Lecture 5 Bacterial Transcription PDF

Lecture 5 Bacterial Transcription BIO206 Introductory Cell & Molecular Biology Instructor: Ichiro Inamoto University of Toronto Mississauga 1 Table of contents 5.1 Bacterial genes 3 5.2 B...

Lecture 5 Bacterial Transcription BIO206 Introductory Cell & Molecular Biology Instructor: Ichiro Inamoto University of Toronto Mississauga 1 Table of contents 5.1 Bacterial genes 3 5.2 Bacterial RNA polymerase 25 5.3 Bacterial transcription initiation and elongation 31 5.4 Bacterial transcription termination 39 2  Lecture 5.1 Bacterial Genes 3  Week 2: Transcription Storage and inheritance of genetic information Processing genetic information to build proteins Proteins built according to genetic Cellular activity performed by proteins: information. Catalyze metabolic reactions Build cellular structures Send / receive signals 4 and much more Transcription copies DNA information to RNA 1. Proteins separate the double-stranded DNA 2. One of the single-stranded DNA becomes the template 3. RNA is synthesized according to template, following base-pairing rules Catalyzed by RNA polymerase... which part of DNA should we copy??? 5  Gene Gene is a segment of DNA which controls a discrete hereditary trait, characteristic or phenotype At the molecular level, gene is a segment of DNA that codes information to produce protein or functional RNA which its expression is regulated by cellular mechanisms Two major components of a gene: 1. Information to make functional protein or RNA 2. Information to control when to make the protein / RNA it codes for 6 Gene have features allowing it to be controlled by the cell transcribe more mRNA transcribe less mRNA to make more proteins to make less proteins Cells don’t want all genes to produce their products all the time without control Turn genes on/off in response to cellular events Adjust the amount of product each gene makes These are commonly controlled by regulating the amount of transcription 7  Features of a Bacterial Gene ‘Upstream' ‘Downstream' 5' Promoter 5' UTR Protein Coding Sequence (CDS) 3' UTR 3' DNA (genome) promoter element region downstream of promoter contains the regulates gene protein coding sequence (information to expression (when make the protein) and how much a gene gets used) this entire sequence is the 'gene' for this protein 8  Features of a Bacterial Gene Transcription start site +1 Transcription termination RNA ‘Upstream' polymerase ‘Downstream' 5' Promoter 5' UTR Protein Coding Sequence (CDS) 3' UTR 3' DNA (genome) RNA polymerase binding to Transcription promoter initiates transcription 5' 5' UTR Protein Coding Sequence (CDS) 3' UTR 3' mRNA Gene gets transcribed from the +1 transcription start site Translation Transcription gets terminated downstream of protein CDS N Translated protein C protein Protein CDS on mRNA gets translated to the protein 9  Features of a Bacterial Gene Transcription start site +1 Transcription termination RNA ‘Upstream' polymerase ‘Downstream' 5' Promoter 5' UTR ATG Protein Coding Sequence (CDS) TAA 3' UTR 3' DNA (genome) Only a portion of the mRNA Transcription contains the protein CDS 5' 5' UTR AUG Protein Coding Sequence (CDS) UAA 3' UTR 3' mRNA Start of protein CDS determined by the start codon, ATG (or AUG on mRNA) Translation End of protein CDS determined by the stop codon (in this N Translated protein C protein example, TAA) 10  Features of a Bacterial Gene Transcription start site +1 Transcription termination RNA ‘Upstream' polymerase ‘Downstream' 5' Promoter 5' UTR ATG Protein Coding Sequence (CDS) TAA 3' UTR 3' DNA (genome) Region of untranslated mRNA Transcription upstream of protein CDS is called the 5' untranslated region 5' 5' UTR AUG Protein Coding Sequence (CDS) UAA 3' UTR 3' mRNA Region of untranslated mRNA upstream of protein CDS is called Translation the 3' untranslated region N Translated protein C protein 11  Translation 101: Features of Protein Coding Sequence (CDS) Vast majority of protein CDS starts with the start codon: ATG Most, if not all protein CDS ends with one of the three stop codons: TAA, TAG, TGA UAA, UAG and UGA in mRNA CAAGCTATGCCGTACCATCGGTTTCCAGGTCCAGTGTTGGAA CCTCTTCTAAGGATCGAATGTGTAACCTCCGGCCCTTGGTTA TCGGTATCCCTCTCAAATAATCCCGCCCGCGTGTCGTACCGC ATTCAGAGAGAGGGGTTGTGCACTAACTGGAAGTTATGCCGT More details ACCATCGGTTTCCAGGTCCAGTGTTGGAACCTCTTCTATGGA presented during TCGAATGTGTTACCTCCGGCCCTTGGTTATCGGTATCCCTCT the Translation CAAATAATCCCGCCCGCGTGTCGTAACGCATTCAGAGAGAGG lectures GGTTGTGCACTAACTGGAAGTTCCCGCGTGTCGTATCGCATT CAGAGAGAGGGGTTGTGCACTTAACTTACGTT 12  Translation 101: Features of Protein Coding Sequence (CDS) Vast majority of protein CDS starts with the start codon: ATG Most, if not all protein CDS ends with one of the three stop codons: TAA, TAG, TGA UAA, UAG and UGA in mRNA CAAGCTATGCCGTACCATCGGTTTCCAGGTCCAGTGTTGGAA Protein Coding CCTCTTCTAAGGATCGAATGTGTAACCTCCGGCCCTTGGTTA Sequence (CDS) TCGGTATCCCTCTCAAATAATCCCGCCCGCGTGTCGTACCGC ATTCAGAGAGAGGGGTTGTGCACTAACTGGAAGTTATGCCGT More details ACCATCGGTTTCCAGGTCCAGTGTTGGAACCTCTTCTATGGA presented during TCGAATGTGTTACCTCCGGCCCTTGGTTATCGGTATCCCTCT the Translation CAAATAATCCCGCCCGCGTGTCGTAACGCATTCAGAGAGAGG lectures GGTTGTGCACTAACTGGAAGTTCCCGCGTGTCGTATCGCATT CAGAGAGAGGGGTTGTGCACTTAACTTACGTT 13  Features of a Bacterial Gene (coding for functional RNA) Transcription start site +1 Transcription termination RNA ‘Upstream' polymerase ‘Downstream' 5' Promoter 'Functional RNA' coding gene 3' DNA (genome) A gene does not always code for Transcription proteins 5' functional RNA (tRNA, rRNA etc.) 3' functional A gene may code for a functional RNA RNA, directly made from transcription Transcribed RNA may get post- transcriptionally modified But no translation occurs. Protein CDS and UTRs do not exist 14 'Typical' Bacterial promoter +1 Transcription start site 5' Promoter 5' UTR ATG Protein Coding Sequence (CDS) TAA 3' UTR 3' -60 -50 -40 -30 -20 -10 +1 | | | | | | | 5' TCAGAAAATTATTTTAAATTTCCTCTTGACAGGCCGGAATAACTCCCTATAATGCGCCACCACT 3' UP element -35 element -10 element Core promoter Extended promoter Typical bacterial promoter contains the consensus UP element, -35 element and the -10 element The specific sequences of these promoter elements are recognized by RNA polymerase for protein-DNA interaction 15 'Typical' Bacterial promoter +1 Transcription start site 5' Promoter 5' UTR ATG Protein Coding Sequence (CDS) TAA 3' UTR 3' -60 -50 -40 -30 -20 -10 +1 | | | | | | | 5' TCAGAAAATTATTTTAAATTTCCTCTTGACAGGCCGGAATAACTCCCTATAATGCGCCACCACT 3' UP element -35 element -10 element Core promoter Extended promoter Consensus sequence for -10 element = TATAAT Consensus sequence for -35 element = TTGACA These consensus sequences are found in many different bacterial promoters, although their sequences may slightly vary from one another 16  Consensus sequences slightly different versions of -10 sequences for each gene For example, the -10 element (consensus = TATAAT) is found at the -10 positions of many different bacterial promoters Sequences of -10 elements in these Different genes promoters are similar, but not exactly the same Compare the various -10 elements in different promoters and come up with a representative sequence This is how the consensus -10 sequence, TATAAT, was derived Modified from Kumar et al. (1993) J. Mol. Biol. 232:406-418 17  Consensus sequences T A T A A T 77% 76% 60% 61% 56% 82% For example, the -10 element (consensus = TATAAT) is found at the -10 element in bacterial promoter, TATAAT -10 positions of many different 77% of all -10 promoters have a 'T' in the first position bacterial promoters Sequences of -10 elements in these 61% of all -10 promoters have an 'A' in the fourth promoters are similar, but not exactly position, etc. the same Compare the various -10 elements in different promoters and come up T T G A C A with a representative sequence 69% 79% 61% 56% 54% 54% -35 element in bacterial promoter, TTGACA This is how the consensus -10 sequence, TATAAT, was derived You need to learn the sequences of -10 and -35, but do not need to know the exact percentages for each position 18  Bacterial Transcription, schematic RNA Polymerase Binds to -35 and -10, causing DNA to 'open' Transcription start site -35 -10 +1 | | | 5’- TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACGCCTAATGACGATC -3’ 3’- ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGCGGATTACTGCTAG -5’ relative position of -10 and -35 tells RNA polymerase which way to go Learn relative locations of -35, -10 and +1 exact sequences of -35 and -10 this is your reference slide to study these sequences 19 Bacterial Transcription, schematic RNA polymerase starts synthesizing RNA using bottom strand as template starts from the transcription start site ALWAYS 5’ to 3’ direction complementary base pairing Transcription start site -35 -10 +1 | | | 5’- TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACGCCTAATGACGATC -3’ this 'A' was the first nucleotide added to the template RNA 5’- AGGUCCACGCCUAAUGACGAUC -3’ 3’- ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGCGGATTACTGCTAG -5’ direction of RNA polymerization 20 Bacterial Transcription, schematic RNA polymerase starts synthesizing RNA using bottom strand as template starts from the transcription start site ALWAYS 5’ to 3’ direction complementary base pairing -35 -10 +1 | | | 5’- TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACGCCTAATGACGATC -3’ RNA 5’- AGGUCCACGCCUAAUGACGAUC -3’ 3’- ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGCGGATTACTGCTAG -5’ top DNA strand and the newly synthesized RNA has the same sequence except for ‘T’ being replaced with ‘U’ 21  +1 Template vs Non-template DNA strands promoter | ATG TAA This DNA: Codes for the protein sequence = Coding strand Is NOT used as a template for transcription = Non-template strand -35 -10 +1 translation start | | | | 5’- TAGTGTATTGACATGATAGAAGCACTCTACTATAATCTCAATAGGTCCACGCCTAATGACGATCGAGGAGGTCAATGG... -3’ the ‘TTGACA’ of -35 and ‘TATAAT’ of -10 always occurs on non-template strand mRNA 5’- AGGUCCACGCCUAAUGACGAUCGAGGAGGUCAAUGG... -3’ 3’- ATCACATAACTGTACTATCTTCGTGAGATGATATTAGAGTTATCCAGGTGCGGATTACTGCTAGCUCCUCCAGUTACC... -5’ This DNA: Does NOT code for the protein sequence = Non-coding strand Is used as a template for transcription = Template strand 22 Template vs Non-template DNA strands RNA polymerase moves This DNA: Codes for the protein sequence = Coding strand along the DNA in the 5' to 3' direction of the Is NOT used as a template for transcription = Non-template strand non-template strand RNA pol. As it moves, RNA polymerase opens the 5’ 3’ dsDNA to synthesize more mRNA onto the RNA template strand 5’ 3’ 3’ 5’ -1 +1 +2 This DNA: Does NOT code for the protein sequence = Non-coding strand Is used as a template for transcription = Template strand 23  Both strands of the dsDNA can code for genes Gene's features will stay the same relative to the polarity of the ssDNA +1 -35 -10 | Start Stop 5' TTGACA TATAAT ATG TAA ATTATA TGTCAA 3' 3' AACTGT ATATTA AAT GTA TAATAT ACAGTT 5' Stop Start | -10 -35 +1 Gene A Gene B Patches of genes found in organisms' genome Genes on different DNA strand face opposite, but usually will not overlap. 24  Lecture 5.2 Bacterial RNA polymerase 25 RNA polymerases RNA Polymerase responsible for transcription Synthesizes RNA using DNA as a template ATP, UTP, GTP an CTP are substrates Polymerization is always in the 5’ to 3’ direction 26  Bacterial RNA Polymerase core consists of multiple subunits Bacterial RNA polymerase core is a 5-protein complex = α-subunit + α-subunit + β-subunit + β’-subunit + ω-subunit alpha beta omega β β β` α β` α α α ω ω RNA polymerase core has catalytic activity to polymerize RNA But, RNA polymerase core can not recognize all promoter elements by itself 27  Bacterial RNA Polymerase core consists of multiple subunits Bacterial RNA polymerase core is a 5-protein complex = α-subunit + α-subunit + β-subunit + β’-subunit + ω-subunit alpha beta omega catalytic activity holds DNA β Subunit function αx2 recognizes and binds to UP elements using β` their C-terminal domain α β contains the polymerase activity α β’ ω binds and holds onto DNA stabilizes RNA polymerase structure binds to UP elements ω Total polymerizes RNA using DNA as template stabilizes RNA polymerase structure RNA polymerase core has catalytic activity to polymerize RNA But, RNA polymerase core can not recognize all promoter elements by itself 28  Bacterial RNA Polymerase Holoenzyme = RNA pol. Core + sigma factor σ (sigma) factors assist RNA polymerase core to bind to specific promoters many types of σ factors exist in a single cell σ70 corresponds to the -35 and -10 elements in the typical bacterial promoter α σ70 binds to the RNA polymerase core and helps it bind to the typical bacterial promoter σ70 RNA polymerase core bound to a sigma factor is called RNA Polymerase Holoenzyme RNA polymerase core can still transcribe σ70 is helping the RNA polymerase core recognize and attach to the -35 and -10 elements without σ factors, but at a much lower frequency and specificity 29  Bacterial RNA Polymerase Holoenzyme = RNA pol. Core + sigma factor Different σ factors exist in a single cell, which conserved recognize different promoter sequences sequences for σ70 +1 Core -35 -10 | The type of sigma factor carried by the RNA σ70 polymerase Holoenzyme determines which promoter it can transcribe from conserved +1 Core Many sigma factors control group of genes sequence for σ32 | σ32 which work together for a specific function σ70: general transcription σ32: genes for heat shock response σN: genes to cause disease Core conserved +1 σE: genes for sporulation sequence for σE | σE Only one sigma factor can be bound to RNA polymerase core at once 30  Lecture 5.3 Bacterial transcription initiation and elongation 31 RNA polymerase creates a Transcription Bubble RNA polymerase moves ~ 50 bp / second, opening (and closing) dsDNA and sequentially adding nucleotides to the 3’ end of growing RNA Transcription Bubble created by RNA polymerase (~10 - 20 bp) Direction of transcription 32  RNA polymerase creates a Transcription Bubble -10 TATAAT +1, transcription start non-template 5’ template 3’ -35 TTGACA 5’ Shown here are bacterial promoters, but the concept is the same for eukaryotes as well 33 Three stages of transcription Initiation binding of RNA polymerase to a promoter sequence Elongation sequential addition of NTPs using DNA as a template Termination dissociation of RNA polymerase release of primary transcript from template 34 Transcription initiation in bacteria: Loading DNA Note: Not all subunits are fully shown in these images to show the interaction of the DNA with the polymerase better This example shows RNA polymerase Holoenzyme carrying σ70 σ70 recognizes and binds to -35 and -10 elements α subunits of RNA polymerase core recognizes and binds to the UP element α N-terminal domain These protein-DNA α interactions 'load' DNA onto α C-terminal domain RNA polymerase Holoenzyme σ70 35 Transcription initiation in bacteria: Closed and Open Complex Note: Not all subunits are fully shown in these images to show the interaction of the DNA with the polymerase better DNA gets bent when it is loaded onto the RNA polymerase holoenzyme Initially, the loaded dsDNA is not separated: this is the Closed Complex Then, the RNA polymerase Holoenzyme opens up the dsDNA (Open Complex) Opening the DNA generates the replication bubble, which at the beginning, exposes the template strand between positions -10 to +10 -10 -10 -UP -UP -35 -35 36 Closed complex Open complex Transcription initiation in bacteria: Abortive initiation Note: Not all subunits are fully shown in these images to show the interaction of the DNA with the polymerase better RNA polymerase starts to synthesize on the opened template strand, starting from the +1 transcription start site RNA polymerase starts to move towards the 3' direction ~10 nt ssRNA However, the Sigma factor is binding strongly to both the promoter elements AND the RNA polymerase core The core can not move far away from the promoter while it is bound to the Sigma factor After the RNA polymerase has transcribed ~10 -10 -UP nucleotides, the Sigma factor interrupts -35 polymerization and brings back the RNA polymerase core to the +1 site Sigma factor 'blocks' RNA polymerase core RNA polymerase Holoenzyme starts to transcribe from from moving too far from the +1 site +1 site again After several attempts, RNA polymerase core breaks off from the sigma factor, and enters the elongation phase 37 Transcription elongation in bacteria Note: Not all subunits are fully shown in these images to show the interaction of the DNA with the polymerase better RNA polymerase now moves down the DNA, synthesizing the new RNA strand Sigma factor is absent. Only the RNA polymerase core is required for elongation. RNA Pol reads template RNA polymerase core DNA 3' to 5' -UP RNA Pol synthesizes new -35 RNA 5' to 3' -10 Newly synthesized RNA sequence is Direction of transcription ‘identical’ to the non- template strand Newly synthesized RNA 38  Lecture 5.4 Bacterial transcription termination 39  Transcriptional termination in Bacteria: two methods Transcription start site +1 Transcription termination RNA ‘Upstream' polymerase ‘Downstream' 5' Promoter 5' UTR ATG Protein Coding Sequence (CDS) TAA 3' UTR 3' DNA (genome) Transcription 5' 5' UTR AUG Protein Coding Sequence (CDS) UAA 3' UTR 3' mRNA Bacteria transcription termination occurs at the end of 3' UTR using one of two methods: 1. Intrinsic (Rho-independent) 2. Rho-dependent 40 Transcription termination in Bacteria: Intrinsic (Rho-independent) Highly GC rich sequence followed by U (T, on DNA) rich area exist at the location where transcription is supposed to end Terminator Sequence GC rich U rich C U C U G G - C A - U Therefore forms a hairpin structure C - G C - G G – C GC rich sequences are complementary to each other AND this is a single strand RNA C - G C – G 5’ CCCACAGCCGCCAGUUCCGCUGGCGGCAUUUU 3’ 5’ CCCACA G - C AUUUU 3’ 3’ TAAAA 5’ 3’ TAAAA 5’ Template DNA 41 Transcription termination in Bacteria: Intrinsic (Rho-independent) Formation of the hairpin loop pulls on the RNA RNA adjacent to the hairpin is a U-rich region, with weaker hydrogen bonds against the template DNA The ‘pull’ forces off the RNA from template G/C rich complementary region gets transcribed G/C rich complementary region forms a loop 42 Transcription termination in Bacteria: Rho-dependent Rho is a homohexameric protein Recognizes and binds to the Rho Utilization Site (RUT) on the growing RNA Each Rho subunit hydrolyses ATP, uses the energy to move towards the 3’ end of RNA Direction of transcription Direction of Rho movement RUT site 3' Rho Rho 5' 43 Transcription termination in Bacteria: Rho-dependent Each Rho subunit hydrolyses ATP and uses the energy to move towards the 3’ end of RNA Eventually, Rho catches up to RNA polymerase core enzyme As Rho approaches RNA polymerase, the polymerase interacts with a stem-loop structure RUT site on RNA, and gets slowed down Rho catches up to RNA polymerase, causing RNA polymerase to dissociate from DNA and RNA  Bacterial transcription overview Initiation binding of RNA polymerase to a promoter sequence Elongation sequential addition of NTPs using DNA as a template Termination dissociation of RNA polymerase release of primary transcript from template 45