Central Dogma and Genetic Variation Lecture PDF

The Central Dogma and Genetic Variation Assoc. Prof Eman Ramadan 1  An example of hypertrophy would be An example of hypertrophy would be (a)liver (a)regeneration after partialafter liver regeneration hepatectomy (compensatory hyp...

The Central Dogma and Genetic Variation Assoc. Prof Eman Ramadan 1  An example of hypertrophy would be An example of hypertrophy would be (a)liver (a)regeneration after partialafter liver regeneration hepatectomy (compensatory hyperplasia) partial hepatectomy (b)breast (b) development at puberty (hormonal breast development at pubertyhyperplasia) (c)enlargement (c) the of the uterus uterus during during pregnancypregnancy (an example of hormonal (d) hyperplasia the uterus andmenstruation during hypertrophy) (d)the uterus during menstruation (atrophy) (e) a papillomavirus (e)a papillomavirus induced skininduced skin wart hyperplasia) wart (pathologic 2 2. Hypertrophy 2. Hypertrophy (a)occurs after partial hepatectomy (hyperplasia) (a) occursfunction (b)increases after partial of an hepatectomy organ exponentially (wrong) (b) increasesby (c) is triggered function of an organ mechanical exponentially and trophic chemicals (eg (c) progestrogen, is triggeredand by mechanical andeffects foetal growth trophicon chemicals the uterus) (d)occurs (d) after denervation occurs after denervation(atrophy) (e)is usually (e) pathological is usually WRONG (exercise induced pathological hypertrophy, pregnancy) 3 2. Which Which 1. of of the following the following is an example is an example of hypertrophy of hypertrophy (a) increased (a)increased liver liver size size after afterhepatectomy partial partial hepatectomy (hyperplasia) (b) increased (b)increased sizefemale size of the of the female breast atbreast at puberty puberty (hyperplasia) (c) increased (c)increased respiratory respiratory epithelium epithelium seen in seen in vitamin vitamin A deficiency A deficiency (metaplasia) (d)increased size of the uterus in pregnancy (both hyperplasia & hypertrophy) (d) increased size of the uterus in pregnancy (e) endometrial e)endometrial development development in readiness in readiness for ovumforimplantation ovum implantation (hyperplasia) 4 2. 1.Metapalsia Metapalsia can be (a)(a)can’t becaused causedbybyvitamin vitaminBB1212deficiency deficiency (decreases cell (b) preserves the mucus secretion in the respiratory tract turnover, the gastric mucosa becomes thin and atrophic) (b)does not preserve (c) is typically the mucus secretion in the respiratory tract irreversible (c)is typically reversible (d) describes the underlying pathology of Barrett’s (d)describes the underlying pathology of Barrett’s oesophagus (e) isoesophagus an increase in the number and size of cells in a tissue (e) is an increase (hypertrophy andinhyperplasia) the number and size of cells in a tissue 5 2. 1. Hyperplasia Hyperplasiaisis (a)increase in the size of cells (hypertrophy) (a) increase in the size of cells (b)increase inthe (b) increase in thenumber number of of cells cells (c) increase in the number of cellular organelles (also seen in (c)increase hypertrophy) (d) increase in the size of the organ (d)increase in the size of the organ (also seen in hypertrophy) (e) always pathological (e)is either pathological or physiological 6  Learning Objectives Explain the role of DNA, RNA, and protein in the central dogma. Name three differences between DNA and RNA Compare and contrast the processes of transcription and translation. Identify the major features of a gene that regulate transcription and define its boundaries. Name two processes that convert a primary RNA transcript into a mature messenger RNA and describe their effects on the transcript. Explain how four different nucleotides can encode twenty different amino acids. 7 Cont… Explain the connection between the central dogma and the relationship between genotype and phenotype. Predict whether a variant is likely to affect RNA levels or protein function based on its genomic location. Classify a protein coding variant as a nonsense, missense, silent, or frameshift variant. Epigenetics Mechanisms 8  Watson and Crick and the Central Dogma In 1940s, two scientists James Watson and Francis Crick worked together on studying the structure of DNA. In 1962 Nobel Prize in Medicine for their discovery of the structure of DNA. Their model served to explain how DNA replicates and how hereditary information is coded on it. This was one of the most significant scientific discoveries of the 20th century. https://www.sciencephoto.com/media/222784/view/watson-and-crick-with-their-dna-model 9  The Central Dogma Genetic information flow: 1) From DNA to DNA (Genome): Genetic information is preserved and transmitted from generation to generation by a duplication process called replication. 2) From DNA to Protein: during its phenotypic expression in an organism. Transcription: DNA to RNA (transcriptome) (sometimes reversible). Translation: RNA to protein (proteome) (irreversible). https://www.carolguze.com/images/biomolecules/centraldogma2.gif 10 DNA & RNA 11 https://ib.bioninja.com.au/standard-level/topic-2-molecular-biology/26-structure-of-dna-and-rna/nucleotides.html  Cont… ▪ Ribose is a single-ring pentose [5- Carbon] sugar. ▪ The numbering of the carbon atoms runs clockwise ▪ Note the absence of the hydroxyl (- OH) group on the 2’ carbon in the deoxy-ribose sugar in DNA as compared with the ribose sugar in RNA. 12 Nitrogenous Base 13 http://loretocollegebiology.weebly.com/dna-structure.html Phosphodiester bond is the covalent bond on the DNA back bone The phosphodiester bond is the linkage between the 3' carbon atom of one sugar molecule and the 5' carbon atom of another. The 3’-end has a free hydroxyl group at the 3’-carbon of a sugar, and the 5’end has phosphate group at the 5’-carbon of a sugar. 14 Hydrogen bonding in DNA The Hydrogen bond inforce hydrophobic bases inside of the helix, whereas the polar exterior is touching the solvent water. Cytosine and Guanine are held together by three hydrogen bonds. Adenine and thymine share two hydrogen bonds Hydrogen bonds are fairly weak, but millions of hydrogen bonds in DNA make it a stable molecule. 15 https://socratic.org/questions/how-do-hydrogen-bonds-contribute-to-the-structure-of-dna Hydrogen bonding in DNA 16  DNA Structure & Genes DNA is double stranded antiparallel. The sides of the ladder are made of alternating sugar and phosphate molecules. The steps of the ladder are pairs of 4 types of nitrogen bases. The two strands are complementary i.e the sequence of one strand can be identified from the other strand The shape of DNA is a double helix, which is like a twisted ladder. 17 https://wikispaces.psu.edu/display/230/DNA+and+Chromosomes DNA Sequence 5’ ATTGCATTCG 3’ 3’ TAACGTAAGC 5’ https://www.chemguide.co.uk/organicprops/aminoacids/dna3.html 18  Transcription Transcription is the first step of gene expression. During this process, the DNA sequence of a gene is copied into mRNA 19 https://www.nature.com/scitable/topicpage/translation-dna-to-mrna-to-protein-393/  Transcription Before transcription can take place, the DNA double helix must unwind near the gene that is getting transcribed. The region of opened-up DNA is called a transcription bubble. Steps: 1. Initation 2. Elongation 3.Termination 4.Post-transcription modification https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into- rna/a/stages-of-transcription 20  Which strand ??? Transcription uses one of the two exposed DNA strands as template strand. The RNA product is complementary to the template strand and is almost identical to the other DNA strand, called the non template (or coding) strand. In RNA, all of the T nucleotides are replaced with U nucleotides. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription 21  Transcription initiation…How transcription start??? To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a region called the promoter. The promoter tells the polymerase where to "sit down" on the DNA and begin transcribing. Each gene has its own promoter. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages- of-transcription 22  Elongation Basically, elongation is the stage when the RNA strand gets longer, by addition of new nucleotides. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription 23  Termination…when to stop transcription??? The termination of transcription Require termination signals https://www.easynotecards.com/notecard_set/74835  Untranslated region Untranslated region (or UTR) are two sections, one on each side of a coding sequence on a strand of mRNA. On the 5' side, it is called the 5' UTR or if it is found on the 3' side, it is called the 3' UTR The 5' and 3' UTRs usually not translated into protein. Within the 5' UTR is a sequence that is recognized by the ribosome which allows the ribosome to bind and initiate translation. The 3' UTR plays a critical role in translation termination https://en.wikipedia.org/wiki/Untranslated_region#/media/File:MRNA_structure.svg 25  Post-transcriptional modification Alternative splicing, or differential splicing, is a regulated process during gene expression that results in a single gene coding for multiple proteins 26 https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription  Translation Translation is a process by which the genetic code contained within an mRNA molecule is decoded to produce the specific sequence of amino acids. 27 Ribosome 28 1) The Met-tRNA that initiates the process is shown already in the P site. The next charged tRNA enter the A site. (2) The Met is cleaved from the tRNA in the P site, and linked by a peptide bond to the amino acid in the A site. (3) The tRNA in the P sites moves to the E site, and the tRNA in the A site with the di-peptide moves to the P site. (4) The uncharged tRNA is released from the E site. 29  Genetic Code There are 61 codons for amino acids Each 3 nucleotide are codons specify an amino acid. Three "stop" codons mark the end of a protein. One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine mRNA codons are read from 5' to 3' , and they specify the order of amino acids in a protein from N-terminus (methionine) to C-terminus. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription 30 Types of RNA Recent research has also revealed the presence of small, single-stranded and double-stranded RNA molecules that play important roles in regulating which genes get expressed. These types of RNA include small interfering RNA (siRNA) and microRNA (miRNA). Epigenetic phenomena are changes in gene expression and chromatin configuration which are independent from DNA sequence, hence genetics. The non genetic influence to gene expression  Epigenome provides instructions and regulates the functional aspects of all the genes Schematic of the mechanisms of epigenetic regulation  Representations of DNA Each human cell contains approximately 2 meters of DNA if stretched end-to- end; yet the nucleus of a human cell, which contains the DNA, is only about 6 μm in diameter. 35  Chromatin Chromatin is a complex of DNA and protein. Its primary function is packaging very long DNA molecules into a more compact, denser shape, which prevents the strands from becoming tangled. https://classconnection.s3.amazonaws.com/478/flashcards/3105478/png/chromatin- 1414CCB24AD4DE4B71E.png 36  Chromatin Chromosomal material extracted from nuclei of eukaryotic cells Consists of: 1- Very long double stranded DNA molecule (2 m long) 2- Proteins involved in folding/packing eukaryotic chromosomes and consists of: A- Histone proteins: basic proteins (positively charged) B- Non-histone proteins: regulatory proteins including enzymes & regulatory factors of transcription. https://classconnection.s3.amazonaws.com/478/flashcards/3105478/png/chromatin- 1414CCB24AD4DE4B71E.png 37  Histones Histones These small proteins are positively charged at physiologic PH as a result of their high content of lysine and arginine (+vely charged) so they form ionic bonds with negatively charged phosphate group in DNA 38 https://www.ncbi.nlm.nih.gov/books/NBK26834/figure/A632/?report=objectonly Histone Modifications  GENE ACTIVATION (Epigenetics) In addition, METHYLATION of certain regions of a gene can TURN OFF or SILENCE that gene. DEMETHYLATING the region can ACTIVATE that gene & lead to the production of the protein for which it codes. 40  RNA Interference (RNAi) RNAi: 21-25 nt fragments, which bind to the complementary portion of the target mRNA and tag it for degradation 41 Human genome The human genome is the genome of Homo sapiens. The total genetic material of an organism. The genome includes both the genes and the non-coding sequences of the DNA/RNA. It is made up of 23 chromosome pairs with a total of about 3 billion DNA base pairs. Human Genome Project estimated that humans have between 20,000 and 25,000 genes. Chromosome Elongate cellular structure composed of DNA and protein - they are the vehicles which carry DNA in cells. Human genome Homologous chromosomes Chromosomes of the same size and shape which carry the same type of genes. Homologous chromosomes Somatic cell All body cells except reproductive cells. Gamete Reproductive cells (i.e. Sperm & eggs). Human genome There are 24 distinct human chromosomes: 22 autosomal chromosomes, plus the sex-determining X and Y chromosomes. Somatic cells usually have one copy of chromosomes 1-22 from each parent, plus an X chromosome from the mother, and either an X or Y chromosome from the father, for a total of 46. Each sperm and egg has 23 chromosomes where one of them is the sex chromosome. Diploid (2n) Cellular condition where each chromosome type is represented by two homologous chromosomes. Haploid Cellular condition where each chromosome type is represented by only one chromosome.  Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA Phenotypes Genotype Genotype GCCAAGAATGGCTCCCACC ATGTTTCCACCTTCAGGTTCC T ACTGGGCTGATTCCCCCCTC GGCTCTCAGACATTCCCCT C GGTCCAACCCCCAGGCCAT CACTTTCAAGCTCGGCCCCT CAAGATGTCTCAGAGAGGC T GGCTAGACACCCAGAGACC TCAACTCAGAGAGGCGGCTA TCAAGTGACCATGTGGGAA GACACCCAGAGACCTCAAGT CGGGATGTTTCCAGTGACA GACCATGTGGGAACGGGATG GGCA TTTCCAGTGACAGGCAG  CELL CYCLE A sequence of stages that a cell goes through during its lifetime. The cell cycle is divided into TWO parts: - Interphase ( G0,G1,S and G2) - Mitosis. 52  CELL CYCLE A sequence of stages that a cell goes through during its lifetime. During embryogenesis → ALL cells go through ALL stages as do adult cells that continue to reproduce. The RATE at which a cell goes through its cycle DEPENDS ON the given cell & the growth factors, hormones, & chemicals to which it is exposed. Intrinsic rate can be increased or decreased by internal & external cues. BRAKES on cell cycle may include proteins synthesized by cells in response to activation of certain REGULATOR GENES, including the tumor suppressor genes. After Embryogenesis, Some Cells that DO NOT continue to reproduce, remain in a resting stage (Go) → May stay indefinitely. 53  CELL CYCLE 1- INTERPHASE (a lengthy 10 - 22 hour process): Not actively dividing cells - THREE standard stages (G1, S, & G2) - a 4th stage, G0 = resting stage (a cell may stay indefinitely). G stands for Gap (time period that the cell uses to check & recheck the preceding steps). A cell will be stimulated to progress through G1 stage when certain genes, including PROTO-ONCOGENES, are activated. Genes that are activated at G2 stage to STOP the progression of the cell through its cycle → TUMOR SUPPRESSOR GENES. 54  CELL CYCLE 2- MITOSIS (M stage): Stage of cell division (lasts approximately 1 hour). Replicated cell splits into two daughter cells each contains 23 pairs of chromosomes. Consists of 4 Substages (prophase, metaphase, anaphase, & telophase). External cues that stimulate cell cycle include neural or hormonal stimulation, or may come from cell products released in response to tissue injury & activation of the inflammatory & immune systems. Uncontrollable cell growth & CANCER may occur with the destruction or inactivation of regulator genes OR by excessive stimulation & activation of proto-oncogenes. 55  MEIOSIS It is the process during which germ cells of the ovary (primary oocytes) or testicle (primary spermatocytes) give rise to MATURE eggs or sperms. It involves DNA replication, followed by 2 cell divisions, which results in 4 daughter cells, each with 23 (unpaired haploid) chromosomes. During fertilization, genetic information contained in both the egg & sperm are joined → this results in an embryo with a total of 46 (23 paired diploid) chromosomes. 56 Mutation If a MISTAKE is: IDENTIFIED: proof-reading or other enzymes remove & correct it, OR the cell may initiate its own death (APOPTOSIS). IDENTIFIED BUT NOT REPAIRED & the cell DOES NOT UNDERGO APOPTOSIS → a mutation will exist. 57 Mutations Mutation = change(s) in the nucleotide/base sequence of DNA; may occur due to errors in DNA replication or due to the impacts of chemicals or radiation to the DNA molecule Mutation may result in coding sequences for new amino acids in proteins or not! 58 Point mutation Point mutations are the most common type of mutation. A single point mutation, also called a base substitution, occurs when a single nucleotide is replaced with a different nucleotide. There are three types of point mutations: Silent mutation Missense mutation Nonsense muation 59 Results of point mutations Silent mutations Causes no change in the activity of the protein Because the genetic code is degenerate (most amino acids are coded for by several alternative codons), the resulting new codon may still code for the same amino acid. 60 Results of point mutations Missense mutations = produces Nonsense mutations = produces a change in amino acid in protein but STOP codon in the midst of the does not change the function of the mRNA transcript; can produce a non- protein functional protein 61 Thanks 62