Biochemistry Quiz PDF

Four major types of molecules in cells - Carbohydrates - Simple sugars - Monosaccharides - General formula - CH(2)O - Roles - Sources of stored energy - Used to transport stored energy...

Four major types of molecules in cells - Carbohydrates - Simple sugars - Monosaccharides - General formula - CH(2)O - Roles - Sources of stored energy - Used to transport stored energy - Carbon skeletons for other molecules Hydro - break lysis - water Difference - Condensation reactions releases water while hydrolysis reactions use up water - Difference in reaction - Condensation reaction involves joining two molecules to form a larger molecule with the release of water whereas hydrolysis involves breaking down a larger molecule into a smaller one with the addition of water - Similarity - Reactions that involve water Example of monosaccharide - Glucose - Fructose - Glycosidic linkages bond monosaccharides in condensation reactions - Do you know what 6-carbon sugar that all cells use as an energy source? - Glucose Roles of carbohydrates - Carbon skeletons for other molecules - Used to Transmit stored energy - Sources of stored energy Difference between starch glycogen and cellulose - Starch - Storage in plants - branched - Glycogen - Storage in animals - Highly branched - Cellulose - Major component of plant cell walls - Linear polysaccharide of glucose - carbs can also be the skeleton of other macromolecules eg. nucleic acids and triglycerides/phospholipids - Lipids - Hydrocarbons - Insoluble in water  - Fats and oils - Roles - Energy storage - Insulation - Hormones and vitamins - Saturated - Solid at room temperature - packed tightly - No double bonds - saturated with hydrogen - Unsaturated - Liquid at room temperature - Poorly together poorly - One or more double bonds in carbon chain What are triglycerides made up of? - Tri - three - Three fatty acids and glycerol What are the major components of cell membrane - Phospholipids Are phospholipids amphipathic? - Yes - Phospholipids have both polar and nonpolar regions - Leads them to form lipids bilayers in water How do the heads and tails of phospholipids interact with water? - Almost like a sandwich Hydrophilic (heads) interact with water and hydrophobic (tails) do not What layer is formed in water? - Bilayer Know examples of other lipids in animal and plant cells: Steroids - rings share carbons - Cholesterol is an important steroid - helps maintain integrity - Other steroids function as Hormones Carotenoids -Light-absorbing Pigment - Proteins - Polymers of 20 different amino acids - Amino acids - Roles - Physical stability and movement - Catalyze reactions - Store amino acids for later use - Amino acids consist of  - Amino group - R group - Side chain - Carboxyl group - Hydrogen atom - Carbon - 20 amino acids found in humans - Charged side chains - Histidine (H) - Arginine (A) - Lysine (K) - Aspartic (D) - Glutamic (G) - Polar uncharged side chain - Serine (S) - Threonine (T) - Asparagine (N) - Glutamine (Q) - Tyrosine (Y) - Hydrophobic side chains - Alanine (A) - Isoleucine (I) - Methionine (M) - Phenylalanine (F) - Tryptophan (W) - Valine (V) - Special cases - Cysteine (C) - Glycine (G) - Proline (P) What type of bond covalently links amino acids in a condensation reaction into polypeptide Chains? - Peptide bonds - What are the N and C terminus of a protein? - N terminus end of the protein that has a free amino group (first) - C terminus is the end of a protein that has as free carboxyl group (Last) - Know what are the primary, secondary (α,β), tertiary and quaternary structures of a protein. - Primary - sequence of amino acids in a protein - order determines how the protein will fold and act - Secondary - two types of folding patterns within the protein - Alpha helix - coiled spring or spiral  - Occurs when the chain if amino acids twists around itself - Beta sheet - zigzags or folded sheets - - occurs when amino acid chain lie side by side and form hydrogen bonds - Tertiary - Over 3-D shape of a single protein molecule - Created by the further folding interactions between the secondary structures - Quaternary - Subunits coming together to form a larger functional protein - What bonds are important for protein secondary structure? - Hydrogen bonds Under what environmental conditions will a protein structure get affected? - High Temp - Ph - High concentrations of polar molecules and nonpolar substances Protein shapes can change. Do you know how protein shape can be affected? - Interaction with other molecule - Modifications - additions of a chemical group to an amino acid - Nucleic acids - DNA is a polymer of nucleotides - Nucleotides - Roles - Storage transmission - Genetic information - Two types of nucleic acids - Nucleosides and nucleotide What are nucleotides? - Monomers that make of euclid acids What 3 features characterize them? - Nitrogen-containing base - Pentose sugar - Phosphate group What is a nucleoside? - Pentose sugar and nitrogen-containing base What linkages are formed when nucleotides are linked together in condensation reactions? - Phosphodiester lninlages Know that the 5’ phosphate of the new nucleotide joins the 3’ carbon of the nucleic acid. Remember: nucleic acids grow in the 5’ to 3’ direction What are the four nucleotide bases in DNA? - Cytosine - Thymine - Adenine Guanine Which nucleotide base replaces thymine in RNA? - Uracil What bonds are the nucleotide bases held together - T/U and A - C and G What are the purines? - Purines - Single ring - Pyrimidines - Two fused rings - Do you know what to base pair adenine (A) with in DNA? - Thymine cytosine (C) within DNA? - Guanine When in RNA - Single strand Know the differences between DNA and RNA - DNA - double stranded - Deoxyribose sugar - Bases - Adenine, Thymine, Cytosine, Guanine - RNA - Single stranded - Ribose sugar - Adenine, Uracil, Cytosine, Guanine  - Key features of DNA structure - Double-stranded - Antiparallel - Right-handed What did the X-ray crystallography show? - Double-stranded helix with 10 nucleotides - Bases - on inside - Phosphate group - Outside Are the two strands in DNA parallel or antiparallel? - Antiparallel What is Chargaff’s rule? - Base pairing - DNA from any cell of all organisms should have a 1:1 ratio of pyrimidine and purine bases. What do base pairing rules mean? - Information in DNA can be easily copied 5’ TTACCACTATGGATATGTCCACT 3’ = 3’AATGGTGATACCTATACAGGTGA ‘5 - The experiments from Griffith and Avery (transformation) and Hershey and Chase (bacteriophage) suggest that DNA (rather than protein) is the genetic material - The structure of DNA (Watson and Crick) helps to explain how DNA carries genetic information. DNA information molecule - DNA replication and transcription depend on base pairing - DNA replication involves the entire molecule, but only relatively small sections of the DNA are transcribed into RNA