NEET Physics Past Paper PDF 2023 - Set E1

NEET (Physics) 7th May 2023 : Set E1 Question 1 Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sec...

NEET (Physics) 7th May 2023 : Set E1 Question 1 Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is (1) 2W /A (2) W /A (3) W /2A (4) Zero Question 2 The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is (1) 3:5 (2) 5:3 (3) 2:5 (4) 5:2 Question 3 The equivalent capacitance of the system shown in the following circuit is 3 µF 3 µF A B 3 µF (1) 2µF (2) 3µF (3) 6µF (4) 9µF Question 4 A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is (1) Along eastward  (2) Along northward (3) Along north-east (4) Along south-west I Question 5 If E ⃗ = 0 over a surface, then ⃗ · dS S (1) The number of flux lines entering the surface but be equal to the number of flux lines leaving it (2) The magnitude of electric field on the surface is constant (3) All the charges must necessarily be inside the surface (4) The electric field inside the surface is necessarily uniform Question 6 The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, the potential energy stored in it will be (1) 2U (2) 4U (3) 8U (4) 16 U Question 7 If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by 400 Ω G + + 10 V R 2V − − (1) 200 Ω (2) 50 Ω (3) 100 Ω (4) 400 Ω  Question 8 A 12 V, 60 W lamp is connected to the secondary of a step-down transformer whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding? (1) 0.27 A (2) 2.7 A (3) 3.7 A (4) 0.37 A Question 9 A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped trans- former, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output? (1) A centre-tapped transformer (2) p-n junction diodes (3) Capacitor (4) Load resistance Question 10 Light travels a distance X in time t1 in air and 10X in time t2 in another denser medium. What is the critical angle for this medium?   −1 t2 (1) sin t1   −1 10t2 (2) sin t1   −1 t1 (3) sin 10t2   −1 10t1 (4) sin t2 Question 11 Resistance of a carbon resistor determined from colour codes is (22000 ± 5%)Ω. The colour of the third band must be (1) Red (2) Green  (3) Orange (4) Yellow Question 12 Given below are two statements: Statement I: Photovoltaic devices can convert optical radiation into electricity. Statement II: Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below. (1) Both Statement I and Statement II are correct. (2) Both Statement I and Statement II are incorrect. (3) Statement I is correct but Statement II is incorrect. (4) Statement I is incorrect but Statement II is correct. Question 13 The magnetic energy stored in an inductor of inductance 4 µH carrying a current of 2 A is (1) 4 µJ (2) 4 mJ (3) 8 mJ (4) 8 µJ Question 14 The angular acceleration of a body, moving along the circumference of a circle, is (1) Along the radius, away from the centre (2) Along the radius towards the centre (3) Along the tangent to its position (4) Along the axis of rotation Question 15 A Carnot engine has an efficiency of 50% when its source is at a temperature 327◦ C. The temperature of the sink is (1) 27◦ C (2) 15◦ C  (3) 100◦ C (4) 200◦ C Question 16 Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant) 8Gm (1) − R 12Gm (2) − R 16Gm (3) − R 20Gm (4) − R Question 17 A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is v (1) 3 2v (2) 3 4v (3) 3 3v (4) 4 Question 18 The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface tension of soap solution = 0.03 N m−1 ) (1) 30.16 × 10−4 J (2) 5.06 × 10−4 J (3) 3.01 × 10−4 J (4) 50.1 × 10−4 J Question 19 The minimum wavelength of X-rays produced by an electron accelerated through a po- tential difference of V volts is proportional to √ (1) V  1 (2) V 1 (3) √ V 2 (4) V Question 20 The half life of a radioactive substance is 20 minutes. In how much time, the activity of 1 th substance drops to ( 16 ) of its initial value? (1) 20 minutes (2) 40 minutes (3) 60 minutes (4) 80 minutes Question 21 A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be (1) 1.2% (2) 1.3% (3) 1.6% (4) 1.4% Question 22 In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 × 1010 Hz and amplitude 48 V m−1. Then the amplitude of the oscillating magnetic field is (Speed of light in free space = 3 × 108 m s−1 ) (1) 1.6 × 10−9 T (2) 1.6 × 10−8 T (3) 1.6 × 10−7 T (4) 1.6 × 10−6 T Question 23 ◦ The temperature of a gas is −50 C. To what temperature the gas should be heated so that the rms speed is increased by 3 times? (1) 669◦ C  (2) 3295◦ C (3) 3097 K (4) 223 K Question 24 An ac source is connected to a capacitor C. Due to decrease in its operating frequency (1) Capacitive reactance decreases (2) Displacement current increases (3) Displacement current decreases (4) Capacitive reactance remains constant Question 25 For Young’s double slit experiment, two statements are given below: Statement I: If the screen is moved away from the plane of slits, the angular separation of the fringes remains constant. Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below: (1) Both statement I and statement II are true. (2) Both statement I and statement II are false. (3) Statement I is true but statement II is false. (4) Statement I is false but statement II is true. Question 26 The hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Brackett series is (1) 2λ (2) 4λ (3) 9λ (4) 16λ Question 27 The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?  (1) Cs only (2) Both Na and K (3) K only (4) Na only Question 28 The errors in the measurement which arise due to unpredictable fluctuations in temper- ature and voltage supply are (1) Instrumental errors (2) Personal errors (3) Least count errors (4) Random errors Question 29 In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The frequency at which resonance occurs is (1) 15.9 rad/s (2) 15.9 kHz (3) 1.59 rad/s (4) 1.59 kHz Question 30 The venturimeter works on (1) Huygen’s principle (2) Bernoulli’s principle (3) The principle of parallel axes (4) The principle of perpendicular axes Question 31 The ratio of frequencies of fundamental harmonic produced by an open pipe to that of a closed pipe having the same length is (1) 1:2 (2) 2:1 (3) 1:3 (4) 3:1  Question 32 An electric dipole is placed at an angle of 30◦ with an electric field of intensity 2 × 105 N C−1. It experiences a torque equal to 4 Nm. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm. (1) 8 mC (2) 6 mC (3) 4 mC (4) 2 mC Question 33 The magnitude and direction of the current in the following circuit is 2 Ω 10 V 5V 1 Ω A B E D C 7Ω (1) 0.2 A from B to A through E (2) 0.5 A from A to B through E 5 (3) A from A to B through E 9 (4) 1.5 A from B to A through E Question 34 The net magnetic flux through any closed surface is (1) Zero (2) Positive (3) Infinity (4) Negative Question 35 A bullet is fired from a gun at the speed of 280 ms−1 in the direction 30◦ above the horizontal. The maximum height attained by the bulllet is (g = 9.8 ms−2 , sin 30◦ = 0.5) (1) 2800 m (2) 2000 m  (3) 1000 m (4) 3000 m Question 36 Two thin lenses are of same focal lengths (f ), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be (1) Zero f (2) 4 f (3) 2 (4) Infinite Question 37 The net impedance of the circuit (as shown in figure) will be 10 3 — µF π 50 mH 10 Ω — π 220 V, 50 Hz √ (1) 10 2 Ω (2) 15 Ω √ (3) 5 5Ω (4) 25 Ω Question 38 The xt-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t = 2 s is 1 x (m) 4 6 0 2 8 t (s) −1  π2 (1) m s−2 8 π2 (2) − m s−2 8 π2 (3) m s−2 16 π2 (4) − m s−2 16 Question 39 An electric dipole is placed as shown in the figure. 5 cm P 0 −q +q 3 cm 3 cm The electric potential (in 102 V) at point P due to the dipole is (∈0 = permittivity of free 1 space and 4π∈ 0 = K)   3 (1) qK 8   5 (2) qK 8   8 (3) qK 5   8 (4) qK 3 Question 40 A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, the velocity of the bullet becomes u3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is (1) 27 cm (2) 24 cm (3) 28 cm (4) 30 cm  Question 41 In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)? n1 = 1.5 R1 = R2 = 20 cm R1 n2 = 1.6 R2 (1) 40 cm (2) −40 cm (3) −100 cm (4) −50 cm Question 42 For the following logic circuit, the truth table is A Y B A B Y 0 0 1 (1) 0 1 1 1 0 1 1 1 0 A B Y 0 0 0 (2) 0 1 1 1 0 1 1 1 1 A B Y 0 0 1 (3) 0 1 0 1 0 1 1 1 0 A B Y 0 0 0 (4) 0 1 0 1 0 0 1 1 1  Question 43 A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity of 4 ms−1. The ball strikes the water surface after 4 s. The height of the bridge above the water surface is (Take g=10 ms−2 ) (1) 56 m (2) 60 m (3) 64 m (4) 68 m Question 44 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. When those are connected in parallel to the same battery, the current is increased n times. The value of n is (1) 10 (2) 100 (3) 1 (4) 1000 Question 45 A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic ⃗ = (2î + 3ĵ − 4k̂) T. the magnitude of the magnetic force acting on the wire is field B (1) 3 IL √ (2) 5 IL (3) 5 IL √ (4) 3 IL Question 46 A satellite is orbiting just above the surface of the earth with period T. If d is the density 3π of the earth and G is the universal constant of gravitation, the quantity Gd represents (1) T (2) T2 (3) T3 √ (4) T  Question 47 Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s−2 ) (1) 1.2 m s−2 (2) 150 m s−2 (3) 1.5 m s−2 (4) 50 m s−2 Question 48 The resistance of a platinum wire at 0◦ C is 2 Ω and 6.8 Ω at 80◦ C. The temperature coefficient of resistance of the wire is ◦ (1) 3 × 10−4 C−1 ◦ (2) 3 × 10−3 C−1 ◦ (3) 3 × 10−2 C−1 ◦ (4) 3 × 10−1 C−1 Question 49 The radius of the innermost orbit of a hydrogen atom is 5.3 × 10−11 m. What is the radius of the third allowed orbit of the hydrogen atom? (1) 0.53 Å (2) 1.06 Å (3) 1.59 Å (4) 4.77 Å Question 50 A very long conducting wire is bent in a semi-circular shape from A to B as shown in the figure. The magnetic field at point P for steady current configuration is given by i A R P i B µ0 i (1) ; pointed into the page 4R µ0 i (2) ; pointed away from the page 4R    µ0 i 2 (3) 1− ; pointed away from the page 4R π   µ0 i 2 (4) 1− ; pointed into the page 4R π NEET (Chemistry) 7th May 2023 : Set E1 Question 51 Which of the following reactions will NOT give primary amine as the product? Br2 /KOH (1) CH3 CONH2 −−−−−→Product (i) LiAlH4 (2) CH3 CN −−−−−−→ ⊕ Product (ii) H3 O (i) LiAlH4 (3) CH3 NC −−−−−−→ ⊕ Product (ii) H3 O (i) LiAlH4 (4) CH3 CONH2 −−−−−−→ ⊕ Product (ii) H3 O Question 52 Match List-I with List-II. List-I List-II A. Coke I. Carbon atoms are sp3 hybridised B. Diamond II. Used as a dry lubricant C. Fullerene III. Used as a reducing agent D. Graphite IV. Cage like molecules Choose the correct answer from the options given below: (1) A-II, B-IV, C-I, D-III (2) A-IV, B-I, C-II, D-III (3) A-III, B-I, C-IV, D-II (4) A-III, B-IV, C-I, D-II Question 53 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reason R : The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below. (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true  Question 54 In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe3+ due to the formation of (1) Fe4 [Fe(CN)6 ]3 · xH2 O (2) NaSCN (3) [Fe(CN)5 NOS]4− (4) [Fe(SCN)]2+ Question 55 The conductivity of centimolar solution of KCl at 25◦ is 0.0210 ohm−1 cm−1 and the resistance of the cell containing the solution at 25◦ is 60 ohm. The value of cell constant is (1) 1.34 cm−1 (2) 3.28 cm−1 (3) 1.26 cm−1 (4) 3.34 cm−1 Question 56 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A reaction can have zero activation energy. Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to the threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true and R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true  Question 57 Which one is an example of heterogenous catalysis? (1) Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of ni- trogen (2) Hydrolysis of sugar catalysed by H+ ions (3) Decomposition of ozone in presence of nitrogen monoxide (4) Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron Question 58 The given compound CH CH CH CH2CH3 X is an example of. (1) Benzylic halide (2) Aryl halide (3) Allylic halide (4) Vinylic halide Question 59 Identify the product in the following reaction: + − N2Cl (i) Cu2Br2/HBr (ii) Mg/dry ether Product (iii) H2O OH (1) (2) MgBr (3)  OH (4) Br Question 60 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Helium is used to dilute oxygen in diving apparatus. Reason R : Helium has high solubility in O2 In the light of the above statements, choose the correct answer from the options given below (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true and R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true Question 61 A compound is formed by two elements A and B. The element B forms cubic close-packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is Ax By , then the value of x + y is in option (1) 5 (2) 4 (3) 3 (4) 2 Question 62 Given below are two statements: Statement I: A unit formed by the attachment of a base to 1′ position of sugar is known as nucleoside. Statement II: When nucleoside is linked to phosphorous acid at 5′ position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true  (2) Both Statement I and Statement II are false (3) Statement I is true but Statement II is false (4) Statement I is false but Statement II is true Question 63 The relation between nm , (nm = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is nm − 1 (1) l= 2 (2) l = 2nm + 1 (3) nm = 2l2 + 1 (4) nm = l + 2 Question 64 Amongst the following, the total number of species NOT having eight electrons around the central atom in its outermost shell, is NH3 , AlCl3 , BeCl2 , CCl4 , PCls : (1) 3 (2) 2 (3) 4 (4) 1 Question 65 The correct order of energies of molecular orbitals of N2 molecule, is (1) σ1s < σ ∗ 1s < σ2s < σ ∗ 2s < (π2px = π2py ) < σ2pz < (π ∗ 2px = π ∗ 2py ) < σ ∗ 2pz (2) σ1s < σ ∗ 1s < σ2s < σ ∗ 2s < σ2pz < (π2px = π2py ) < (π ∗ 2px = π ∗ 2py ) < σ ∗ 2pz (3) σ1s < σ ∗ 1s < σ2s < σ ∗ 2s < σ2pz < σ ∗ 2pz < (π2px = π2py ) < (π ∗ 2px = π ∗ 2py ) (4) σ1s < σ ∗ 1s < σ2s < σ ∗ 2s < (π2px = π2py ) < (π ∗ 2px = π ∗ 2py ) < σ2pz < σ ∗ 2pz Question 66 The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are: (1) 11, 2, 0 (2) 12, 3, 0 (3) 11, 3, 1 (4) 12, 2, 1  Question 67 Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole−dipole forces B. dipole−induced dipole forces C. hydrogen bonding D. covalent bonding E. dispersion forces Choose the most appropriate answer from the options given below: (1) B, C, D, E are correct (2) A, B, C, D are correct (3) A, B, C, E are correct (4) A, C, D, E are correct Question 68 Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism C. Hydrogen is used to make saturated fats from oils. D. The H−H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below. (1) B, C, D, E only (2) B, D only (3) D, E only (4) A, B, C only Question 69 Which amongst the following molecules on polymerization produces neoprene? (1) H2C CH CH CH2 Cl (2) H2C C CH CH2 (3) H2C CH C CH  CH3 (4) H2C C CH CH2 Question 70 Some tranquilizers are listed below. Which one from the following belongs to barbiturates? (1) Chlordiazepoxide (2) Meprobamate (3) Valium (4) Veronal Question 71 The element expected to form largest ion to achieve the nearest noble gas configuration is (1) O (2) F (3) N (4) Na Question 72 Select the correct statements from the following A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10−31 kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton’s atomic theory regarded the atom as an ultimate particle of matters. Choose the correct answer from the options given below. (1) A, B and C only (2) C, D and E only (3) A and E only (4) B, C and E only  Question 73 Consider the following reaction and identify the product (P). HBr H3C CH CH CH3 Product (P) CH3 OH 3-methylbutan-2-ol Br (1) H3C C CH2 CH3 CH3 (2) CH3CH CH CH3 (3) H3C CH CH CH3 CH3 Br CH3 (4) H3C C CH2Br CH3 Question 74 The stability of Cu2+ is more than Cu+ salts in aqueous solution due to (1) First ionisation enthalpy (2) Enthalpy of atomization (3) Hydration energy (4) Secondary ionisation enthalpy Question 75 Wich one of the following statements is correct? (1) The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g (2) All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor (3) The bone in human body is an inert and unchanging substance (4) Mg plays roles in neuromuscular function and interneuronal transmission Question 76 Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:  (1) 16 (2) 32 (3) 30 (4) 18 Question 77 Amongst the given options, which of the following molecules/ion act/s as a Lewis acid? (1) NH3 (2) H2 O (3) BF3 (4) OH− Question 78 Identify product (A) in the following reaction: O Zn-Hg (A) + 2H2O O conc. HCl (1) OH (2) OH OH (3) CH2 CH2OH CH3 (4) CH3  Question 79 Taking stability as the factor, which one of the following represents correct relationship? (1) TlCl3 > TICl (2) Inl3 > Inl (3) AlCl > AlCl3 (4) TIl > TIl3 Question 80 Homoleptic complex from the following complexes is (1) Potassium trioxalatoaluminate (III) (2) Diamminechloridonitrito-N-platinum (II) (3) Pentaamminecarbonatocobalt (III) chloride (4) Triamminetriaquachromium (III) chloride Question 81 Complete the following reaction OH HCN conc. H2SO4 O [C] ∆ CN [A] [B] [C] is. (1) OH (2) COOH (3) CHO (4) COOH  Question 82 Which amongst the following options are correct graphical representation of Boyle’s law? T3 > T2 > T1 (1) P T1 T2 T3 V T3 T2 T1 (2) P T3 > T2 > T1 1/V T3 > T2 > T1 (3) P T3 T2 T1 1/V V1 V2 V3 (4) P V1 < V2 < V3 T Question 83 The right option for the mass of CO2 produced by heating 20 g of 20% pure limestone is h i 1200 K (Atomic mass of Ca = 40) CaCO3 −−−−→ CaO + CO2 (1) 1.12 g (2) 1.76 g (3) 2.64 g (4) 1.32 g  Question 84 For a certain reaction, the rate = k[A]2 [B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would (1) Decrease by a factor of nine (2) Increase by a factor of six (3) Increase by a factor of nine (4) Increase by a factor of three Question 85 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: In equation ∆r G = −nF Ecell , value of ∆r G depends on n. Reason R: Ecell is an intensive property and ∆r G is an extensive property. In the light of the above statements, choose the correct answer from the options given below. (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true and R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true Question 86 Match List-I with List-II: List-I List-II (Oxoacids of Sulphur) (Bonds) A. Peroxodisulphuric acid I. Two S−OH, Four S=O, One S−O−S B. Sulphuric acid II. Two S−OH, One S=O C. Pyrosulphuric acid III. Two S−OH, Four S=O, One S−O−O−S D. Sulphurous acid IV Two S−OH, Two S=O Choose the correct answer from the options given below. (1) A−I, B−III, C−II, D−IV (2) A−III, B−IV, C−I, D−II (3) A−I, B−III, C−IV, D−II (4) A−III, B−IV, C−II, D−I  Question 87 Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc2 O3 to Mn2 O7 C. Basic character increases from V2 O3 to V2 O4 to V2 O5 D. V2 O4 dissolves in acids to give VO3− 4 salts. E. CrO is basic but Cr2 O3 is amphoteric. Choose the correct answer from the options given below: (1) A and E only (2) B and D only (3) C and D only (4) B and C only Question 88 Which complex compound is most stable? (1) [Co(NH3 )4 (H2 O)Br](NO3 )2 (2) [Co(NH3 )3 (NO3 )3 ] (3) [CoCl2 (en)2 ]NO3 (4) [Co(NH3 )6 ]2 (SO4 )3 Question 89 Consider the following compounds/species: (i) (ii) − − (iii) (iv) + (v) (vi) (vii) The number of compounds/species which obey Huckel’s rule is. (1) 4 (2) 6 (3) 2 (4) 5 Question 90 What fraction of one edge centered octahedral void lies in one unit cell of f cc? 1 (1) 2 1 (2) 3 1 (3) 4 1 (4) 12 Question 91 Which amongst the following options is the correct relation between change in enthalpy and change in inernal energy? (1) ∆H = ∆U − ∆ng RT (2) ∆H = ∆U + ∆ng RT (3) ∆H − ∆U = −∆nRT (4) ∆H + ∆U = ∆nR Question 92 On balancing the given redox reaction, c aCr2 O2− 2− 2− 7 + bSO3 (aq) + cH (aq) −→ 2aCr (aq) + bSO4 (aq) + H2 O(l) + 3+ 2 the coefficients a, b and c are found to be, respectively (1) 1, 3, 8 (2) 3, 8, 1 (3) 1, 8, 3 (4) 8, 1, 3 Question 93 The equilibrium concentrations of the species in the reaction A + B C + D are 2, 3, −1 0 10 and 6 mol L , respectively at 300 K. ∆G for the reaction is (R = 2 cal/mol K)  (1) 1372.60 cal (2) −137.26 cal (3) −1381.80 cal (4) −13.73 cal Question 94 Pumice stone is an example of (1) Sol (2) Gel (3) Soil sol (4) Foam Question 95 Identify the major product obtained in the following reaction: O + − ∆ major product H + 2[Ag(NH3)2] + 3 OH O OH (1) OH O (2) OH O (3) COO− OH (4) COO−  Question 96 Identify the final product [D] obtained in the following sequence of reactions. Br (i) LiAlH4 H2SO4 HBr CH3CHO [A] [B] [C] [D] (ii) H3O+ ∆ Na/dry ether (1) (2) (3) C4 H10 (4) HC ≡ C⊖ Na+ Question 97 Which amongst the following will be most readily dehydrated under acidic conditions? NO2 OH (1) CH3 H OH OH (2) H3C H O2N H (3) OH OH NO2 (4) OH Question 98 Given below are two statements: Statement I: The nutrient deficient water bodies lead to eutrophication Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below:  (1) Both Statement I and Statement II are true (2) Both Statement I and Statement II are false (3) Statement I is correct but Statement II is false (4) Statement I is incorrect but Statement II is true Question 99 Consider the following reaction: HI CH2 O A+B ∆ Identify products A and B. (1) A= CH3 and B = OH (2) A= CH2OH and B = I (3) A= CH2I and B = OH (4) A= CH3 and B = I Question 100 The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is: (1) Fe2 O3 + CO −→ 2FeO + CO2 (2) FeO + CO −→ Fe + CO2 (3) C + CO2 −→ 2CO (4) CaO + SiO2 −→ CaSiO3 NEET (Biology) 7th May 2023 : Set E1 Question 101 Given below are two statements. One labelled as Assertion A and the other labelled as Reason R: Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R: Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from options given below: (1) Both A and R are correct and R is the correct explanation of A (2) Both A and R are correct but R is NOT the correct explanation of A (3) A is correct but R is not correct (4) A is not correct but R is correct Question 102 In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are: (1) Synergids, Primary endosperm nucleus and zygote (2) Antipodals, synergids, and primary endosperm nucleus (3) Synergids, Zygote and Primary endosperm nucleus (4) Synergids, antipodals and Polar nuclei Question 103 Movement and accumulation of ions across a membrane against their concentration gra- dient can be explained by (1) Osmosis (2) Facilitated Diffusion (3) Passive Transport (4) Active Transport Question 104 Large, colourful, fragrant flowers with nectar are seen in (1) Insect pollinated plants (2) Bird pollinated plants  (3) Bat pollinated plants (4) Wind pollinated plants Question 105 The phenomenon of pleiotropism refers to (1) Presence of several alleles of a single gene controlling a single crossover (2) Presence of two alleles, each of the two genes controlling a single trait (3) A single gene affecting multiple phenotypic expression (4) More than two genes affecting a single character Question 106 Which hormone promotes internode/petiole elongation in deep water rice? (1) GA3 (2) Kinetin (3) Ethylene (4) 2, 4-D Question 107 Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species? (1) Habitat loss and fragmentation (2) Over exploitation for economic gain (3) Alien species invasions (4) Co-extinctions Question 108 Upon exposure to UV radiation, DNA stained with ethidium bromide will show (1) Bright red colour (2) Bright blue colour (3) Bright yellow colour (4) Bright orange colour  Question 109 Which micronutrient is required for splitting of water molecule during photosynthesis? (1) Manganese (2) Molybdenum (3) Magnesium (4) Copper Question 110 Axile placentation is observed in (1) Mustard, Cucumber and Primrose (2) China rose, Beans and Lupin (3) Tomato, Dianthus and Pea (4) China rose, Petunia and Lemon Question 111 The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis? (1) Zygotene (2) Pachytene (3) Diplotene (4) Diakinesis Question 112 The reaction centre in PS II has an absorption maxima at (1) 680 nm (2) 700 nm (3) 660 nm (4) 780 nm Question 113 Unequivocal proof that DNA is the genetic material was first proposed by (1) Frederick Griffith (2) Alfred Hershey and Martha Chase  (3) Avery, Macleoid and McCarthy (4) Wilkins and Franklin Question 114 Among eukaryotes, replication of DNA takes place in: (1) M phase (2) S phase (3) G1 phase (4) G2 phase Question 115 In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as (1) Differentiation (2) Dedifferentiation (3) Development (4) Senescence Question 116 Cellulose does not form blue colour with Iodine because (1) It is a disaccharide (2) It is a helical molecule (3) It does not contain complex helices and hence cannot hold iodine molecules (4) It breaks down when iodine reacts with it Question 117 Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production? (1) Indole-3-butyric Acid (2) Gibberellic Acid (3) Zeatin (4) Abscisic Acid  Question 118 Given below are two statements: Statement I: The forces generated transpiration can lift a xylem-sized column of water over 130 meters height. Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both Statement I and Statement II are correct (2) Both Statement I and Statement II are incorrect (3) Statement I is correct but Statement II is incorrect (4) Statement I is incorrect but Statement II is correct Question 119 Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae. (1) Diadelphous and Dithecous anthers (2) Polyadelphous and epipetalous stamens (3) Monoadelphous and Monothecous anthers (4) Epiphyllous and Dithecous anthers Question 120 Expressed Sequence Tags (ESTs) refers to (1) All genes that are expressed as RNA. (2) All genes that are expressed as proteins. (3) All genes whether expressed or unexpressed. (4) Certain important expressed genes.  Question 121 Identify the correct statements: A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralisation. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below: (1) A, B, C only (2) B, C, D only (3) C, D, E only (4) D, E, A only Question 122 The thickness of ozone in a column of air in the atmosphere is measured in terms of: (1) Dobson units (2) Decibels (3) Decameter (4) Kilobase Question 123 Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true  Question 124 Which of the following stages of meiosis involves division of centromere? (1) Metaphase I (2) Metaphase II (3) Anaphase II (4) Telophase Question 125 The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year (1) 1985 (2) 1992 (3) 1986 (4) 2002 Question 126 How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle? (1) 12 ATP and 12 NADPH2 (2) 18 ATP and 12 NADPH2 (3) 12 ATP and 16 NADPH2 (4) 18 ATP and 16 NADPH2 Question 127 In the equation GPP − R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is. (1) Photosynthetically active radiation (2) Respiratory quotient (3) Respiratory loss (4) Reproductive allocation  Question 128 During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out (1) RNA (2) DNA (3) Histones (4) Polysaccharides Question 129 What is the role of RNA polymerase III in the process of transcription in Eukaryotes? (1) Transcription of rRNAs (28S, 18S and 5.8S) (2) Transcription of tRNA, 5S rRNA and snRNA (3) Transcription of precursor of mRNA (4) Transcription of only snRNAs Question 130 What is the function of tassels in the corn cob? (1) To attract insects (2) To trap pollen grains (3) To disperse pollen grains (4) To protect seeds Question 131 Identify the pair of heterosporous pteridophytes among the following: (1) Lycopodium and Selaginella (2) Selaginella and Salvinia (3) Psilotum and Salvinia (4) Equisetum and Salvinia Question 132 In gene gun method used to introduce alien DNA into host cells, microparticles of metal are used. (1) Copper (2) Zinc  (3) Tungsten or gold (4) Silver Question 133 Given below are two statements. Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true (2) Both Statement I and Statement II are false (3) Statement I is correct but Statement II is false (4) Statement I is incorrect but Statement II is true Question 134 Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by (1) Thomas Hunt Morgan (2) Sutton and Boveri (3) Alfred Sturtevant (4) Henking Question 135 Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: ATP is used at two steps in glycolysis. Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A. (2) Both A and R are true but R is NOT the correct explanation of A. (3) A is true but R is false. (4) A is false but R is true.  Question 136 Which one of the following statements is NOT correct? (1) The micro-organisms involved in biodegradation of organic matter in a sewage pol- luted water body consume a lot of oxygen causing the death of aquatic organisms (2) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries (3) Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbal- ance in the ecosystem dynamics of the water body (4) The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels Question 137 How many different proteins does the ribosome consist of? (1) 80 (2) 60 (3) 40 (4) 20 Question 138 Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine developement is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below: (1) A and B only (2) C and D only (3) B and E only (4) A and E only  Question 139 Match List I with List II: List I List II A Oxidative decarboxylation I Citrate synthase B Glycolysis II Pyruvate dehydrogenase C Oxidative phosphorylation III Electron transport system D Tricarboxylic acid cycle IV EMP pathway Choose the correct answer from the options given below: (1) A – III, B – IV, C – II, D – I (2) A – II, B – IV, C – I, D – III (3) A – III, B – I, C – II, D – IV (4) A – II, B – IV, C – III, D – I Question 140 Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true Question 141 Given below are two statements. One labelled as Assertion A and the other labelled as Reason R. Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A  (2) Both A and R are true but R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true Question 142 Match List I with List II: List I List II A. Cohesion I. More attraction in liquid phase B. Adhesion II. Mutual attraction among water molecules C. Surface tension III. Water loss in liquid phase D. Guttation IV. Attraction towards polar surfaces Choose the correct answer from the options given below: (1) A – II, B – IV, C – I, D – III (2) A – IV, B – III, C – II, D – I (3) A – III, B – I, C – IV, D – II (4) A – II, B – I, C – IV, D – III Question 143 Which of the following combinations is required for chemiosmosis? (1) Membrane, proton pump, proton gradient, ATP synthase (2) Membrane, proton pump, proton gradient, NADP synthase (3) Proton pump, electron gradient, ATP synthase (4) Proton pump, electron gradient, NADP synthase Question 144 Malonate inhibits the growth of pathogenic bacteria by inhibiting the activity of (1) Succinic dehydrogenase (2) Amylase (3) Lipase (4) Dinitrogenase  Question 145 Identify the correct statements: A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below: (1) B, C and E only (2) A and D only (3) A, B and D only (4) B and C only Question 146 Match List I with List II: List I List II A. M Phase I. Proteins are synthesized B. G2 Phase II. Inactive phase Interval between mitosis and C. Quiescent stage III. initiation of DNA replication D. G1 Phase IV. Equational division Choose the correct answer from the options given below: (1) A-III, B-II, C-IV, D-I (2) A-IV, B-II, C-I, D-III (3) A-IV, B-I, C-II, D-III (4) A-II, B-IV, C-I, D-III Question 147 Match List I with List II: List I List II (Interaction) (Species A and B) A. Mutualism I. +(A), 0(B) B. Commensalism II. –(A), 0(B) C. Amensalism III. +(A), –(B) D. Parasitism IV. +(A), +(B) Choose the correct answer from the options given below: (1) A-IV, B-II, C-I, D-III  (2) A-IV, B-I, C-II, D-III (3) A-IV, B-III, C-I, D-II (4) A-III, B-I, C-IV, D-II Question 148 Given below are two statements: Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is correct but Statement II is false. (4) Statement I is incorrect but Statement II is true. Question 149 Match List I with List II: List I List II A. Iron I. Synthesis of auxin B. Zinc II. Component of nitrate reductase C. Boron III. Activator of catalase D. Molybdenum IV. Cell elongation and differentiation Choose the correct answer from the options given below: (1) A-III, B-II, C-I, D-IV (2) A-II, B-III, C-IV, D-I (3) A-III, B-I, C-IV, D-II (4) A-II, B-IV, C-I, D-III Question 150 Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell B. Cutting of DNA at specific location by restriction enzyme C. Isolation of desired DNA fragment D. Amplification of gene of interest using PCR Choose the correct answer from the options given below: (1) B, C, D, A (2) C, A, B, D (3) C, B, D, A (4) B, D, A, C Question 151 Match List I with List II. List I List II A. Vasectomy I Oral method B. Coitus interruptus II Barrier method C. Cervical caps III Surgical method D. Saheli IV Natural method Choose the correct answer from the options given below: (1) A-III, B-I, C-IV, D-II (2) A-III, B-IV, C-II, D-I (3) A-II, B-III, C-I, D-IV (4) A-IV, B-II, C-I, D-III Question 152 Given below are two statements: Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is correct but Statement II is false. (4) Statement I is incorrect but Statement II is true.  Question 153 Which of the following statements is correct? (1) Eutrophication refers to increase in domestic sewage and waste water in lakes. (2) Biomagnification refers to increase in concentration of the toxicant at successive trophic levels. (3) Presence of large amount of nutrients in water restricts ‘Algal Bloom’ (4) Algal Bloom decreases fish mortality Question 154 Which one of the following symbols represents mating between relatives in human pedigree analysis? (1) (2) (3) (4) Question 155 Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly? (1) Genital herpes (2) Gonorrhoea (3) Hepatitis-B (4) HIV Infection Question 156 Match List I with List II. List I List II A. Heroin I Effect on cardiovascular system B. Marijuana II Slow down body function C. Cocaine III Painkiller D. Morphine IV Interfere with transport of dopamine Choose the correct answer from the options given below: (1) A-II, B-I, C-IV, D-III (2) A-I, B-II, C-III, D-IV (3) A-IV, B-III, C-II, D-I (4) A-III, B-IV, C-I, D-II Question 157 Match List I with List II. List I (Type of Joint) List II (Found between) A. Cartilaginous Joint I. Between flat skull bones B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column C. Fibrous Joint III. Between carpal and metacarpal of thumb D. Saddle Joint IV. Between Humerus and Pectoral girdle Choose the correct answer from the options given below: (1) A-III, B-I, C-II, D-IV (2) A-II, B-IV, C-I, D-III (3) A-I, B-IV, C-III, D-II (4) A-II, B-IV, C-III, D-I Question 158 Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C- terminal) and the right end represented by last amino acid (N-teminal) Statement II: Adult human haemoglobin, consist of 4 subunits (two subunits of α type and two subunits of β type.) In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is true but Statement II is false. (4) Statement I is false but Statement II is true.  Question 159 Which of the following are NOT considered as part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below: (1) B and D only (2) A, C and E only (3) A and D only (4) A, D and E only Question 160 Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is true but Statement II is false. (4) Statement I is false but Statement II is true. Question 161 Match List I with List II. List I List II A. CCK I Kidney B. GIP II Heart C. ANF III Gastric gland D. ADH IV Pancreas Choose the correct answer from the options given below: (1) A-IV, B-III, C-II, D-I (2) A-III, B-II, C-IV, D-I  (3) A-II, B-IV, C-I, D-III (4) A-IV, B-II, C-III, D-I Question 162 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Endometrium is necessary for implantation of blastocyst. Reason R : In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A. (2) Both A and R are true but R is NOT the correct explanation of A. (3) A is true but R is false. (4) A is false but R is true. Question 163 Match List I with List II. List I List II A. Ringworm I Haemophilus influenzae B. Filariasis II Trichophyton C. Malaria III Wuchereria bancrofti D. Pneumonia IV Plasmodium vivax Choose the correct answer from the options given below: (1) A-II, B-III, C-IV, D-I (2) A-II, B-III, C-I, D-IV (3) A-III, B-II, C-I, D-IV (4) A-III, B-II, C-IV, D-I Question 164 Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the option given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is true but Statement II is false. (4) Statement I is false but Statement II is true. Question 165 Match List I with List II. List I List II A. Taenia I Nephridia B. Paramoecium II Contractile vacuole C. Periplaneta III Flame cells D. Pheretima IV Urecose gland Choose the correct answer from the options given below: (1) A-I, B-II, C-III, D-IV (2) A-I, B-II, C-IV, D-III (3) A-III, B-II, C-IV, D-I (4) A-II, B-I, C-IV, D-III Question 166 Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment? (1) Recombinant DNA Technology (2) Serum and Urine analysis (3) Polymerase Chain Reaction (PCR) technique (4) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique Question 167 Match List I with List II. List I List II (Interacting species) (Name of interaction) A. A Leopard and a Lion in a forest/grassland I Competition B. A Cuckoo laying egg in a Crow’s nest II Brood parasitism Fungi and root of a higher plant in C. III Mutualism Mycorrhizae D. A cattle egret and a Cattle in a field IV Commensalism Choose the correct answer from the options given below: (1) A-I, B-II, C-III, D-IV (2) A-I, B-II, C-IV, D-III (3) A-III, B-IV, C-I, D-II (4) A-II, B-III, C-I, D-IV Question 168 Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is true but Statement II is false. (4) Statement I is false but Statement II is true. Question 169 Given below are two statements: Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is correct but Statement II is false. (4) Statement I is incorrect but Statement II is true.  Question 170 Match List I with List II with respect to human eye. List I List II Visible coloured portion of eye that regulates A. Fovea I diameter of pupil. B. Iris II External layer of eye formed of dense connective tissue. C. Blind spot III Point of greatest visual acuity or resolution. Point where optic nerve leaves the eyeball and D. Sclera IV photoreceptor cells are absent. Choose the correct answer from the options given below: (1) A-III, B-I, C-IV, D-II (2) A-IV, B-III, C-II, D-I (3) A-I, B-IV, C-III, D-II (4) A-II, B-I, C-III, D-IV Question 171 Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. (1) Tasmanian wolf, Bobcat, Marsupial mole (2) Numbat, Spotted cuscus, Flying phalanger (3) Mole, Flying squirrel, Tasmanian tiger cat (4) Lemur, Anteater, Wolf Question 172 Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below. (1) A and D only (2) A and B only (3) A, B and C only (4) A, C and D only  Question 173 Vital capacity of lung is (1) IRV + ERV (2) IRV + ERV + TV + RV (3) IRV + ERV + TV RV (4) IRV + ERV + TV Question 174 Match List I with List II. List I List II A. P-wave I Beginning of systole B. Q-wave II Repolarisation of ventricles C. QRS complex III Depolarisation of atria D. T-wave IV Depolarisation of ventricles Choose the correct answer from the options given below: (1) A-III, B-I, C-IV, D-II (2) A-IV, B-III, C-II, D-I (3) A-II, B-IV, C-I, D-III (4) A-I, B-II, C-III, D-IV Question 175 Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R : Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below. (1) Both A and R are true and R is the correct explanation of A. (2) Both A and R are true and R is NOT the correct explanation of A. (3) A is true but R is false. (4) A is false but R is true.  Question 176 Once the undigested and unabsorbed substances enter the caecum, their backflow is pre- vented by (1) Sphincter of Oddi (2) Ileo-caecal valve (3) Gastro-oesophageal sphincter (4) Pyloric sphincter Question 177 Match List I with List II. List I List II A. Gene a’ I β-galactosidase B. Gene ‘y’ II Transacetylase C. Gene ‘i’ III Permease D. Gene ‘z’ IV Repressor protein Choose the correct answer from the options given below: (1) A-II, B-I, C-IV, D-III (2) A-II, B-III, C-IV, D-I (3) A-III, B-IV, C-I, D-II (4) A-III, B-I, C-IV, D-II Question 178 Match List I with List II. List I (Cells) List II (Secretion) A. Peptic cells I Mucus B. Goblet cells II Bile juice C. Oxyntic cells III Proenzyme pepsinogen D. Hepatic cells IV HCl and intrinsic factor for absorption of vitamin B12 Choose the correct answer from the options given below: (1) A-IV, B-III, C-II, D-I (2) A-II, B-I, C-III, D-IV (3) A-III, B-I, C-IV, D-II (4) A-II, B-IV, C-I, D-III  Question 179 Which of the following functions is carried out by cytoskeleton in a cell? (1) Nuclear division (2) Protein synthesis (3) Motility (4) Transportation Question 180 Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A. (2) Both A and R are true but R is NOT the correct explanation of A. (3) A is true but R is false. (4) A is false but R is true. Question 181 Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both Statement I and Statement II are correct. (2) Both Statement I and Statement II are incorrect. (3) Statement I is correct but Statement II is incorrect. (4) Statement I is incorrect but Statement II is correct. Question 182 Broad palm with single palm crease is visible in a person suffering from- (1) Down’s syndrome  (2) Turner’s syndrome (3) Klinefelter’s syndrome (4) Thalassemia Question 183 Radial symmetry is NOT found in adults of phylum (1) Ctenophora (2) Hemichordata (3) Coelenterata (4) Echinodermata Question 184 In which blood corpuscles, the HIV undergoes replication and produces progeny viruses? (1) TH cells (2) B-lymphocytes (3) Basophils (4) Eosinophils Question 185 Which of the following is not a cloning vector? (1) BAC (2) YAC (3) pBR322 (4) Probe Question 186 Match List I with List II. List I List II A. Logistic growth I Unlimited resource availability condition B. Exponential growth II Limited resource availability condition The percent individuals of pre-reproductive C. Expanding age pyramid III age is largest followed by reproductive and post reproductive age groups The percent individuals of pre-reproductives D. Stable age pyramid IV and reproductive age group are same Choose the correct answer from the options given below:  (1) A-II, B-I, C-III, D-IV (2) A-II, B-III, C-I, D-IV (3) A-II, B-IV, C-I, D-III (4) A-II, B-IV, C-III, D-I Question 187 Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below: (1) A, C and D only (2) B and C only (3) B, D and E only (4) C, D and E only Question 188 The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. Are: (1) Limbic system and hypothalamus (2) Corpora quadrigemina and hippocampus (3) Brain stem and epithalamus (4) Corpus callosum and thalamus Question 189 The unique mammalian characteristics are: (1) hairs, tympanic membrane and mammary glands (2) hairs, pinna and mammary glands (3) hairs, pinna, and indirect development (4) pinna, monocondylic skull and mammary glands  Question 190 Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of RBCs formation Choose the correct answer from the options given below: (1) A and D only (2) B and C only (3) C and D only (4) D and E only Question 191 Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below: (1) A and C only (2) B and D only (3) A, C and E only (4) B and E only Question 192 Match List I with List II. List I List II A. Mast cells I Ciliated epithelium B. Inner surface of bronchiole II Areolar connective tissue C. Blood III Cuboidal epithelium D. Tubular parts of nephron IV Specialised connective tissue Choose the correct answer from the options given below: (1) A-I, B-II, C-IV, D-III (2) A-II, B-III, C-I, D-IV  (3) A-II, B-I, C-IV, D-III (4) A-III, B-IV, C-II, D-I Question 193 Which of the following is characteristic feature of cockroach regarding sexual dimorphism? (1) Dark brown body colour and anal cerci (2) Presence of anal styles (3) Presence of sclerites (4) Presence of anal cerci Question 194 Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3′ ? (1) 5′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3′ (2) 3′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5′ (3) 5′ ATCGATCGATCGATCGATCGATCGATCG 3′ (4) 3′ ATCGATCGATCGATCGATCGATCGATCG 5′ Question 195 In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below : (1) A and E only (2) A, B and E only (3) B, C and D only (4) B and D only Question 196 Given below are two statements: Statement I: During G0 phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:  (1) Both Statement I and Statement II are correct. (2) Both Statement I and Statement II are incorrect. (3) Statement I is correct but Statement II is incorrect. (4) Statement I is incorrect but Statement II is correct. Question 197 Which one of the following is NOT an advantage of inbreeding? (1) It decreases homozygosity. (2) It exposes harmful recessive genes but are eliminated by selection. (3) Elimination of less desirable genes and accumulation of superior genes takes place due to it. (4) It decreases the productivity of inbred population, after continuous inbreeding. Question 198 Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below: (1) A and B only (2) B, C and D only (3) A, B and E only (4) C, D and E only Question 199 Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below: (1) A, B and C only  (2) B and C only (3) A, C and D only (4) C and D only Question 200 Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the option given below: (1) D and E only (2) C and E only (3) B and C only (4) A and B only