-SA 4.0 , via Wikimedia Commons, 15 https://commons.wikimedia.org/wiki/File:Process_of_DNA_transcription.png Rate of transcription Changes in the rate of transcription acts as an important checkpoint in deciding which proteins are made and in what quantities. Why might WE need to alter the rate of transcription? Regulation of transcription Different cells express different genes Levels of mRNA transcripts in a cell reflects genes actively being expressed. Housekeeping – necessary for basic functions, constitutively expressed Cell-type specific, e.g., T cell receptor Changing functional requirements, e.g., inflammatory cytokines RNA is less stable than DNA – regulates gene expression For transcription we need: To open the double stranded DNA template A supply of nucleotides RNA polymerase Transcription factors We will talk about these next week but, they are proteins that bind to DNA and regulate transcription: Basal transcription machinery Altering the rate of transcription – turn off / on or up / down to biological or environmental factors Promotors and Enhancers Promoter Upstream of the coding sequence of the gene NOT transcribed TATA box with consensus 5’- TATAAA-3’ Basal transcription factors bind to the TATA box, recruiting RNA polymerase Enhancer Region Short section of DNA found up to 1,000,000 bp up- or down-stream of the gene Binds to transcription factors, altering rate of transcription Different enhancers are specific to different transcription factors Post-transcriptional modifications Additional processing of RNA transcript in eukaryotes Poly A “tail” added for stability and export Introns (non-coding region) cut out; exons (coding region) joined This process is called ‘splicing’ Alternative splicing: mRNA from the same gene may be spliced in more than one way Different proteins from same transcript are expressed in: Different cell types, or At different stages of development This is why complex animals do not have more genes! Translation Can you work out the amino acid sequence? 5’ CCAUGCUUCAUCGCUCGCUUGUUUAACGU 3’ Genetic code Consists of triplets of nucleotides (codons) Since there are four bases (A, T, C and G), there are 64 possible codons (43) Genetic code is degenerate as each codon has meaning, e.g., some amino acids specified by MORE THAN one codon e.g. leu, pro However, a single codon does not specify more than one amino acid Start codon AUG codes N formyl methionine, present at the start of proteins. AUG also encodes the amino acid methionine elsewhere in proteins. Stop codons  Translation Mature mRNA transcript can now be taken to the ribosome for translation mRNA dictates the order in which amino acids are added to the growing polypeptide chain Each set of 3 bases forms a codon The codon is recognised by transfer RNA (tRNA) The tRNA has an anti-codon which binds to the codon The tRNA is bound to an amino acid (dictated by the codon) By Boumphreyfr vector conversion by Glrx - File:Peptide syn.png, CC BY-SA 3.0, 24 https://commons.wikimedia.org/w/index.php?curid=101457889 Stages of translation Activation Amino acid binds to tRNA Initiation Ribosome binds to the 5’ end of the mRNA Translation begins with the start codon (AUG) Reading frame determined Elongation Ribosome moves along the mRNA adding amino acids to the polypeptide chain Termination Ribosome reaches the stop codon Post-translational modifications Occurs in the ER and Golgi Modifies Structure Function / activity Location Interactions Includes Glycosylation Lipidation Phosphorylation Methylation Acetylation Mutations Mutations A mutation is a change in the nucleotide sequence of DNA that can be passes on from one cell or organism to another. Not all mutations affect phenotypes. Types of mutations: Point – change of 1 nucleotide Silent, Missense or Nonsense Frameshift – deletion / addition of 1 or 2 bases results in a whole reading frame shifting Deletion of (multiples of) 3 bases = missing amino acid Insertion of (multiples of) 3 bases = extra amino acid Point Mutation: Silent  Point Mutation: Missense Generation of a stop codon -3 truncated protein -3 nonsense mutation In simple form: Clinical Significance of Mutation Several conditions have point mutations or deletions as their cause. Cancers Tay-Sachs Cystic fibrosis Sickle cell anaemia Screening of conditions available.  Sickle cell anaemia Single point mutation in gene encoding β-globin Reduced oxygen carrying capacity Characteristic sickling of red blood cells Occlusion of small capillaries 05 September Diana grib, CC BY-SA 4.0 , via Wikimedia Commons 34 2023  Cystic Fibrosis Genetic mutation = faulty chloride channel protein Thick, sticky mucus Inhibits absorption in the gut = malnutrition Lung infections >2000 different mutations Most common in F508del Deletion of a triplet of nucleotides Missing phenylalanine Affects protein structure 05 September Favia et al (2020)https://doi.org/10.3390/jcm811189035 2023 Summary You need to be able to describe DNA replication. You also need to be able to discuss how DNA is transcribed to RNA and how RNA is translated into a protein. You also need to be able to discuss different types of mutations on DNA and protein structure. Ideas for further reading and discussion will be uploaded to the PL1003 Moodle page.