NEET 2023 Solved Paper PDF
Document Details

Uploaded by TopQualityGadolinium2126
2023
NEET
Tags
Summary
This NEET 2023 solved paper document covers the botany section A, including questions on plant kingdom, anatomy of flowering plants and biomolecules. ​
Full Transcript
ar Ye 2023 NEET Solved Paper Botany Section-A Plant Kingdom...
ar Ye 2023 NEET Solved Paper Botany Section-A Plant Kingdom Anatomy of Flowering Plants 1. Given below are two statements: One is labelled as Assertion 5. Given below are two statements: A and the other is labelled as Reason R: Statement I: Endarch and exarch are the terms often used for Assertion A: The first stage of gametophyte in the life cycle describing the position of secondary xylem in the plant body. of moss is protonema stage. Statement II: Exarch condition is the most common feature Reason R: Protonema develops directly from spores produced of the root system. in capsule. In the light of the above statements, choose the correct answer In the light of the above statements, choose the most from the options given below: appropriate answer from the options given below: a. Statement I is incorrect but Statement II is true. a. A is not correct but R is correct. b. Both Statement I and Statement II are true. b. Both A and R are correct and R is the correct explanation c. Both Statement I and Statement II are false. of A. d. Statement I is correct but Statement II is false. c. Both A and R are correct but R is NOT the correct explanation of A. 6. Given below are two statements: One is labelled as Assertion d. A is correct but R is not correct. A and the other is labelled as Reason R: 2. Identify the pair of heterosporous pteridophytes among the Assertion A: Late wood has fewer xylary elements with following: narrow vessels. a. Equisetum and Salvinia b. Lycopodium and Selaginella Reason R: Cambium is less active in winters. c. Selaginella and Salvinia d. Psilolum and Salvinia In the light of the above statements, choose the correct answer from the options given below: Morphology of Flowering Plants a. A is false but R is true. 3. Family Fabaceae differs from Solanaceae and Liliaceae. With b. Both A and R are true and R is the correct explanation of A. respect to the stamens, pick out the characteristics specific to c. Both A and R are true but R is NOT the correct explanation family Fabaceae but not found in Solanaceae or Liliaceae. of A. a. Epiphyllous and Dithecous anthers d. A is true but R is false. b. Diadelphous and Dithecous anthers c. Polyadelphous and epipetalous stamens Biomolecules d. Monoadelphous and Monothecous anthers 7. Cellulose does not form blue colour with lodine because 4. Axile placentation is observed in a. It breakes down when iodine reacts with it. a. China rose, Petunia and Lemon b. It is a disaccharide. b. Mustard, Cucumber and Primorose c. It is a helical molecule. c. China rose, Beans and Lupin d. It does not contain complex helices and hence cannot hold d. Tomato, Dianthus and Pea iodine molecules. 2 Chapter & Topicwise NEET PYQ's Cell Cycle and Cell Division Respiration in Plants 8. Among eukaryotes, replication of DNA takes place in 16. Given below are two statements: One is labelled as Assertion a. G2 phase b. M phase A and the other is labelled as Reason R: c. S phase d. G1 phase Assertion A: ATP is used at two steps in glycolysis. 9. Which of the following stages of meiosis involves division of Reason R: First ATP is used in converting glucose into centromere? glucose-6-phosphate and second ATP is used in conversion a. Telophase b. Metaphase I of fructose-6- phosphate into fructose-1-6-diphosphate. c. Metaphase II d. Anaphase II In the light of the above statements, choose the correct answer 10. The process of appearance of recombination nodules occurs from the options given below is true, at which sub stage of prophase I in meiosis? a. A is false but R is true. a. Diakinesis b. Pachytene b. Both A and R are true and R is the correct explanation c. Zygotene d. Diplotenes of A c. Both A and R are true but R is NOT the correct explanation Transport in Plants of A. d. A is true but R is false. 11. Movement and accumulation of ions across a membrane against their concentration gradient can be explained by Plant Growth and Development a. Active Transport b. Osmosis 17. Spraying of which of the following phytohormone on c. Facilitated Diffusion d. Passive Transport juvenile conifers helps in hastening the maturity period, that 12. Given below are two statements : leads to early seed production? Statement I: The forces generated by transpiration can lift a a. Abscisic Acid b. Indole-3-butyric Acid xylem-sized column of water over 130 meters height. c. Gibberellic Acid d. Zeatin Statement II: Transpiration cools leaf surfaces sometimes 18. In tissue culture experiments, leaf mesophyll cells are put in 10 to 15 degrees, by evaporative cooling. a culture medium to form callus. This phenomenon may be called as: In the light of the above statements, choose the most appropriate answer from the options given below: a. Senescence b. Differentiation c. Dedifferentiation d. Development a. Statement I is incorrect but Statement II is correct. b. Both Statement I and Statement II are correct. 19. Which hormone promotes intemode/petiole elongation in c. Both Statement I and Statement II are incorrect. deep water rice? d. Statement I is correct but Statement II is incorrect. a. 2, 4-D b. GA3 c. Kinetin d. Ethylene Mineral Nutrition Sexual Reproduction in Flowering Plants 13. Which micronutrient is required for splitting of water molecule during photosynthesis? 20. Large, colourful, fragrant flowers with nectar are seen in: a. copper b. manganese a. wind pollinated plants b. insect pollinated plants c. molybdenum d. magnesium c. bird pollinated plants d. bat pollinated plants 21. In angiosperm, the haploid, diploid and triploid structures of Photosynthesis in Higher Plants a fertilized embryo sac sequentially are: 14. How many ATP and NADPH, are required for the synthesis a. Synergids, antipodals and Polar nuclei of one molecule of Glucose during Calvin cycle? b. Synergids, Primary endosperm nucleus and zygote a. 18 ATP and 16 NADPH2 c. Antipodals, synergids, and primary endosperm nucleus b. 12 ATP and 12 NADPH2 d. Synergids, Zygote and Primary endosperm nucleus c. 18 ATP and 12 NADPH2 22. What is the function of tassels in the corn cob? d. 12 ATP and 16 NADPH2 a. To protect seeds 15. The reaction centre in PS II has an absorption maxima at b. To attract insects a. 780 nm b. 680 nm c. To trap pollen grains c. 700 nm d. 660 nm d. To disperse pollen grains NEET 2023 Solved Paper 3 Principles of Inheritance and Variation Ecosystem 23. The phenomenon of pleiotropism refers to 31. Identify the correct statements: a. more than two genes affecting a single character. A. Detrivores perform fragmentation b. presence of several alleles of a single gene controlling a B. The humus is further degraded by some microbes during single crossover. mineralization. c. presence of two alleles, each of the two genes controlling C. Water soluble inorganic nutrients go down into the soil a single trait. and get precipitated by a process called leaching. d. a single gene affecting multiple phenotypic expression. D. The detritus food chain begins with living organisms. 24. Frequency of recombination between gene pairs on same E. Earthworms break down detritus into smaller particles by chromosome as a measure of the distance between genes to a process called catabolism. map their position on chromosome, was used for the first time by Choose the correct answer from the options given below: a. Henking b. Thomas Hunt Morgan a. D, E, A only c. Sutton and Boveri d. Alfred Sturtevant b. A, B, C only c. B, C, D only Molecular Basis of Inheritance d. C, D, E only 25. What is the role of RNA polymerase III in the process of 32. In the equation GPP – R = NPP transcription in Eukaryotes? a. Transcription of only snRNAS GPP is Gross Primary Productivity b. Transcription of rRNAs (28S, 18S and 5.8S) NPP is Net Primary Productivity. c. Transcription of tRNA, 5 srRNA and snRNA R here is d. Transcription of precursor of mRNA a. Reproductive allocation 26. Expressed Sequence Tags (ESTs) refers to b. Photosynthetically active radiation a. Certain important expressed genes. c. Respiratory quotient b. All genes that are expressed as RNA. c. All genes that are expressed as proteins. d. Respiratory loss d. All genes whether expressed or unexpressed. Biodiversity and Conservation 27. Unequivocal proof that DNA is the genetic material was first proposed by 33. The historic Convention on Biological Diversity, ‘The Earth a. Wilkins and Franklin Summit’ was held in Rio de Janeiro in the year: b. Fedrick, Griffith a. 2002 b. 1992 c. Alfred Hershey and Martha Chase c. 1985 d. 1986 d. Avery, Macleoid and McCarthy 34. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species? Biotechnology : Principles and Processes a. Co-extinctions 28. Upon exposure to UV radiation, DNA stained with ethidium b. Habitat loss and fragmentation bromide will show c. Over exploitation for economic gain a. Bright orange colour b. Bright red colour c. Bright blue colour d. Bright yellow colour d. Alien species invasions 29. In gene gun method used to introduce alien DNA into host Environmental Issues cells, microparticles of ______ metal are used. a. Silver b. Copper 35. The thickness of ozone in a column of air in the atmosphere c. Zinc d. Tungsten or gold is measured in terms of: 30. During the purification process for recombinant DNA a. Kilobase technology, addition of chilled ethanol precipitates out b. Dobson units a. Polysaccharides b. RNA c. Decameter c. DNA d. Histones d. Decibels 4 Chapter & Topicwise NEET PYQ's Botany Section-B Plant Kingdom Biomolecules 36. Given below are two statements: One is labelled as Assertion 39. Melonate inhibits the growth of pathogenic bacteria by A and the other is labelled as Reason R: inhibiting the activity of Assertion A: In gymnosperms the pollen grains are released a. Dinitrogenase from the microsporangium and carried by air currents. b. succinic dehydrogenase c. Amylase Reason R: Air currents carry the pollen grains to the mouth d. Lipase of the archegonia where the male gametes are discharged and pollen tube is not formed. Cell Cycle and Cell Division In the light of the above statements, choose the correct answer from the options given below: 40. Match List-I with List-II a. A is false but R is true. List-I List-II b. Both A and R are true and R is the correct explanation of A. (A) M Phase (I) Proteins are synthesized c. Both A and R are true but R is NOT the correct explanation of A. (B) G2 Phase (II) Inactive phase d. A is true but R is false. (C) Quiescent stage (III) Interval between mitosis and initiation of DNA Anatomy of Flowering Plants replication 37. Given below are two statements: One is labelled as Assertion (D) G1 Phase (IV) Equational division A and the other is labeled as Reason R: Assertion A: A flower is defined as modified shoot wherein Choose the correct answer from the options given below: the shoot apical meristem changes to floral meristem. a. A-II, B-IV, C-I, D-III Reason R: Internode of the shoot gets condensed to produce b. A-III, B-II, C-IV, D-I different floral appendages laterally at successive nodes c. A-IV, B-II, C-I, D-III instead of leaves. d. A-IV, B-I, C-II, D-III In the light of the above statements, choose the correct answer from the options given below: Transport in Plants a. A is false but R is true. 41. Match List-I with List-II b. Both A and R are true and R is the correct explanation of A. List-I List-II c. Both A and R are true but R is NOT the correct explanation of A. (A) Cohesion (I) More attraction in liquid d. A is true but R is false. phase 38. Identify the correct statements: (B) Adhesion (II) Mutual attraction among wate molecules A. Lenticels are the lens-shaped openings permitting the exchange of gases. (C) Surface tension (III) Water loss in liquid phase B. Bark formed early in the season is called hard bark. (D) Guttation (IV) Attraction towards polar C. Bark is a technical term that refers to all tissues exterior surfaces to vascular cambium. D. Bark refers to periderm and secondary phloem. Choose the correct answer from the option given below: E. Phellogen is single-layered in thickness. Choose the a. A-II, B-I, C-IV, D-III correct answer from the options given below: b. A-II, B-IV, C-I, D-III a. B and C only b. B. C and E only c. A-IV, B-III, C-II, D-I c. A and D only d. A, B and D only d. A-III, B-I, C-IV, D-II NEET 2023 Solved Paper 5 Mineral Nutrition Biotechnology : Principles and Processes 42. Match List-I with List-II 47. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence List-I List-II A. Insertion of recombinant DNA into the host cell. (A) Iron (I) Synthesis of auxin B. Cutting of DNA at specific location by restriction enzyme. (B) Zinc (II) Component of nitrate C. Isolation of desired DNA fragment. reductase (C) Boron (III) Activator of catalase D. Amplification of gene of interest using PCR. (D) Molybdenum (IV) Cell elongation and Choose the correct answer from the option given below: differentiation a. B, D, A, C b. B, C, D, A c. C, A, B, D d. C, B, D, A Choose the correct answer from the options given below: a. A- II, B- IV, C- I, D-III b. A-III, B- II, C-I, D-IV Organisms and Populations c. A-III, B- III, C-IV, D-I d. A-III, B-I, C-IV, D-II 48. Given below are two statements: Photosynthesis in Higher Plants Statement I: Gause’s ‘Competitive Exclusive Principle’ states that two closely related species competing for the same 43. Which of the following combinations is required for related species competing for the same resources cannot chemiosmosis? co-exist indefinitely and competitively inferior one will be a. proton pump, electron gradient, NADP synthase eliminated eventually. b. membrane, proton pump, proton gradient. ATP synthase Statement II: In general, carnivores are more adversely c. membrane, proton pump, proton gradient, NADP synthase affected by competition than herbivores. d. proton pump, electron gradient, ATP synthase In the light of the above statements, choose the correct answer Respiration in Plants from the options given below: a. Statement I is incorrect but Statement II is true 44. Math List-I with List-II b. Both Statement I and Statement II are true List-I List-II c. Both Statement I and Statement II are false (A) Oxidative ecarboxylation (I) Citrate synthase d. Statement I is correct but Statement II is false. (B) Glycolysis (II) Pyruvate 49. Match List-I with List-II (C) Oxidative (III) Electron phosphorylation transport system List-I (Interaction) List-II (Species A And B) (D) Tricarboxylic acid cycle (IV) EMP pathway (A) Mutualism (I) +(A), O(B) Choose the correct answer from the options given below: (B) Commensalism (II) –(A), O(B) a. A-II, B-IV, C-III,, D-I b. A-III, B-IV, C-II,, D-I (C) Amensalism (III) +(A), -(B) c. A-II, B-IV, C-I,, D-III d. A-III, B-I, C-II,, D-IV (D) Parasitism (IV) +(A), +(B) Principles of Inheritance and Variation Choose the correct answer from the given options: 45. Which of the following statements are correct about a. A-III, B-I, C-IV, D-II b. A-IV, B-II, C-I, D-III Klinefelter’s Syndrome? c. A-IV, B-I, C-II, D-III d. A-IV, B-III, C-I, D-II A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. Environmental Issues However, the feminine development is also expressed. 50. Which of the following answers are NOT correct? C. The affected individual is short stature. a. The amount of some toxic substances of industrial waste D. Physical, psychomotor and mental development is retarded. water increases in the organisms at successive trophic E. Such individuals are sterile. levels. Choose the correct answer from the options given below: b. The micro-organisms involved in biodegradation of a. A and E only b. A and B only organic matter in a sewage polluted water body consume c. C and D only d. B and E only a lot of oxygen causing the death of aquatic organisms. Molecular Basis of Inheritance c. Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries. 46. How many different proteins does the ribosome consist of? d. Water hyacinth grows abundantly in eutrophic water a. 20 b. 80 bodies and leads to an imbalance in the ecosystem c. 60 d. 40 dynamics of the water body. 6 Chapter & Topicwise NEET PYQ's Zoology Section-A Animal Kingdom Biomolecules 51. Radial symmetry is NOT found in adults of phylum 56. Given below are two statements: a. Echinodermata b. Ctenophora Statement I: Low temperature preserves the enzyme in a c. Hemichordata d. Coelenterata temporarily inactive state whereas high temperature destroys 52. Match List-I with List-II. enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the List-I List-II substrate in its molecular structure and inhibits the activity (A) Taenia (I) Nephridia of the enzyme, it is known as competitive inhibitor. (B) Paramoecium (II) Contractile vacuole In the light of the above statements, choose the correct answer from the options given below: (C) Periplaneta (III) Flame cells a. Statement I is false but statement II is true. (D) Pheretima (IV) Urecose gland b. Both Statement I and Statement II are true. Choose the correct answer from the options give below: c. Both Statement I and Statement II are false. a. A-II, B-I, C-IV, D-III b. A-I, B-II, C-III, D-IV d. Statement I is true but Statement II is false. c. A-I, B-II, C-IV, D-III d. A-III, B-II, C-IV, D-I 57. Given below are two statements: Statement I: A protein is imagined as a line, the left end Structural Organisation in Animals represented by first amino acid (C-terminal) and the right 53. Given below are two statements: end represented by last amino acid (N-terminal) Statement I: Ligaments are dense irregular tissue Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of a type and two subunits of b type.) Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer In the light of above statements choose the correct answer from the options given below: from the option given below: a. Statement I is false but Statement II is true. a. Statement I is false but Statement III is true. b. Both Statement I and Statement II are true. b. Both Statement I and II are true c. Both Statement I and Statement II are false. c. Both Statement I and II are false d. Statement I is true but Statement II is false. d. Statement I is true but Statement II is false Cell : The Unit of Life Digestion and Absorption 54. Which of the following are NOT considered as the part of 58. Match List-I with List-II. endomembrane system? List-I (Cells) List-II (Secretion) A. Mitochondria B. Endoplasmic Reticulum (A) Peptic cells (I) Mucus C. Chloroplasts E. Peroxisomes (B) Goblet Cells (II) Bile Juice D. Golgi complex (C) Oxyntic Cell (III) Proenzyme Pepsinogen Choose the most appropriate answer from the options given (D) Hepatic cells (IV) HCl and intrinsic factor for below: absorption of vitamin B12 a. A, D and E only b. B and D only c. A, C and E only d. A and D only Choose the correct answer from the options given below 55. Which of the following functions is carried out by a. A-II, B-IV, C-I, D-III cytoskeleton in a cell? b. A-IV, B-III, C-II, D-I a. Transportation b. Nuclear division c. A-II, B-I, C-III, D-IV c. Protein synthesis d. Motility d. A-III, B-I, C-IV, D-II NEET 2023 Solved Paper 7 59. Once the undigested and unabsorbed substances enter the (C) Fibrous Joint (III) Between carpal and caecum, their backflow is prevented by- metacarpal of thumb a. Pyloric sphincter (D) Saddle Joint (IV) Between Humerus and b. Sphincter of Oddi Pectoral girdle c. Ileo-caecal valve Choose the correct answer from the option given below: d. Gastro-oesophageal sphincter a. A-II, B-IV, C-III, D-I b. A-III, B-I, C-II, D-IV c. A-II, B-IV, C-I, D-III d. A-I, B-IV, C-III, D-II Breathing and Exchange of Gases 60. Vital capacity of lung is ________. Neural Control and Coordination a. IRV + ERV + TV b. IRV + ERV 64. Match List-I with List-II with respect to human eye. c. IRV + ERV + TV + RV d. IRV + ERV + TV – RV List-I List-II Body Fluids and Circulation (A) Fovea (I)Visible coloured portion of eye 61. Match List-I with List-II. that regulates diameter of pupil. (B) Iris (II) External layer of eye formed of List-I List-II dense connective tissue. (A) P-wave (I) Beginning of systole (C) Blind spot (III) Point of greatest visual acuity or resolution. (B) Q-wave (II) Repolarisation of ventricles (D) Sclera (IV) Point where optic nerve leaves (C) QRS complex (III) Depolarisation of atria the eyeball and photoreceptor (D) T-wave (IV) Depolarisation of ventricles cells are absent. Choose the correct answer from the options given below: a. A-I, B-II, C-III, D-IV b. A-III, B-I, C-IV, D-II a. A-II, B-I, C-III, D-IV b. A-III, B-I, C-IV, D-II c. A-IV, B-III, C-II, D-I d. A-II, B-IV, C-I, D-III c. A-IV, B-III, C-II, D-I d. A-I, B-IV, C-III, D-II Excretory Products and their Elimination Chemical Coordination and Integration 62. Given below are statements: one is labelled as Assertion A 65. Match List-I with List-II. and the other is labelled as Reason R. List-I List-II Assertion A: Nephrons are of two types: Cortical & Juxta (A) CCK (I) Kidney medullary, based on their relative position in cortex and (B) GIP (II) Heart medulla. (C) ANF (III) Gastric gland Reason R: Juxta medullary nephrons have short loop of (D) ADH (IV) Pancreas Henle whereas, cortical nephrons have longer loop of Henle. Choose the correct answer from the options given below: In the light of the above statements, choose the correct answer a. A-IV, B-II, C-III, D-I b. A-IV, B-III, C-II, D-I from the options given below: c. A-III, B-II, C-IV, D-I d. A-II, B-IV, C-I, D-III a. A is false but R is true. b. Both A and R are true and R is the correct explanation of A. Human Reproduction c. Both A and R are true but R is NOT the correct explanation of A. 66. Given below are two statements: d. A is true but R is false. Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Locomotion and Movement Statement II: The cavity of the cervix is called cervical canal 63. Match List-I with List-II. which along with vagina forms birth canal. List-I (Type of Joint) List-II (Found between) In the light of the above statements, choose the correct answer from the options given below: (A) Cartilaginous (I) Between flat skull bones a. Statement I incorrect but Statement II is true. Joint (B) Ball and Socket (II) Between adjacent b. Both Statement I and Statement II are true. Joint vertebrae in vertebral c. Both Statement I and Statement II are false. column d. Statement I is correct but Statement II is false. 8 Chapter & Topicwise NEET PYQ's 67. Given below are two statements: one is labelled as Assertion 71. Match List-I with List-II. A and the other is labelled as Reason R. List-I List-II Assertion A: Endometrium is necessary for implantation of (A) Vasectomy (I) Oral method blastocyst. (B) Coitus interruptus (II) Barrier method Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. (C) Cervical caps (III) Surgical method (D) Saheli (IV) Natural method In the light of the above statements, choose the correct answer from the options given below: Choose the correct answer from the options given below: a. A is false but R is true. a. A-IV, B-II, C-I, D-III b. Both A and R are true and R is the correct explanation of A. b. A-III, B-I, C-IV, D-II c. Both A and R are true but R is NOT the correct explanation c. A-III, B-IV, C-II, D-I of A. d. A-II, B-III, C-I, D-IV d. A is true but R is false. 68. Which of the following statements are correct regarding Principles of Inheritance and Variation female reproductive cycle? 72. Which one of the following symbols represents mating A. In non-primate mammals cyclical changes during between relatives in human pedigree analysis? reproduction are called oestrus cycle. a. b. B. First menstrual cycle begins at puberty and is called menopause. c. d. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and 73. Broad palm with single palm crease is visible in a person menopause. suffering from- Choose the most appropriate answer from the options given a. Thalassemia b. Down’s syndrome below: c. Turner’s syndrome d. Klinefelter’s syndrome a. A, C and D only b. A and D only c. A and B only d. A, B and C only Molecular Basis of Inheritance 74. Given below are two statements: Reproductive Health Statement I: RNA mutates at a faster rate. 69. Which one of the following common sexually transmitted Statement II: Viruses having RNA genome and shorter life diseases is completely curable when detected early and span mutate and evolve faster. treated properly? In the light of the above statements, choose the correct answer a. HIV Infection b. Genital herpes from the options given below. c. Gonorrhoea d. Hepatitis-B a. Statement I false but Statement II is true. 70. Given below are two statements: one is labelled as Assertion b. Both Statement I and Statement II are true. A and the other is labelled as Reason R. c. Both Statement I and Statement II are false. d. Statement I is true but Statement II is false. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care 75. Match List-I with List-II. Programme. List-I List-II Reason R: Ban on amniocentesis checks increasing menace (A) Gene 'a' (I) β-galactosidase of female foeticide. (B) Gene 'y' (II) Transacetylase In the light of the above statements. Choose the correct (C) Gene 'i' (III) Permease answer from the options given below: (D) Gene 'z' (IV) Repressor protein a. A is false but R is true. b. Both A and R are true and R is the correct explanation of Choose the correct answer from the option given below: A. a. A-III, B-I, C-IV, D-II c. Both A and R are true and R is NOT the correct explanation b. A-III, B-I, C-IV, D-III of A. c. A-II, B-III, C-IV, D-I d. A is true but R is false. d. A-III, B-IV, C-I, D-II NEET 2023 Solved Paper 9 76. Given below are two statements: Biotechnology : Principles and Processes Statement I: In prokaryotes, the positively charged DNA is 81. Which of the following is not a cloning vector? held with some negatively charged proteins in a region called nucleoid. a. Probe b. BAC c. YAC d. pBR322 Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to Biotechnology and its Applications form nucleosome. 82. Which one of the following techniques does not serve the In the light of the above statements, choose the correct answer purpose of early diagnosis of a disease for its early treatment? from the options given below: a. Enzyme Linked Immuno-Sorbent Assay (ELISA) a. Statement I is incorrect but Statement II is true. technique b. Both Statement I and Statement II are true. b. Recombinant DNA Technology c. Both Statement I and Statement II are false. c. Serum and Urine analysis d. Statement I is correct but Statement II is false. d. Polymerase Chain Reaction (PCR) technique Evolution Organisms and Populations 77. Select the correct group/set of Australian Marsupials 83. Match List-I with List-II. exhibiting adaptive radiation. a. Lemur, Anteater, Wolf List-I List-II b. Tasmanian wolf, Bobcat, Marsupial mole (Interacting species) (Name of Interaction) (A) A Leopard and a Lion in a (I) Competition c. Numbat, Spotted cuscus, Flying phalanger forest/ grassland d. Mole, Flying squirrel, Tasmanian tiger cat (B) A Cuckoo laying egg in a (II) Brood parasitism Crow's nest Human Health and Disease (C) Fungi and root of a higher (III) Mutualism 78. Match List-I with List-II plant in Mycorrtizae (D) A cattle egret and a Cattle (IV) Commensalism List-I List-II in a field (A) Ringworm (I) Haemophilus influenzae Choose the correct answer from the options given below: (B) Filariasis (II) Trichophyton. a. A-II, B-III, C-I, D-IV b. A-I, B-II, C-III, D-IV (C) Malaria (III) Wuchereria bancrofti c. A-I, B-II, C-IV, D-III d. A-III, B-IV, C-I, D-II (D) Pneumonia (IV) Plasmodium vivax Environmental Issues Choose the correct answer from the options given below: 84. Which of the following statements is correct? a. A-III, B-II, C-IV, D-I b. A-II, B-III, C-IV, D-I a. Algal Bloom decreases fish mortality. c. A-II, B-III, C-I, D-IV d. A-III, B-II, C-I, D-IV b. Eutrophication refers to increase in domestic sewage and waste water in lakes. 79. Match List-I with List-II. c. Biomagnification refers to increase in concentration of List-I List-II the toxicant at successive trophic levels. d. Presence of large amount of nutrients in water restricts (A) Heroin (I) Effect on cardiovascular system ‘Algal Bloom’. (B) Marijuana (II) Slow down body function 85. Given below are two statements: (C) Cocaine (III) Painkiller Statement I: Electrostatic precipitator is most widely used in (D) Morphine (IV) Interfere with transport thermal power plant. dopamine Statement II: Electrostatic precipitator in thermal power Choose the correct answer from the options given below: plant removes ionising radiations a. A-III, B-IV, C-I, D-II b. A-II, B-I, C-IV, D-III In the light of the above statements, choose the most c. A-I. B-II, C-III, D-IV d. A-IV, B-III, C-II, D-I appropriate answer from the options given below: 80. In which blood corpuscles, the HIV undergoes replication a. Statement I incorrect but Statement II is correct. and produces progeny viruses? b. Both Statement I and Statement II are correct. a. Eosinophils b. TH cells c. Both Statement I and Statement II are incorrect. c. B-lymphocytes d. Basophils d. Statement I is correct but Statement II is incorrect. 10 Chapter & Topicwise NEET PYQ's Zoology Section-B Animal Kingdom Cell Cycle and Cell Division 86. The unique mammalian characteristics are: 91. Given below are two statements: a. pinna, monocondylic skull and mammary glands Statement I: During Go phase of cell cycle the cell is b. hairs, tympanic membrane and mammary glands metabolically inactive c. hairs, pinna and mammary glands Statement II: The centrosome undergoes duplication during d. hairs, pinna and indirect development S phase of interphase. 87. Select the correct statements with reference to chordates. In the light of the above statements, choose the most appropriate A. Presence of a mid-dorsal, solid and double nerve cord. answer from the option below: B. Presence of closed circulatory system. a. Statement I is incorrect but Statement II is correct C. Presence of paired pharyngeal gills b. Both Statement I and Statement II are correct D. Presence of dorsal heart c. Both Statement I and Statement II are incorrect. E. Triploblastic pseudocoelomate animals. d. Statement I is correct but Statement II is incorrect. Choose the correct answer from the options given below: 92. Select the correct statements. a. C, D and E only b. A, C and D only A. Tetrad formation is seen during leptotene c. B and C only d. B, D and E only B. During Anaphase, the centromere split and chromatids separate. Structural Organisation in Animals C. Terminalization takes place during Pachytene. 88. Which of the following is characteristic feature of cockroach D. Nucleolus, Golgi complex and ER are reformed during regarding sexual dimorphism? Telophase. a. Presence of anal cerci E. Crossing over takes place between sister chromatids of b. Dark brown body colour and anal cerci homologous c. Presence of anal styles Choose the correct answer from the option given below: d. Presence of sclerites a. B and E only b. A and C only 89. Match List-I with List-II. c. B and D only d. A, C and E only List-I List-II Body Fluids and Circulation (A) Mast cells (I) Ciliated epithelium 93. Which of the following statements are correct? (B) Inner surface of (II) Areolar connective A. Basophils are most aboundant cell of the total WBCs bronchiole tissue B. Basophils secrete histamine, serotonin and heparin (C) Blood (III) Cuboidal epithelium C. Basophils are involved in inflammatory response (D) Tubular parts of (IV) specialised connective D. Basophils have kidney shaped nucleus nephron tissue E. Basophil are agranulocyte Choose the correct answer from the options Choose the correct answer from the options given below: a. A-III, B-IV, C-II, D-I b. A-I, B-II, C-IV, D-III a. A and B only b. D and E only c. A-II, B-III, C-I, D-IV d. A-II, B-I, C-IV, D-III c. C and E only d. B and C only 90. In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland Excretory Products and their Elimination C. Ncphrocytes D. Fat body 94. Which of the following statements are correct? E. Collatcrial glands A. An excessive loss of body fluid from the body switches Choose the correct answer from the options given below: off osmoreceptors. a. B and D only b. A and E only B. ADH facilitates water reabsorption to prevent diuresis. c. A, B and E only d. B, C and D only C. ANF causes vasodilation. NEET 2023 Solved Paper 11 D. ADH causes increase in blood pressure. Molecular Basis of Inheritance E. ADH is responsible for decrease in GFR. 98. Which one of the following is the sequence on corresponding Choose the correct answer from the options given below: coding strand, if the sequence on mRNA formed is as follow a. C, D and E only b. A and B only 5’AUCGAUCGAUCGAUCGAUCGAUCG c. B, C and D only d. A, B and E only AUCG 3? a. 3’ ATCGATCGATCGTCGATCG Locomotion and Movement ATCGATCG 5’ 95. Which of the following statements are correct regarding b. 5’ UAGCUAGCUAGCUAGCUA skeletal muscle? GCUAGC UAGC 3’ A. Muscle bundles are held together by collagenous c. 3’ UAGCUAGCUAGCUAGCUA connective tissue layer called fascicle. GCUAGCUAGC 5’ B. Sarcoplasmic reticulum of muscle fibre is a store house d. 5’ ATCGATCGATCGATCGATCG of calcium ions. ATCGATCG 3’ C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. Strategies for Enhancement in D. M line is considered as functional unit of contraction Food Production called sarcomere. 99. Which one of the following NOT an advantage of inbreeding? Choose the most appropriate answer from the options given below: a. It decreases the productivity of inbred population, after continuous inbreeding. a. C and D only b. A, B and C only b. It decreases homozygosity. c. B and C only d. A, C and D only c. It exposes harmful recessive genes that are eliminated by selection. Neural Control and Coordination d. Elimination of less desirable genes and accumulation of 96. The parts of human brain that helps in regulation of sexual superior genes takes place due to it behaviour, expression of excitement, pleasure, rage, fear etc. are. Organisms and Populations a. Corpus callosum and thalamus 100. Match List-I with List-II. b. Limbic system & hypothalamus List-I List-II c. Corpora quadrigemina & hippocampus d. Brain stem & epithalamus (A) Logistic (I) Unlimited resource availability growth condition Chemical Coordination and Integration (B) Exponential (II) Limited resource availability growth condition 97. Which of the following are NOT under the control of thyroid (C) Expanding (III) The percent individuals of hormone? age pyramid pre-reproductive age is largest A. Maintenance of water and electrolyte balance followed by reproductive and B. Regulation of basal metabolic rate post reproductive age groups (D) Stable age (IV) The percent individuals C. Normal rhythm of sleep-wake cycle pyramid of pre-reproductives and D. Development of immune system reproductive age group are E. Support the process of R.B.Cs formation Choose the same correct answer from the options given below: Choose the correct answer from the options given below: a. D and E only b. A and D only a. A-II, B-IV, C-III, D-I b. A-II, B-I, C-III, D-IV c. B and C only d. C and D only c. A-II, B-III, C-I, D-IV d. A-II, B-IV, C-I, D-III 12 Chapter & Topicwise NEET PYQ's Answer Key 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 b c b a a b d c d b a b b c b b c 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 c d b d c d d c b c a d c b d b b 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 b d b c b d b d b a d b b d c c c 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 d c c d b a d c a b d c b b b c a 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 c a c c b b c a c b b b a c b c d 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 c c c d d a c d c c b d d a b Explanations 1. (b) Mosses spores released from the capsule germinate to 8. (c) In eukaryotes, S or Synthesis phase marks the period form the filamentous structure called protonema. It is the during which DNA synthesis or replication takes place. first stage of gametophyte. During this phase the amount of DNA per cell doubles. 2. (c) Genera like Selaginella and Salvinia which produce two 9. (d) Anaphase stage is characterised by the following key kinds of spores, macro (large) and micro (small) spores, are events: known as heterosporous. 1. Centromeres split and chromatids separate. 3. (b) In fabaceae family the filaments of nine stamen are 2. Chromatids move to opposite poles. united into one bundle and tenth posterior stamen stand 10. (b) The first two stages of prophase I are relatively short- apart (diadelphous condition). Anther in fabaceae is of two lived compared to the next stage that is pachytene. During lobes or two theca thus called dithecous anther. These two this stage the four chromatids of each bivalent chromosomes characteristics are present in the members of fabaceae family became distinct and clearly appears as tetrads. This stage is but not found in members of solanacea or liliaceae family. characterized by the appearance of recombination nodules, Androecium: ten, diadelphous, anther dithecous the site at which crossing over occurs between non-sister 4. (a) In axile placentation ovules are attached to multilocular chromatids of the homologous chromosomes. ovary as in china rose, petunia and lemon. 11. (a) Active transport is a type of cellular transport in which 5. (a) In roots, the protoxylem lies towards periphery and substances like ions, glucose and amino acids are transported metaxylem lies towards the centre. Such arrangement of across a biological membrane towards the region that already primary xylem is called exarch. Endarch and exarch xylem contains a lot of such substances. In active transport, chemical are the terms used for primary xylem. energy (eg. ATP) is used to transport such substances against 6. (b) In winter, the cambium is less active and forms fewer the concentration gradient. xylary elements that have narrow vessels, and this wood is 12. (b) A system of xylem vessels from the root to the leaf vein called autumn wood or late wood. can supply the needed water. A pull force is created as water 7. (d) Both starch and cellulose are made of glucose molecules, evaporates through stomata, and presence of water channel but the difference between them is that starch is branched in the xylem elements. Presence of lower concentration of polymer while cellulose is a linear polymer. Starch also forms water vapour in atmosphere and higher in concentration in helical secondary structures, so it can hold I2 molecules in the the substomatal cavity and intercellular spaces. These forces helical portion. The Starch-I2 is blue colour. Cellulose does generated by transpiration can create pressure sufficient to not contain complex helices and hence cannot hold I2. lift xylem sized column of water over 130 metres high. NEET 2023 Solved Paper 13 Apart of creating transpiration pull for absorption and 25. (c) In eukaryotes, The RNA polymerase I transcribes rRNAs transport of plants it also helps in cooling leaf surfaces, (28S, 18S, and 5.8S), whereas the RNA polymerase III is sometimes 10 to 15 degrees by evapourative cooling. responsible for transcription of tRNA, 5srRNA, and snRNAs (small nuclear RNAs). The RNA polymerase II transcribes 13. (b) Mn is involved in water splitting and oxygen evolving precursor of mRNA, the heterogeneous nuclear RNA during light reaction of photosynthesis. (hnRNA). 14. (c) In one calvin cycle 26. (b) All the genes that are expressed as RNA are referred to as In Out Expressed sequence Tags (EST) are focussed on identifying Six CO2 One glucose all the genes that are expressed as RNA. 18 ATP 18 ADP 27. (c) The unequivocal proof that DNA is the genetic material 12 NADPH 12 NADP came from the experiments of Alfred Hershey and Martha Chase (1952). They worked with viruse that inject bacteria 15. (b) In PS I the reaction centre chlorophyll a has an called bacteriophages. absorptionpeak at 700 nm, hence is called P700, while in PS II it has absorptionmaxima at 680 nm, and is called P680. 28. (a) In gel electrophoresis the separated DNA fragments can be visualized only after staining the DNA with a compound 16. (b) ATP is utilised at two steps: first in the conversion of known as ethidium bromide followed by exposure to UV glucose into glucose 6-phosphate and second in the conversion radiation. Bright orange coloured bands of DNA can be seen of fructose 6-phosphate to fructose 1, 6-bisphosphate. when stained with ethidium bromide and exposed to UV 17. (c) Spraying of gibberellins on juvenile conifers, hastens the light. maturity period and thus leading to early seed production. 29. (d) A biolistic or gene gun is a technique of genetic 18. (c) The living differentiated cells, that by now have lost engineering where the genes, DNA, RNA or proteins are the capacity to divide can regain the capacity of division transferred to the plant cells without the use of any vectors. under certain conditions. This phenomenon is termed as The genetic material is coated with heavy metal i.e. gold or dedifferentiation. Same occurs in tissue culture of leaf. tungsten bombarded with the heavy velocity. 19. (d) Ethylene promotes rapid internode/petiole elongation in 30. (c) Addition of chilled ethanol precipitates the genomic deep water rice plants. DNA during the isolation of DNA or genetic material. 20. (b) Majority of insect-pollinated flowers are large, colorful, 31. (b) Detritus food chain (DFC) begins with detritus or dead fragrant flowers and rich in nectar. These characteristics off organic matter. Detrivores (eg. Earthworm, millipeds, slugs) were attract insect and thus help in pollination. perform fragmentation process on dead decaying material in any ecosystem. Humus a dark nutrient rich substance is 21. (d) In angiosperms, the haploid diploid and triploid structure degraded by microorganisms releasing inorganic nutrients of a fertilised embryo sac sequentially are- into the soil. This process is known as mineralization. By the Synergids, Zygote and Primary endosperm nucleus process leaching, water soluble inorganic nutrients go down 22. (c) Wind pollinated flower eg. Zea mays (maize) have non- into the soil horizon and get precipitated as unavailable salts. essential whorls such as calyx, corolla, bracts and bracteoles 32. (d) Gross primary productivity minus respiration losses (R), are not showy. Flowers are devoid of scent and nectar. The is the net primary productivity (NPP) tessels represent the stigma and style. Pollen grains are dry, 33. (b) The historic Convention on Biological Diversity (‘The very small sized, non-sticky and unwettable, so that they can Earth Summit’) held in Rio de Janeiro in 1992, called upon be carried by wind to the long distances. Stigma is hairy, all nations to take appropriate measures for conservation of feathery that catches the wind borne pollens. biodiversity and sustainable utilisation of its benefits. 23. (d) Generally effect of a gene can be seen on a single 34. (b) There are four major causes of biodiversity losses (The phenotype of a trait. However, there are instances where a Evil Quartet) that are habitat loss and fragmentation, over- single gene can exhibit multiple phenotype expression. Such exploitation, Alien species invasion and co-extinctions. a gene is called a pleiotropic gene. Habitat loss and fragmentation is the most important cause 24. (d) Alfred Sturtevant used the frequency of recombination driving animals and plants to extinction. between gene pairs on the same chromosome as a measure 35. (b) The thickness of the ozone in a column of air from the of the distance between genes and ‘mapped’ their position ground to the top of the atmosphere is measured in terms of on the chromosome. Dobson units (DU). 14 Chapter & Topicwise NEET PYQ's 36. (d) In gymnosperms, the pollen grain is released from the Molybdenum: It is component of several enzymes, including microsporangium. They are carried in air currents and nitrogenous and nitrate reductase. come in contact with the opening of the ovules borne on 43. (b) Chemiosmosis requires a membrane, a proton pump, a megasporophylls. The pollen tube carrying the male gametes proton gradient and ATP synthase. grows towards archegonia in the ovules and discharge their Energy is used to pump protons across a membrane, to contents near the mouth of the archegonia. create a gradient or a high concentration of protons within 37. (b) A flower is a modified shoot wherein the shoot apical the thylakoid lumen. ATP synthase has a channel that meristem changes to floral meristem. Internodes do not allows diffusion of protons back across the membrane; this elongate and the axis gets condensed. The apex produces releases enough energy to activate ATP synthase enzyme that different kinds of floral appendages laterally at successive catalyses the formation of ATP. nodes instead of leaves. 44. (a) Pyruvate when enters into mitochondrial matrix, it 38. (c) Bark is a non-technical term that refers to all tissues undergoes oxidative decarboxylation by a complex set of exterior to the vascular cambium, therefore including reactions catalysed by pyruvic dehydrogenase. secondary phloem. Bark refers to a number of tissue types, Glycolysis often referred to as the EMP pathway. viz., periderm and secondary phloem. Bark that is formed early in the season is called early or soft bark. Towards the Oxidative phosphorylation in process embedded in inner end of the season, late or hard bark is formed. Lenticels membrane of mitochondria (called electron transport chain permit the exchange of gases between the outer atmosphere and ATP synthase). The reaction in TCA cycle catalysed by and the internal tissue of the stem. Meristematic tissue called the enzyme citrate synthase. cork cambium or phellogen develops, usually in the cortex 45. (d) Klinefelter’s Syndrome is a genetic disorder that also region. Phellogen is a couple of layers thick. caused due to the presence of an additional copy of X 39. (b) The competitive inhibitor competes with the substrate chromosome resulting into a karyotype of 47, XXY. Such for the substrate binding site of the enzyme. Consequently, an individual has overall masculine development, however, the substrate cannot bind and as a result, the enzyme action the feminine development (development of breast, i.e., Gynaecomastia) is also expressed. Such individuals are declines, e.g. inhibition of succinic dehydrogenase by sterile. malonate which closely resembles the substrate succinate in structure. Such competitive inhibitors are ofter used in the Down syndrome was first described by Langdon down control of bacterial pathogens. (1866). In this disorder affected individual is physically, psychomotorly and mentally retarded. 40. (d) M phase is most dramatic period of cell cycle also called equational division. 46. (b) The cellular factory responsible for synthesising proteins is the ribosome. The ribosome consists of structural RNAs G2 phase: Proteins are synthesized in preparation for mitosis. and about 80 different proteins. Quiescent stage: cell do not divide further exit G1 phase to 47. (b) Main steps in the formation of recombinant DNA in enter an inactive state. correct sequence are: G1 phase: This phase corresponds to the interval between B: Cutting of DNA at specific location by restriction enzyme. mitosis and initiation of DNA replication. C: Isolation of desired DNA fragment by electrophoresis. 41. (b) Cohesion: Mutual attraction between water molecules. D: Amplification of gene of interest using PCR. Adhesion: Attraction of water molecules to polar surfaces. A: Insertion of recombinant DNA into the host cell. Surface Tension: Water molecules are attracted to each other in the liquid phase more than to water in the gas phase. 48. (d) Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources Guttation: Water loss in its liquid phase near the tip of grass cannot co-exist indefinitely and the competitively inferior blades. one will be eliminated eventually. 42. (d) Iron: It activates catalase enzyme, and is essential for the In general, herbivores and plants appear to be more adversely formation of chlorophyll. affected by competition than carnivores. Zinc: It needed in the synthesis of auxin. 49. (c) Mutualism: This interaction confers benefits on both the Boron: It required for uptake and utilisation of Ca2+, cell interacting species. elongation, cell differentiation, membrane functioning, Commensalism: This is the interaction in which one species Pollen germination and carbohydrate translocation. benefit (+) and other in neutral (o). NEET 2023 Solved Paper 15 Amensalism: In this interaction one species is harmed (–) dehydrogenase by malonate which closely resembles the whereas the other in unaffected (o). substrate succinate in structure. Parasitism: In this interaction one species benefit (+) and 57. (a) Statement I is incorrect as the first amino acid is called other is harmed (–). as N-terminal amino acid and the last amino acid is called 50. (c) Presence of large amounts of nutrients is waters causes the C-terminal amino acid. excessive growth of planktonic algae called an algal bloom 58. (d) Peptic cells – Secrete the proenzyme pepsinogen. which imparts a distinct colour to the water bodies. Algal Goblet cells – Secrete mucus. blooms cause deterioration of the water quality and fish mortality. Some bloom forming algae are extremely toxic to Oxyntic cells – Secrete HCl and intrinsic factor needed for human beings and animals. the absorption of Vitamin B12. 51. (c) Radial symmetry: When any plane passing through Hepatic cells – Secretes bile which is stored and concentrated the central axis of the body divides the organism into two in the gall bladder. identical halves. 59. (c) The undigested, unabsorbed substances called faeces Bilateral symmetry: When the body can be divided into enters into the caecum of the large intestine through ileo- identical left and right halves in only one plane. caecal valve, which prevents the back flow of the faecal matter. It is temporarily stored in the rectum till defaecation. The adult echinoderms are radially symmetrical but larvae are bilaterally symmetrical. 60. (a) Vital Capacity (VC): The maximum volume of air a person can breathe in after a forced expiration. This includes Coelenterates and Ctenophores are radially symmetrical ERV, TV and IRV or the maximum volume of air a person animals. can breathe out after a forced inspiration. Hemichordates are bilaterally symmetrical animals. 61. (b) In an ECG record, three recognisable waves (P-wave, 52. (d) Flatworms (e.g., Taenia) have excretory systems called QRS complex and T-wave) appear with each heartbeat. protonephridia with flame cells. P-wave – represents atrial depolarisation. Freshwater Paramoecium have osmoregulatory organelle QRS complex – represents ventricular depolarisation. called contractile vacuole. Urecose glands in Cockroaches (Periplaneta) helps in excretion. In earthworms (Pheretima), T-wave – represents ventricular repolarisation. the excretory organs are nephridia. Q-wave – represents initial phase of ventricular depolarisation 53. (c) Ligaments are dense regular connective tissue that connect i.e., beginning of systole. bone to bone. Cartilage is one of the types of specialised 62. (d) In majority of nephrons, the loop of Henle is too short and connective tissues. extends only very little into the medulla. Such nephrons are 54. (c) The endomembrane system include endoplasmic reticulum called cortical nephrons. In some of the nephrons, the loop (ER), golgi complex, lysosomes and vacuoles. Since the of Henle is very long and runs deep into the medulla. These functions of the mitochondria, chloroplast and peroxisomes nephrons are called juxta medullary nephrons. are not coordinated with the above components, these are not 63. (c) Cartilaginous Joints – Between adjacent vertebrae in considered as part of the endomembrane system. vertebral column. 55. (d) The cytoskeleton in a cell are involved in many functions Ball and socket Joint – Between humerus and pectoral girdle. such as mechanical support, motility, maintenance of the Fibrous Joint – Between flat skull bones. shape of the cell. Saddle Joint – Between carpal and metacarpal of thumb. 56. (b) Both statements, I and II are correct. Low temperature preserves the enzyme in a temporarily inactive state whereas 64. (b) The fovea is a thinned-out portion of the retina where only high temperature destroys enzymatic activity because proteins the cones are densely packed. It is the point where the visual are denatured by heat. When the inhibitor closely resembles acuity (resolution) is the greatest. The visible colored portion the substrate in its molecular structure and inhibits the activity of the eye is iris. The diameter of the pupil is regulated by the of the enzyme, it is known as competitive inhibitor. Due to muscle fibres of iris. Blind spot contains no photoreceptor its close structural similarity with the substrate, the inhibitor cells. It is also a region where the optic nerves leave the eye competes with the substrate for the substrate binding site of and the retinal blood vessels enter it. The external layer of the enzyme. Consequently, the substrate cannot bind and as a an eyeball is composed of a dense connective tissue and is result, the enzyme action declines, e.g., inhibition of succinic called the sclera. 16 Chapter & Topicwise NEET PYQ's 65. (b) Cholecystokinin (CCK), a hormone secreted by I-cells of 71. (c) Vasectomy is a surgical method of contraception in the upper small intestine. It acts on both pancreas and gall males. In vasectomy, a small part of the vas deferens is bladder and stimulates the secretion of pancreatic enzymes removed or tied up through a small incision on the scrotum. and bile juice, respectively. Although sperm production continues in the testes, sperm can no longer reach the exterior. The sperm degenerate and Gastric inhibitory peptide (GIP) is secreted by K-cells of are destroyed by phagocytosis. the small intestine. It acts to decrease gastrin and gastrin dependent acid secretion from the parietal cells of the Withdrawal or coitus interruptus is one of the natural methods stomach (gastric glands). of contraception in which the male partner withdraws his penis from the vagina just before ejaculation so as to avoid Atrial natriuretic factor (ANF) is a peptide hormone secreted insemination. by atrial wall of our heart. It decreases blood pressure. Cervical caps are barriers that fit snugly over the cervix and Anti-diuretic hormone (ADH) causes the kidneys to return block sperm from entering the uterus. more water to the blood and thus decrease the urine volume. Saheli –the new oral contraceptive for the females contains a 66. (b) Each ejaculatory duct is formed by the union of the duct non-steroidal preparation. It is a ‘once a week’ pill with very from the seminal vesicle and the vas deferens. They opens few side effects and high contraceptive value. into the prostatic urethra. 72. (c) Affected individuals Cervical canal (interior of the cervix) along with vagina forms the birth canal. Mating 67. (c) Both assertion and reason are correct but reason is not Mating between relatives correct explanation why endometrium is necessary for (consanguineous mating) implantation of blastocyst. The attachment of a blastocyst to Parents with male child the endometrium is called the implantation. It occurs about affected with disease 6 days after fertilisation. The endometrium is necessary for implantation as it serves as a key place not only for 73. (b) Down’s Syndrome : The cause of this genetic disorder supporting foetal growth through supplementation of oxygen is the presence of an additional copy of the chromosome and nutrients but also for protecting the embryo and later the number 21 (trisomy of 21). This disorder was first described foetus from microbial invasion during pregnancy. by Langdon Down (1866). The affected individual is short If fertilisation does not occur, the levels of progesterone statured with small round head, furrowed tongue and partially and estrogens decline due to degeneration of the corpus open mouth. Palm is broad with characteristic palm crease. luteum. Withdrawal of progesterone and estrogens causes Physical, psychomotor and mental development is retarded. disintegration of the endometrium leading to menstruation. 74. (b) RNA mutates at a faster rate because it is unstable. 68. (a) All options are correct except option B. First menstrual Therefore, viruses having RNA genome and shorter life span cycle begins at puberty is called menarche, not menopause. allow them to mutate and evolve at faster rates. 69. (c) Gonorrhoea is a sexually transmitted disease (STD) caused 75. (c) The lac operon consists of one regulatory gene (the i gene by the infection with bacterium Neisseria gonorrhoeae. – here the term i does not refer to inducer, rather it is derived Gonorrhoea can be cured with the proper treatment if from the word inhibitor) and three structural genes (z, y, and a). detected early. HIV infections, genital herpes and hepatitis-B The i gene codes for the repressor of the lac operon. The z are incurable STDs. gene codes for beta-galactosidase (β-gal), which is primarily 70. (a) Amniocentesis involves removal of some of the amniotic responsible for the hydrolysis of the disaccharide, lactose fluid that bathes the developing foetus and analysing the into its monomeric units, galactose and glucose. The y gene foetal cells and dissolved substances. It can be done to codes for permease, which increases permeability of the cell detect genetic disorders, chromosomal abnormalities, to β-galactosides. The a gene encodes a transacetylase. biochemical defects, etc. It can also reveal a baby’s gender. 76. (a) In prokaryotes, such as, E. coli, though they do not have a Statutory ban on amniocentesis for sex-determination have defined nucleus, the DNA is not scattered throughout the cell. been done to legally check increasing menace of female DNA (being negatively charged) is held with some proteins foeticides. Its application of sex determination is not one (that have positive charges) in a region termed as ‘nucleoid’. of the strategies of Reproductive and Child Health Care The DNA in nucleoid is organised in large loops held by Programme. proteins. NEET 2023 Solved Paper 17 77. (c) The process of evolution of different species in a given large amounts of nutrients in waters also causes excessive geographical area starting from a point and literally radiating growth of planktonic (free-floating) algae, called an algal to other areas of geography (habitats) is called adaptive bloom. radiation. Australian marsupials exhibit this phenomenon 85. (d) There are several ways of removing particulate matter; and gave varieties of marsupials, e.g., Numbat, Spotted the most widely used of which is the electros