DNA Replication and Central Dogma (Oct. 10, 2024) PDF

DNA Replication DNA Replication Occur in the nucleus DNA molecule is copied to produce two identical DNA molecules (Important for cell division, cells need to make a copy of DNA before dividing so each daughter cell has a complete copy of genetic information) DNA Replication: Steps 1. Unwind...

DNA Replication DNA Replication Occur in the nucleus DNA molecule is copied to produce two identical DNA molecules (Important for cell division, cells need to make a copy of DNA before dividing so each daughter cell has a complete copy of genetic information) DNA Replication: Steps 1. Unwind DNA  helicase enzyme – unwinds the helix and separates the strand  binding proteins - binds to each separated DNA strand in replication to hold them in place while the new strand form.  DNA gyrase - Enzyme that prevents tangling upstream from the replication fork helicase gyrase binding proteins replication fork  DNA Replication: Steps 2. Primer Binding  Primase enzyme – adds small section of RNA (RNA primer) to the 3’end of template DNA Parent /Original Strand DNA Replication: Steps 3. Polymerization/elongation – building new daughter strand  DNA Replication: Steps 3. Polymerization/elongation– building new daughter strand  DNA polymerase III – copies each strand  DNA polymerase I – replaces the primer with DNA nucleotide (add new complementary bases)  DNA Replication: Steps 3. Polymerization – building new daughter strand  DNA ligase – join pieces of polynucleotide together DNA Replication: Steps Mismatch in DNA Replication  DNA Replication: Steps DNA Repair A T T A ? Coding error G C  Proofreading C T G G C A T Mismatch repair T A by proteins T A  DNA Replication: Steps DNA Repair A T T A ? Coding error G C  Proofreading C G G C A T Mismatch repair T A by proteins T A DNA Replication Base Pairing Exercise DNA Replication Old strand TAC CTG TAG CTC ATC AGG New strand ATG GAC ATC GAG TAG TCC Old strand ATG CTA GTT GCA AGA TGA New strand TAC GAT CAA CGT TCT ACT  Central Dogma of Molecular Biology How can cells produce proteins with identical amino acid sequences? Central Dogma of Molecular Biology Central Dogma of Molecular Biology transcription DNA translation RNA Proteins Types of RNA Three Main Types of RNA 1. Messenger RNA (mRNA)  Carries copies of instructions for the assembly of amino acids into proteins  made from DNA in nucleus…travels out of nucleus and finds a ribosome. Three Main Types of RNA 2.Ribosomal RNA (rRNA) –the major part of ribosomes, which is where proteins are made. Ribosomal RNA Three Main Types of RNA 3. Transfer RNA (tRNA)  Transfers amino acids to ribosomes during protein synthesis  found in cytoplasm Three Main Types of RNA Location Function Messenger RNA Nucleus and Serves as the transcript for the (mRNA) cytoplasm amino acid sequence Ribosomal RNA Structural and functional Cytoplasm (rRNA) component of ribosomes Transfer RNA Carries amino acids to the Cytoplasm (tRNA) ribosomes for protein synthesis Transcription 1. Transcription  The first step in the protein synthesis (cells make proteins)  DNA  RNA  A complementary single strand of mRNA is copied from part of the DNA. 1. Transcription 1) Initiation RNA polymerase enzyme binds to a region of a gene called the promoter unwind the DNA strand 2) Elongation RNA polymerase reads the DNA strand and build the mRNA molecule 1. Transcription 1) Initiation RNA polymerase enzyme binds to a region of a gene called the promoter unwind the DNA strand 2) Elongation RNA polymerase reads the DNA strand and build the mRNA molecule 3) Termination the ending of transcription, when RNA polymerase crosses a stop (termination) sequence in the gene. The mRNA strand is complete, and it detaches from DNA. 1. Transcription mRNA exits the nucleus through the nuclear pore Translation 2. Translation  mRNA  protein  Takes place in the ribosome 2. Translation 2. Translation One codon at a time is matched to a tRNA “anticodon”. When tRNA sits down at it’s matching codon, the amino acid it carries is dropped off and bonded to the protein chain by peptide bonds. The tRNA molecule for methionine (an amino acid) has the “anticodon” UAC which matches to the “codon” AUG. 2. Translation 2. Translation An amino acid chart is used to find out which amino acid joins the protein chain next! ALWAYS read the mRNA codon! Illustrations… Let’s Try DNA G T T T TACC AT CCC AC A AT T TA Transcription mRNA CAAAAUGGUAGGGUGUUAAAU Separate by Codon C-AAA-AUG-GUA-GGG-UGU-UAA-AU Translation Amino Acid M e t - Va l - G l y - C y s DNA ATACG CCG C A AC T CCG TAG G C Transcription mRNA UAUGCGGCGUUGAGGCAUCCG Separate by Codon U-AUG-CGG-CGU-UGA-GGC-AUC-CG Translation Amino Acid Met-Arg-Arg Assignment ½ Crosswise To be submitted tomorrow  Central Dogma of Molecular Biology Activity Example: Replicate New DNA strand C A A A A T G G T A G G G T G T A A A T Original DNA G T T T TACC ATCCC AC A AT T TA mRNA CAAAAUGGUAGGGUGUUAAAU Transcript separate by codon C-AAA-AUG-GUA-GGG-UGU-UAA-AU Translate Amino Acid M e t - Va l - G l y - C y s Original DNA Strand: 1. CCTATATACACACGGAGGGTACGCTATTCTATGATTACACGGTTGCGATCCATAATC 2. AGAACTATATACCTCTTAACACTCTAAAGACCAGCACTCCGATGAACTGGAGCA 3. TATATACCTTGGGGAATATACACGCTGGCTTCGATGAATCCGTACGGTACTCGCCAT 4. TAAACTATATACCTAGCTTAGATCTAATTACCCATC 5. ACTATATACCTCTCTTATAGCATTACAAACCTCCGAGCACTG