BMS100 Central Dogma PDF

Central Dogma Dr. Rhea Hurnik BMS100 Learning outcomes Describe the structure of DNA, including the role of the following bond types to overall stability: phosphodiester bond, hydrophobic interaction/ base stacking, hydrogen bonds, base stacking, and electrostatic interactions. Describe the function...

Central Dogma Dr. Rhea Hurnik BMS100 Learning outcomes Describe the structure of DNA, including the role of the following bond types to overall stability: phosphodiester bond, hydrophobic interaction/ base stacking, hydrogen bonds, base stacking, and electrostatic interactions. Describe the function and levels of DNA condensation. Differentiate between structural elements of RNA and DNA and outline the roles of the following RNA molecules: hnRNA, snRNA, mRNA, tRNA, rRNA, miRNA, siRNA, lncRNA Outline the steps of transcription: initiation, elongation, processing, and termination and the role of RNA Polymerase and DNA topoisomerase. Understand the genetic code and determine which amino acid would be added for a given codon. Describe the function of the following molecules to translation: small and large ribosomes, tRNA, aminoacyl-tRNA synthetase, petidyl synthetase Outline the steps of translation: initiation, elongation, and termination Describe how proteins are targeted to a cellular location during translation. Plan Pre-learning 1) DNA, Chromosomes, & genes 2) RNA In-class: Transcription Translation Post-learning Regulation of protein synthesis Central Dogma DNA does not direct protein synthesis itself, but uses RNA as an intermediate: Outline – In class Transcription Introduction RNA Polymerase Steps of transcription Initiation, elongation, processing, termination Translation Introduction Preparing the tRNA Ribosomes Steps of translation Initiation, Elongation, termination Transcription introduction Transcription refers to the process of synthesizing an RNA molecule from DNA template (ie a gene) that will dictate the synthesis of a protein. § Occurs in the cell nucleus Transcriptional unit The transcription unit outlines the 3 general region found in all genes: § Promotor region – contains consensus sequence § Coding region Transcribed into mRNA § Terminator region Specifies end of transcription 5’ 3’ Promoter RNA-coding region TATA Transcription start site Terminator 3’ 5’ Template strand The strand of DNA that is transcribed into RNA is referred to as the template strand. § It can also be referred to as the anti-sense strand The template strand’s complimentary partner is referred as the non-template strand. § It can also be referred to as the sense strand RNA polymerase RNA polymerase is the main key enzyme for transcription: § It moves along the DNA, unwinding the DNA helix just ahead of the active site for polymerization § Catalyzes a new phosphodiester bond on the newly-forming strand of RNA RNA polymerase cont. RNA polymerase § Works in the 5’ à 3’ direction Template (aka non-sense strand) 3’ 5’ 5’ 5’ 3’ Non-template (aka sense strand) 3’ RNA polymerase - Thinking question RNA polymerase § Make mistakes at a rate of 1 for every 104 nucleotides Preview: DNA polymerase makes mistakes at a rate of 1 in every 107 nucleotides. § When do we use DNA polymerase? What is the significance of this? Steps of transcription Transcription can be divided into 4 stages: § Initiation § Elongation § Processing § Termination Step 1 - Initiation In order to begin transcription, RNA polymerase must recognize where to start. § Transcription initiation factors help with this process: In prokaryotes there is just one: sigma factor In Eukaryotes there are many different types, we will consider the role of general transcription factor TFII § Needed for RNA Polymerase II which transcribes all protein-coding genes in eukaryotes Step 1a – Initiation A) TFII recognizes and binds a consensus sequence in the promoter region § In Eukaryotes one example is called the TATA box Located ~25 nucleotides upstream from the transcription start site. TFIID is the specific TFII that binds the TATA box Step 1bàd - Initiation B) Other transcription factors join § Names of additional transcription factors are FYI C) RNA Polymerase II joins D) Transcription initiation complex is complete & transcription can begin Step 1 – Initiation: regulation The TATA box (or other consensus sequences) aren’t the only binding site on DNA that influences initiation of transcription § Repressor proteins bind upstream sequences called silencers (aka negative regulatory elements) Inhibit gene transcription Step 1 – Initiation: regulation cont. Transcriptional activator proteins bind upstream sequences of DNA called enhancers (aka positive regulatory elements) § Increase the rate of transcription by attracting the RNA polymerase II enzyme. Q: What might happen if there was a mutation in an enhancer sequence of DNA? Step 2 - Elongation Once RNA Polymerase begins transcribing DNA, most of the general transcription factors (TFII) are released § These transcription factors are then available to initiate another round of transcription with new RNA Polymerase molecule Step 2 - Elongation RNA polymerase moves downstream along the DNA, transcribing the coding region. § Various elongation factors are needed to help reduce the likelihood that RNA polymerase dissociating from DNA before it reaches the end of a gene. Step 2 - Elongation In addition to elongation factors, eukaryotes also require: Chromatin remodeling complexes help the RNA polymerase navigate the chromatin structure Histone chaperones partially disassemble & reassemble nucleosomes as an RNA Polymerase passes through Step 2 - Elongation As RNA polymerase move along the DNA double helix it generates supercoils. § In Eukaryotes DNA topoisomerase removes this super-helical tension DNA topoisomerase The enzyme DNA topoisomerase relieves the super-helical tension by breaking the phosphodiester bond. This allows the two sections of the DNA helix to rotate freely & relieve tension. The phosphodiester bond will reform as DNA topoisomerase leaves. Step 3 - Processing In eukaryotes, during elongation, the pre-mRNA transcript is processed in 3 main ways: 1) Splicing 2) Capping the 5’ end 3) Polyadenylation of 3’ end Once these modifications are complete the transcript is called mRNA Step 3 – Processing within elongation 1. 7-methyl guanosine cap § A modified guanine nucleotide is added to the 5’ end of the transcribed premRNA This occurs early, once ~25 nucleotides of RNA have been transcribed § This 5’ cap facilitates export of the mRNA into the nucleus and is involved in translation More to come! Step 3 – Processing within elongation 2. Splicing § Both intron and exon sequences are transcribed into RNA Introns are then removed in a processes called RNA splicing. § Splicing is performed by spliceosomes Spliceosomes require a special form of RNA (snRNA) and proteins complexed into snRNPs § snRNA = small nuclear RNA § snRNP = small nuclear ribonucleoprotein snRNP is referred to a spliceosome once it has complexed with the pre-mRNA Why does splicing occur? 95% of human genes are spliced in more than one way § Splicing allows the same gene to produce a variety of different proteins § For example: Step 4 – Processing & termination The 3’ end of the mRNA molecule is specified by signals encoded in DNA. § These signals are transcribed into RNA and then bind to proteins that facilitate cleavage of mRNA from RNA polymerase FYI – CPSF & CstF Step 4 – Processing & termination cont. 3. Poly A tail: § Once cleaved, ~200 A nucleotides are added to the mRNA § FYI - This catalyzed by an enzyme called Poly-A Polymerase (PAP) Poly A tails protects the mRNA from degradation and facilitates export from the nucleus Poly A binding proteins then bind the poly-A tail Prokaryotes Up to this point we have been discussing eukaryotic transcription. § The steps of transcription in prokaryotes are the same, however the mRNA transcript produced in prokaryotes is a little different: No processing is required for the prokaryotic mRNA transcript § No 5’ cap, splicing, or poly-A tail No export from nucleus § Thus translation can begin right away mRNA transcript is polycistronic § Codes for more than one protein Knowledge Check During transcription, which of the following proteins bind the TATA box within the promotor region § A) DNA topoisomerase § B) RNA Polymerase § C) TFII D § D) Poly A polymerase Knowledge Check Which of the following are CORRECT regarding RNA processing § A) A Poly A tail is added by PAP (poly A polymerase) to the 5’ end of the pre-mRNA transcript § B) During spicing the exons are removed by a spliceosome. § C) Splicing is catalyzed by snRNA and proteins complexed into snRNPs § D) A modified G nucleotide forms the 3’ cap, which protects the 3’ end from degradation and facilitate export out of the nucleus. § E) All of the above are true Outline – In class Transcription Introduction RNA Polymerase Steps of transcription Initiation, elongation, processing, termination Translation Introduction Preparing the tRNA Ribosomes Steps of translation Initiation, Elongation, termination Translation - introduction Following processing and termination of transcription, mature mRNA is exported from the nucleus through nuclear pore complexes. Once in the cytosol, mature mRNA is translated into protein Translation – introduction cont. The mRNA sequence is decoded in sets of 3 nucleotides called codons. § There are 64 possible combinations of of 3 nucleotides but only 20 amino acids Some amino acids are specified by more than one codon, demonstrating the redundancy of the genetic code Translation – Reading Frame Reading Frames: § Since mRNA is interpreted in 3-nucleotide codons, the correct polypeptide sequence depends on the correct reading frame. Special punctuation is needed to determine the correct reading frame. § Preview – in Eukaryotes it is the first AUG sequence. In Prokaryotes it is the Shine Dalgarno sequence Thinking Question: Reading Frames: § Here are three possible polypeptides based on different reading frames Q: What might happen if a nucleotide was accidentally inserted into the middle of a gene? Translation – What is needed A number of molecules are needed for translation: § mRNA transcript § tRNA Needs to be bound to the correct amino acids (“charged tRNA”) § Ribosomes A large and small subunit Translation – Preparing the tRNA The cell makes a variety of tRNAs, each corresponding to one of the 20 amino acids § The enzyme aminoacyl-tRNA synthetase catalyzes the attachment of correct amino acid to tRNA Translation – What is needed Protein synthesis is performed in the ribosome § Helps maintain correct reading frame and ensure accuracy of codon – anti-codon interaction The ribosome complex is composed of various ribosomal proteins and ribosomal RNA (rRNA) § 2 subunits: Small subunit Large subunit *Note the 4 binding sites on the ribosome Translation – What is needed Translation can be divided into 3 steps: § 1. Initiation § 2. Elongation A) tRNA binding B) Peptide bond formation C) Large subunit translocation D) Small subunit translocation § 3. Termination Translation – Steps Translation can be divided into 3 steps: § 1. Initiation § 2. Elongation A) tRNA binding B) Peptide bond formation C) Large subunit translocation D) Small subunit translocation § 3. Termination Step 1 - Initiation AUG is the first codon translated on the mRNA § Initiator tRNA carries the amino acid methionine *Thus, all newly made proteins begin with methionine as the first amino acid at their N-terminus § Forms an initiator tRNA-methionine complex (Met-tRNAi) Met-tRNAi is loaded into the small ribosomal subunit with initiation factors (eIFs) Step 1 – Initiation cont. Small ribosome binds to the 5’ end of the mRNA § The 5’ 7-methyl guanosine cap helps with recognition of the 5’ end Step 1 – Initiation: scanning mechanism Small ribosome moves along the mRNA (from 5’ to 3’) scanning for the first AUG § Requires ATP hydrolysis Initiation factors dissociate & the large ribosome subunit assembles to complete the ribosome complex Step 1 – Initiation: Prokaryotes Prokaryotic mRNA is polycistronic § An additional recognition sequence is needed for ribosome binding Shine-Dalgnaro sequence (aka ribosome-binding site) Step 2 – Elongation A) tRNA binding § Newly charged tRNA binds to the A site of the ribosome complex B) Peptide bond formation § Carboxyl end of the polypeptide chain is released from the tRNA at the P site & joins the amino acid linked to the tRNA at the A site § This new peptide bond is catalyzed by peptidyl transferase enzyme contained within the large ribosomal subunit. Step 2 – Elongation C) Translocation of large subunit: § Large ribosomal subunit moves relative to the mRNA held by the small subunit § Two tRNAs are shifted to the E and P sites D) Translocation of small subunit § Small subunit shifts by 3 nucleotides § tRNA in E site is ejected Cycle is repeated for new incoming amino acyl-tRNA Step 2 – Elongation Elongation proceeds efficiently and accurately with the help of elongation factors (EFs) § These elongation factors enter and leave the ribosome during each cycle & are coupled with GTP hydrolysis Step 3 – Termination A STOP codon marks the end of translation § UAA, UAG, UGA Not recognized by a tRNA & do not specify an amino acid Release factors bind to ribosomes with a stop codon in the A site Step 3 – Termination Peptidyl transferase catalyzes the addition of a water molecular rather than amino acid § This frees the carboxyl end and releases the polypeptide Ribosome releases the mRNA & dissociates into the large and small subunits § Subunits are recycled to begin new round of protein synthesis Knowledge Check The first amino acid added to any polypeptide is: § A) Leucine § B) Methionine § C) Phenylalanine § D) Lysine Knowledge Check Which of the following describes the correct order of translation initiation in eukaryotes: § A) Small ribosomal subunit binds to the 5’ cap and scans the mRNA until it reaches AUG, then Met-tRNAi binds to the P site § B) Met-tRNAi binds to the P site of the small ribosomal subunit, small ribosomal subunit binds to the 5’ cap and then scans mRNA until it reaches AUG § C) Small ribosomal subunit binds to the 5’ cap & scans the mRNA until it reaches AUG, the large ribosomal subunit binds, and then Met-tRNAi binds to the P site. § D) Small ribosomal subunit binds to the Shine Dalgnaro sequence, Met-tRNAi bind to the small ribosomal subunit, an then the small ribosomal subunit scans the mRNA until it reaches AUG Polysomes Synthesis of proteins occurs on polyribosomes (or polysomes) § Multiple initiations take place on each mRNA molecule being translation § As soon as the preceding ribosome has translated enough of the nucleotide sequence to move out of the way, a new ribosome complex is formed. § Helps speed up rate of protein synthesis Post-translational Once full translated, what happens next? § Protein is folded into specific 3-D shape Proper folding is important since structure of a protein dictates its function! § More to come next class § May be modified in the ER: Eg. Glycosylated – addition of mono- or oligosaccharide § Sent to its proper cellular location Clinical Application Many antibiotics function by inhibiting bacterial protein synthesis § Interfering with the correct functioning of prokaryotic ribosomes § For example: In class Activity Predict the polypeptide sequence of the following two eukaryotic mRNA: A) 5’- AUGGGUCAGUCGCUCCUGAUU – 3’ B) 5’- GGCAAUGUUGGCGCCAUAAUUU – 3’ References Abali, Emine E; Cline, Susan D; Franklin, David S; Viselli, Susan M. Lippincott Illustrated Reviews: Biochemistry (Lippincott Illustrated Reviews Series) (p. 105). Wolters Kluwer Health Boron, W. and Boulpaep, E. Medical Physiology (3rd ed). Elsevier Alberts et al. Molecular Biology of the Cell. Garland Science. Betts et al. Anatomy and Physiology (2ed). OpenStax Images: § Kcneuman, CC BY-SA 4.0 , via Wikimedia Commons. Retrieved from: https://upload.wikimedia.org/wikipedia/commons/7/7e/Topological_ram ifications_of_DNA_replication_and_transcription.jpg