LF130 Cellular and Molecular Biology Lecture 10, 2024 PDF

LF130 Cellular and Molecular Biology Lecture 10, 2024. Bacterial transcription Part 1. The background Dr Robert 1 Spooner  Recap from lecture 5: information flow ① DNA repli...

LF130 Cellular and Molecular Biology Lecture 10, 2024. Bacterial transcription Part 1. The background Dr Robert 1 Spooner  Recap from lecture 5: information flow ① DNA replication - information held at the DNA level is DNA 5’ 3’ copied ② Transcription ⑤ Reverse – information copied into RNA transcription 5’ 3’ RNA ④ RNA replication ③ Translation COOH – information copied into H 2N protein protein 2  Expression levels of genes vary A A A A A A A A A A translatio 5’ n 3’ mRNA, gene A 5’ 3’ 5’ 3’ transcripti on 5’ gene A 3’ DNA 3’ gene 5’ B transcripti on Gene expression can be regulated at mRNA, gene B3’ 5’ translatio the level of transcription or n translation or both B protein 3 B  Essential polarity and strand nomenclature codon 1 codon 2 codon 2 mRNA carries the ‘sense’ of the mRNA5’ 3’ information. This defines the A A A U G U U C C A DNA strands, as follows: transcripti on 5’ 3’ Non-template strand ‘sense’ A A A T G T T C C A strand DNA A A T A C A A G G T 3’ 5’ Template strand ‘antisense’ strand RNA synthesis follows the same base-pairing rules as DNA, except that uracil (U) substitutes for thymine (T) 4  Sense strands depend on context mRNA, gene A 5’ 3’ transcripti on Sense strand for Gene A 5’ gene A 3’Antisense strand for gene B DNA 3’ gene B 5’Sense strand for Gene B Antisense strand for geneA transcripti on 3’ 5’ Promoter regions mRNA, gene B (see later) 5  Why is uracil not found in DNA? NH2 O Cytosine can undergo spontaneous deamination to produce uracil. N + H20 N Cytosine pairs with Guanine. - NH3 Uracil pairs with Adenine. N O N O H H DNA replication after deamination would replace a C-G base pair with a U-A base-pair, cytosine uracil introducing mutations. GAUCTAG mutant daughter GACCTAG GAUCTAG CTAGATC CTGGATC CTGGATC GACCTAG non-mutant daughter CTGGATC In DNA, any U is removed by uracil-DNA glycosylase, generating an abasic site, which is removed and repaired by DNA polymerases. 6  There are three major classes of bacterial RNA Type of RNA Function mRN messenger encodes proteins A RNA rRNA ribosomal constituents of ribosomes: role in protein RNA synthesis tRNA transfer RNA adaptors between mRNA and amino acids: role in molecules These 3 classes of RNA protein synthesis are synthesized by a single RNA Polymerase in Escherichia coli. (In eukaryotes, there is a separate RNA polymerase for each class). 7  Bacterial transcription unit upstream downstreamDirections: based on SENSE strand transcription unit/ often an operon operator promoter protein-coding sequences terminator +1 5’ 3’ nontemplate strand (‘sense’) 3’ 5’ template strand (‘antisense’) No nucleus, so 5’ 3’ mRNA transcription and translation can occur simultaneously translation products (proteins) 1. 5’ promoter: attracts and binds RNA polymerase. Expect an operator (on-off) 2. Transcribed (protein coding) sequence(s): often multiple genes – polycistronic - as part of an operon 8 Bacterial RNA polymerase: a multi-subunit protein complex α - alpha β - beta ω - omega σ - sigma The bacterial core RNA polymerase is composed of α, β, β’ and ω subunits in the ratio 2:1:1:1 Addition of a σ subunit converts the enzyme to holoenzyme 9  RNA polymerase binds DNA at promoter sequences core polymerase (α2, β, β’ and ω) 3’ The core RNA polymerase 5’ binds DNA non-specifically and 5’ 3’ promoter can slide. σ subunit A σ subunit binds to the core 3’ polymerase and directs the polymerase holoenzyme to a gene 5’ 5’ 3’ promoter. 10  What does a promoter look like? Here’s the method: 3’ Bind RNA polymerase holoenzyme to DNA in vitro 5’ 5’ 3’ Add nuclease: the DNA is degraded, EXCEPT for the stretch that is bound to the polymerase, which is protected This forms the basis of the DNA footprinting technique that was used to identify promote 11  DNA footprinting RNA polymerase Protected from DNase NB! Only a small amount of DNase is used: the aim is partial degradation to generate a ladder of nicked 12  What does a bacterial promoter look like? A typical result: RNA Pol - + Usually, two regions are protected by RNA polymerase: the polymerase makes TWO contacts with the promoter. One is centred around -10 bp (-10 sequence) from the start of transcription and the other centred around -35 bp (-35 sequence) from the start of transcription (+1). Conserved elements: -35 sequence TTGACA -10 sequence TATAAT +1 is usually either A or G Two regions are Strong promoter sequences are closer to the typically consensus protected 13 e asymmetry of the promoter sequences provide directionali -35 -10 +1 Start and direction of transcription 5’ TTGAC TATAAT A 3’ A DNA 3’ 5’ A TTGAC TATAAT RNA 5’ 5’ 3’ 3’ 3’ A 5’ ① The -10, -35 and +1 consensus sequences are defined on the SENSE (NON-TEMPLATE, NON-TRANSCRIBED) strand ② RNA is built in the 5’ → 3’ direction: new nucleotides are added at the 3’ end, using the ANTISENSE strand as a template (don’t forget the pairing 14  LF130 Cellular and Molecular Biology Lecture 10, 2024. Bacterial transcription Part 2. The mechanism Dr Robert 15 Spooner  The three stages of transcription Initiation: RNA polymerase holoenzyme binds the promoter, opens the DNA double helix and starts to transcribe. Elongation: The σ subunit disengages from the holoenzyme, and the core enzyme continues to make new RNA. Termination: RNA polymerase core enzyme dissociates from the DNA, and transcription halts. 16  Initiation (1) core polymerase (α2, β, β’ and ω) 3’ The core RNA polymerase 5’ binds DNA non-specifically 5’ 3’ promoter and can slide. σ subunit A σ subunit binds to the core polymerase and directs the polymerase holoenzyme to a 3’ promoter, binding to the -10 and -35 regions. 5’ 5’ 3’ Escherichia coli has multiple σ subunits: different σ factors recognise different promoters, so they provide specificity. 17 Initiation (2): There are multiple E. coli σ factors Sigma (σ) Type of gene controlled Number of genes subunit controlled RpoD Growth/housekeeping ~1000 RpoS Stationary ~100 phase/virulence RpoH Heat shock ~40 RpoF Flagella-chemotaxis ~40 RpoN N2 metabolism ~15 RpoE Stress response ~5 FecI Ferric citrate transport ~5 18 Initiation (3): scrunching, abortive initiation and success ① The polymerase pulls ② … scrunching the downstream DNA towards DNA. itself … 3’ 3’ 5’ 5’ 3’ 5’ 5’3’ ③ … until success where abortive the -10 region is initiation 3’ opened… ④ … converting the CLOSED promoter 5’ complex to an OPEN promoter complex. 5’ 3’ Unlike the action of DNA helicase, this step does not involve the energy of ATP This becomes This becomes hydrolysis. looser, promoting tighter, promoting NEGATIVE POSITIVE Remember topoisomerases? They relieve supercoiling supercoiling the problems of supercoiling. 19  Initiation (4) 12 to 15 bp are unwound, from within the - 3’ 10 region to position +2 or +3: the 5’ transcriptional start site is exposed. 5’ 3’ RNA polymerase now makes an RNA copy 3’ from the template strand, using base pairing rules (G with C, A with U). Unlike 5’ DNA Pol, RNA polymerase does not 5’ 5’ 3’ require a primer. 3’ After about 10 nucleotides of RNA synthesis, the σ factor is exposed and 5’ disengages. The RNA polymerase can 5’ 3’ 5’ now elongate the new RNA. 20  Elongation: a transcription ‘bubble’ RNA pol core coding/sense strand rewinding unwinding 3’ movement of RNA polymerase 5’ 5’ 3’ template strand 5’ RNA exit channel newly synthesised RNA During elongation, RNA polymerase is highly processive. The RNA:DNA hybrid is ~8 bp long. The unwound DNA bubble is ~17 bp long. 21  Elongation: proofreading If RNA polymerase mis-incorporates a ribonucleotide, it … … hesitates … … and then it back-tracks, removes the nucleotide, and then continues. Error rate ~ one mistake every 104-105 nucleotides, even with these proof- reading functions. Why is such a high error rate tolerated? DNA errors are transmitted to progeny cells: they are stringently repaired. RNA errors mean that some transcripts may be mutated, but the majority are not. If the transcript encodes a protein, them most of that protein will be fine, but 22a  Termination of transcription in bacteria There are 2 mechanisms: 1) Rho (ρ)-independent: a terminator sequence in the RNA is recognised 2) ρ -dependent: requires ρ protein to break the RNA:DNA duplex in the transcription bubble In both cases, the functioning signals are recognised not in the DNA template, but in the newly synthesised RNA. 23  ρ-independent termination of transcription in bacteria DNA encodes STOP signals for transcription. The simplest is a palindromic GC rich sequence followed by a T rich sequence: transcription terminates either in this run of Ts or just after them C U G U G G C e.g. DNA: A U C G 5’ TAATCCCACAGCCGCCAGTTCGGCTGGCGGCATTTT C G 3’ ATTAGGGTGTCGGCGGTCAAGCCGACCGCCGTAAAA C G G C C G RNA transcript: C G G C 5’ UAAUCCCACAGCCGCCAGUUCGGCUGGCGGCAUUUU 5’ UAAUCCCACA AUUUU 3’ The RNA transcript can form a base-paired stem (stable, strong G:C base pairing) with a loop, leaving a tail of 4 or more Us only to participate in the RNA:DNA hybrid in the transcription bubble. 24 RNA polymerase pauses at the pallindome, the hairpin forms in the transcript and the ρ-dependent termination of transcription in prokaryotes 3’ 5’ 5’ 3’ ATP 5’ ADP + Pi ρ protein is a hexameric helicase that binds a C-rich G-poor sequence in the RNA – and it uses its helicase activity to chase RNA pol. When it caches – it disrupts the DNA:RNA hybrid helix, releasing the RNA. 25  Rifampicin: an inhibitor of prokaryotic transcription A synthetic derivative of rifamycins produced by Streptomyces. Rifampicin inhibits RNA Pol by binding tightly to the RNA exit 3’ channel. 5’ It therefore affects initiation 5’ 5’ 3’ (but does not affect RNA Pol that is already at the elongation stage). rifampicin 26  Finally - a twist in the tale … Atomic Force Microscopy image RNA polymerase BENDS the DNA duplex. Bending allows the DNA duplex to be opened more easily. helix opened 5’ 3’ DNA mRNA 3’ 5’ RNA 5’ RNA Pol When you see bent DNA (in any context) … think Herbert et al., Annu Rev Biochem (2008) 77, 149-176, slinky 27