BIOL 200 Central Dogma of Molecular Biology Sept 4 2024 PDF

BIOL 200 Sept 4 2024 Ken Hastings Central dogma of molecular biology: information flow in biopolymer synthesis Lodish 9th ed Chapter 5.2, 5.4, 5.5 pp 185-189,199-202, 205-208 The Central Dogma of molecular biology DNA RNA...

BIOL 200 Sept 4 2024 Ken Hastings Central dogma of molecular biology: information flow in biopolymer synthesis Lodish 9th ed Chapter 5.2, 5.4, 5.5 pp 185-189,199-202, 205-208 The Central Dogma of molecular biology DNA RNA protein physiology, developmental biology = organismal form/function heredity  The Central Dogma and information flow: the language analogy DNA synthesis RNA synthesis protein synthesis replication transcription translation Making a perfect rewriting in a rewriting in a different copy. different nucleotide language. (nucleotide font. vs amino acid) DNA RNA protein Biopolymer synthesis: templates and enzymes process biopolymer template enzyme* replication DNA DNA DNA polymerase transcription RNA DNA RNA polymerase translation protein mRNA ribosome *Most enzymes, including DNA and RNA polymerase, are proteins. The ribosome includes protein and RNA components and both contribute to its enzymatic function. Transcription nascent RNA chain antiparallel exposed DNA strand = template specifies RNA sequence by Watson‐Crick base‐pairing chain growth at 3’ end by RNA polymerase direct interaction of template with incoming monomer (rNTP) catalyzes attack rNTPs diffuse randomly. of 3’‐OH on RNA polymerase will  phosphate of only link incoming rNTP to growing chain if it forms incoming rNTP. perfect Watson‐Crick ,  diphosphate base pair with template. “dropped” Fig 5‐23 Lodish et al 9th ed. The sequence of RNA transcribed from a region of DNA corresponds to the sequence of the non-template strand duplex DNA 5’…CTGCCATTGTCAGACATGTATACCCGTACGTCTTCCCGAGCGAAAACGATC…3’ 3’…GACGGTAACAGTCTGTACATATGGGCATGCAGAAGGGCTCGCTTTTGCTAG…5’ local unwinding non‐template (locally) separated strands strand 5’…CTGCCATTGTCAGACATGTATACCCGTACGTCTTCCCGAGCGAAAACGATC…3’ new RNA strand 5’…CUGCCAUUGUCAGACAUGUAUACCCGUACGUCUUCCCGAGCGAAAACGAUC…3’ 3’…GACGGTAACAGTCTGTACATATGGGCATGCAGAAGGGCTCGCTTTTGCTAG…5’ template strand Note that the non‐template strand, and the newly synthesized RNA strand are both complementary to, and antiparallel with, the template DNA strand. Except for the substitution of U for T the base sequence of the RNA and non‐template strand, are identical. Transcription bubble RNA DNA is double-stranded! Template DNA strand exposed by local unwinding of duplex DNA by helicase associated with RNA polymerase One of the unwound DNA strands is used as the template strand. The other is the non‐template strand. bubble adapted from Fig 5-24 Lodish et al 9th ed The transcription bubble moves along the DNA with RNA polymerase. After being unwound in the transcription bubble, the original DNA duplex re-forms behind RNA polymerase as it moves unidrectionally along the DNA. The re-forming duplex behind polymerase “kicks out” the newly-synthesized RNA strand. The displaced single-stranded RNA exits through a channel in the polymerase, 5’ end first. adapted from Fig 5-24 Lodish et al 9th ed Bacterial RNA polymerase polymerase motion transcribing DNA Growing RNA chain being extruded through the exit channel of the RNA polymerase Transient transcription bubble moving, with the RNA polymerase, to the right. adapted from Fig 5‐25 Lodish et al 9th ed  RNA polymerase: starting and stopping RNA Starting: Certain DNA sequences called promoters facilitate the initial binding of RNA polymerase to DNA. bubble Stopping. Certain DNA sequences destabilize the attachment of RNA polymerase to the DNA as it moves. The RNA polymerase falls off the DNA and releases the completed RNA chain. adapted from Fig 5-24 Lodish et al 9th ed  DNA replication Similarities to, and differences from, transcription Similarities Template = DNA DNA duplex locally unwound by a helicase at initiation sites to expose template (promoters for transcription and replication origins for replication) New strand synthesized 5’ to 3’ antiparallel to template. Chain growth at 3’ end. Monomers = nucleoside triphosphates Direct interaction (Watson‐Crick base pairing) between template DNA and incoming monomer Attack of 3’‐OH onphosphate of incoming dNTP. diphosphate “dropped” Fig 5‐9 Lodish et al 9th ed  DNA replication differences from transcription Differences transcription DNA replication Monomer = rNTPs Monomer = dNTPs Start and stop sites on template Start sites but no stop sites Start site termed promoter. Start site termed replication origin. Newly synthesized strand (RNA) separates Newly synthesized strand (DNA) never separates from template strand. from template strand. Only one of the original DNA strands is a Both of the original DNA strands independently template strand. serve as template strands. We start with one molecule of double‐ We start with one molecule of double‐stranded stranded DNA and we end with one DNA and we end with two molecules of double‐ molecule of double‐stranded DNA (plus stranded DNA the RNA molecule produced).  Protein synthesis = translation Translation: One language (nucleotides) into another language (amino acids) Two language concepts: Words…the unit of meaning (may contain multiple characters) Translating dictionary…lookup table of corresponding words in the two languages Some mRNA sequence: Corresponding protein sequence: 5’…GCUUGUUUACGAAUU…3’ NH2…ACLRI…COOH (1-letter nomenclature) = NH2…AlaCysLeuArgIle…COOH (3 letter nomenclature) Some numbers to consider Amino acids 20 Number of characters A Ala C Cys Nucleotides 4 D Asp A E Glu C F Phe G G Gly U H His I Ile There cannot be a 1:1 correspondence K Lys between 4 characters and 20. L Leu M Met But nucleotides are “read” into amino acids N Asn as 3‐character words called codons. P Pro Q Gln How many 3‐nucleotide codons are there? R Arg S Ser N N N T Thr 4x4x4 = 64 V Val W Trp How do the 64 codons relate to the 20 Y Tyr amino acids? The Genetic Code A dictionary of 3-nucleotide codons and their corresponding amino acids This is a 4 x 16 table = 64 entries, one for each codon Table 5.1 Lodish et al 9th ed  UUU UUC UUA UUG The genetic code is “degenerate”. Often several different codons code for the same amino acid Punctuation codons Of the 64 codons, 3 do not code for any amino acid. UAA, UAG, UGA These are Stop codons (a.k.a termination codons) One codon, AUG, Is a Start codon. It codes for methionine (Met) and all proteins start their synthesis with Met. (Met can also be present within the protein chain.) Table 5.1 Lodish et al 9th ed Biopolymer synthesis. Template:monomer contacts DIRECT interaction of template with next monomer molecule to be incorporated process biopolymer template energized monomer replication DNA DNA dNTP transcription RNA DNA rNTP translation protein mRNA aminoacyl tRNA INDIRECT interaction between template and next monomer to be incorporated (amino acid) tRNA acts as an adaptor between template and growing chain Adaptors Adaptors transform signal from one system to a different system. They have two ends, one to interact with each of the two systems being bridged. Example HDMI to VGA adaptor for data projection from laptop. HDMI end VGA end  Aminoacyl tRNAs are adaptors for transforming a nucleotide signal into an amino acid signal Amino acid monomers used in translation are in the form of high-energy amino acyl-tRNA esters. amino acid signal end nucleotide signal “end” 3-nucleotide anticodon sequence that is complementary to a codon. From Fig 5‐31 Lodish et al 9th ed  amino acid signal end Peptidyl transferase reaction is catalyzed by the large ribosome, a ribonucleo‐ subunit rRNA molecule. protein particle (RNA + protein) consisting of large and small subunits A ribozyme at the heart of protein synthesis! nucleotide signal “end” mRNA template for protein synthesis Fig 5‐29 Lodish et al 9th ed  Translational reading frames Ribosome translocation is 3 bases at a time. Counting 3 at a time starts with the initiation codon AUG. Position of initiation codon determines which of three possible reading frames are used. spaces not real natural AUG mRNA sequence Met experiment 1: displace AUG AUG by one base Met Frameshift experiment 2: mutations! displace AUG AUG by one more Met base modified from Fig 5‐30 Lodish et al 9th ed RNA world hypothesis It is hard to imagine how a process as complex as gene expression (transcription and translation) arose in evolution. The many key roles of RNA in protein synthesis, including the ribozyme nature of the peptidyl transferase activity of the ribosome have suggested the hypothesis that RNA evolved as an informational biopolymer before proteins, and even before DNA (and presumably before cells). This is the RNA world hypothesis of the evolution of life.