Lecture 1_Prokarytic Cell & Central Dogma.pdf

Microbial Genetics BI 302 Prof. Nalina Nadarajah Centennial College Lecture 1: Prokaryotic Cell & Central Dogma of Molecular Biology Image Attribution: Generated with DALL-E in ChatGPT-4o Agenda for This Week Prokaryotic Cell Central Dogma of Molecular B...

Microbial Genetics BI 302 Prof. Nalina Nadarajah Centennial College Lecture 1: Prokaryotic Cell & Central Dogma of Molecular Biology Image Attribution: Generated with DALL-E in ChatGPT-4o Agenda for This Week Prokaryotic Cell Central Dogma of Molecular Biology – DNA Replication – Transcription – Translation Image Attribution: Dhorspool at en.wikipedia, CC BY-SA 3.0, via Wikimedia Commons Prokaryotic Cell Image Attribution: CNX OpenStax, CC BY 4.0, via Wikimedia Commons Prokaryotes are divided into 2 groups: Bacteria & Archaea Image Attribution: CNX OpenStax, CC BY 4.0, via Wikimedia Commons DNA is the Hereditary Molecule of Life carrying genetic info from parents to offsprings found in a stable form in chromosomes in nucleus complex enough to store all the information needed for an organism’s development replicate accurately so that daughter cells contain the same info as parent cells Mutable → foundation for evolutionary change Image Attribution: https://www.rawpixel.com/image/3338043 CC0 1.0 Universal CC0 1.0 Deed Potential Candidates for Hereditary Material DNA? RNA? Proteins? Lipids? Carbohydrates? The Transformation Factor In 1928, Frederick Griffith identified two strains of Pneumococcus: - S: considered virulent, bears a capsule, which is a slippery Frederick Griffith polysaccharide coat; caused fatal Image Attribution: courtesy Dr. Maclyn McCarty, contributed by Dr. Steven Lehrer pneumonia in mice - R: lacking a capsule; considered avirulent; did not cause pneumonia Griffith’s Transformation Experiment (1928) Something in the virulent S type dead cells transformed the avirulent R cells Biochemical tests of heat-killed S extract showed mainly DNA, with small amounts of RNA, protein, lipids, and polysaccharides Additional tests were needed to identify the transforming material Image Attribution: Madeleine Price Ball Madeleine (talk) CC BY-SA 3.0 Avery, MacLeod & McCarty’s Experiment (1944) Image Attribution: https://www.timetoast.com/timelines/dna-timeline--39 Image Attribution: Pearson Education Inc. 2012. Genetics Analysis – An Integrated Approach  Hershey & Chase’s Experiment (1952) Hershey & Chase showed DNA is responsible for bacteriophage infection of host bacterial cells Proteins contain large amounts of sulphur but almost no phosphorus DNA contains large amounts of phosphorus but no sulphur Hershey & Chase separately labeled either phage proteins with 35S or DNA with 32P and then traced them in the course of infection  Hershey & Chase’s Experiment (1952) » Phage DNA, not protein, is responsible for infecting the bacteria Image Attribution: The original uploader was Adenosine at English Wikipedia., CC BY-SA 2.5, via Wikimedia Commons DNA Structure – Nitrogen Bases It is a polynucleotide consisting of four repeating subunits, adenine (A), thymine (T), cytosine (C), and guanine (G), held together by covalent bonds Image Attribution: Boris, CC0, via Wikimedia Commons Image Attribution: Blausen, CC BY-SA 4.0, via Wikimedia Commons DNA Nucleotides A DNA nucleotide is composed of a sugar, one of four N bases, and up to three PO43- groups Deoxyribose: the sugar of DNA nucleotides - five carbon pentose sugar An N-base is attached to the 1 carbon, an OH group is attached to the 3 carbon & one to three PO43- are attached to the 5 carbon Image Attribution: OpenStax, CC BY 4.0, via Wikimedia Commons Complementary DNA Nucleotide Pairing » The two polynucleotide chains of a double helix form a stable structure with three rules: 1. The bases of one strand are complementary to the bases in the corresponding strand combining one purine with one pyrimidine 2. Two H bonds form between A & T; three H bonds form between G & C 3. The two strands are antiparallel with respect to their 5′ and 3′ ends Image Attribution: Francescakb, CC BY-SA 4.0, via Wikimedia Commons Elucidation of the DNA Structure » Structure had to fulfill ‘hereditary molecule’ prerequisites: – ability to store information – ability to replicate – ability to mutate Image Attribution: https://scarc.library.oregonstate.edu/coll/pauling/dna/papers/corr68.11-reprint-19530425-01-large.html Discovery of the Structure of DNA Crick and Watson Maurice Wilkins Rosalind Franklin Erwin Chargaff 1962 Nobel Prize Winners The original DNA model "Photograph 51” - X-ray by Watson and Crick diffraction photo of a DNA molecule  Roles of DNA Information: specified by sequence of nucleotides; may be copied into RNA, eventually deciphered into proteins (instructions required to form organisms) Replication: each strand serves as template for synthesis of complement, using rules of base pairing Mutation: replacement, insertion, deletion of nucleotide results in altered sequence ---> Evolution  Genes Genes are region of DNA that encodes for a functional RNA molecule, mostly mRNA Gene is functional part of chromosome transcribed into RNA at the correct time & place in development or cell cycle Gene includes its adjacent regulatory region(s) In prokaryotes, genes are often tandemly arranged, with little or no spacer sequences in between In eukaryotes, there is considerable spacer DNA (introns) between genes Image Attribution: © 2002 by W. H. Freeman and Company  Prokaryotic Genome Many contain a single circular (double helix) chromosome Prokaryotic chromosomes are condensed in the nucleoid via DNA supercoiling Prokaryotes contain only one copy of each gene (haploid) Nonessential genes are encoded on extrachromosomal plasmids Genes are close together with little intergenic spacer - introns are extremely rare Most prokaryotic genomes contain polycistronic operons (clusters of more than one coding region attached to a single promoter) separated by only a few base pairs The Central Dogma of Molecular Biology 1. Replication 2. Transcription 3. Translation Image Attribution: Alanna MacGregor © August 1996, Microbial Ecology Lab, Acadia University  DNA Replication in Prokaryotes Bacteria reproduce by binary fission – one cell divides to give two identical daughter cells 20  Three Competing Models of Replication Semiconservative DNA replication: each daughter duplex contains one parental and one daughter strand Conservative DNA replication: one daughter duplex contains both parental strands and the other contains both daughter strands Dispersive DNA replication: Each daughter duplex contains interspersed parental and daughter segments Three Competing Models of Replication Image Attribution: © 2012 Pearson Education Inc. Genetics Analysis - An Integrated Approach  The Meselson-Stahl Experiment In 1958, Meselson and Stahl used CsCl centrifugation to test the models of DNA replication Grew E. coli in a medium containing heavy nitrogen (15N) for many generations Once all the bacterial cells in the culture had DNA containing only 15N, they transferred the bacteria to medium containing 14N After each round of replication, the DNA of an aliquot of cells was isolated and centrifuged to determine its density The Meselson- Stahl Experiment Image Attribution: © 2012 Pearson Education Inc. Genetics Analysis - An Integrated Approach  The Meselson-Stahl Experiment – CsCl Centrifugation CsCl centrifugation banding pattern proved that mode of DNA replication is semi- conservative Image Attribution: By LadyofHats - did myself based on the information in wikipedia plus the following websites:, , , , and , Public Domain, https://commons.wikimedia.org/w/index.php?curid=4804985  Attributes of DNA Replication Shared by All Organisms Each strand of the parental DNA molecule remains intact during replication Each parental strand serves as a template for formation of an antiparallel, complementary daughter strand Completion of replication results in the formation of two identical daughter duplexes composed of one parental and one daughter strand  Three Phases of Replication 1. Initiation 2. Elongation 3. Termination  Initiation Bacterial chromosomes have a fixed origin of replication (ori) The start of localized unwinding of the duplex at a specific site (the origin) In E. coli origin (oriC) is 245 bp long – recognizes initiation protein DnaA along with DnaB and DnaC (complex known as helicase, which breaks down H bonds) – helicase unwinds DNA further producing “replication fork” 31 Fig. 4-4 from Modern Genetic  Bidirectional Replication As the DNA unwinds, two replication forks (arrows) move away from the origin, forming a replication bubble The forks merge as DNA replication is completed at a termination region (ter), reproducing one replicon Modern Microbial Genetics, Second Edition. Edited by Uldis N. Streips, 32 Ronald E. Yasbin © 2002  Elongation Process involves elongation of DNA from the initiation site bubble Polymerase enzymes involved are DNA polymerases I and III – DNA polymerase is NOT capable of starting a DNA chain de novo; it can only extend a chain already initiated – RNA primer synthesized by primase enzyme in primosomes – nucleotide addition by DNA polymerase III is always at 3’ end, but in opposite directions – only ONE of the two anti-parallel strands can serve as the template (leading strand) in the direction of the replication fork 33  Elongation Cont. every Okazaki fragment needs its own RNA primer only one initial RNA primer needed Okazaki fragment: a small segment of single stranded DNA synthesized as part of lagging strand 34  Elongation in Lagging Strand Cont. RNA primers are synthesized by primosomes DNA polymerase I replaces RNA primers with DNA DNA ligase joins the 3’ end of the gap-filling DNA to the 5’ end of the downstream Okazaki fragment 35  Termination Termination occurs at ter sites approximately 180° from the initiation site (ori) Involves inhibition of replication forks (inhibiting helicases) and separation of completed chromosomes 36  Animation 37 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  DNA Proofreading DNA replication is very accurate, mainly because DNA polymerases undertake DNA proofreading, to correct occasional errors Errors in replication occur about one in 100 million nucleotides in E. coli Proofreading ability of DNA polymerase enzymes is due to a 3 to 5 exonuclease activity 38 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  DNA Polymerase Proof Reading Animation 39 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  Transcription Once the structure of DNA was known, researchers began to investigate how information from DNA directed protein synthesis RNA transcripts carry the messages of genes 40 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  RNA Nucleotides and Structure RNA ribonucleotides are composed of a sugar, nucleotide base, and one or more phosphate groups, with two critical differences compared to DNA nucleotides – The bases adenine, guanine, and cytosine are the same, but thymine is replaced by uracil (same purines; one different pyrimidine) – The sugar ribose is used rather than deoxyribose RNA is synthesized from a DNA template using complementary base pairing (A with U and C with G) RNA polymerase catalyzes the addition of each ribonucleotide to the 3′ end of the new strand 41 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  RNA Classification 3 types:mRNA, tRNA and rRNA Messenger RNA (mRNA) is produced by protein- encoding genes and is a short-lived intermediary between DNA and protein – it is the only type of RNA that undergoes translation Functional RNAs do not encode proteins, but instead perform functional roles in the cell – transfer RNAs (tRNAs) are responsible for binding an amino acid and depositing it for inclusion into a growing protein chain – ribosomal RNA (rRNA) combines with numerous proteins to form ribosomes 42 Genetics Analysis: An Integrated Approach Copyright © 2012 Pearson Education Inc.  Transcription Transcription: synthesis of mRNA from DNA template RNA polymerase – single RNA polymerase in prokaryotes – locally unwinds DNA – uses one DNA strand as template same strand for a given gene 43 Chapter 3: Gene function © 2002 by W. H. Freeman and Company  Transcription Cont. – adds free nucleotides to growing RNA strand at 3’ end DNA template read from 3’ to 5’ 5’ to 3’ mRNA synthesis uses rules of base pairing to synthesize complementary RNA molecule – What can you conclude about the sequence of the transcript? Transcript is identical in sequence to non-template strand, except T’s replaced by U’s Chapter 3: Gene function © 2002 by W. H. Freeman and Company 44  Essential Steps of Transcription in E. coli 1. Promoter recognition 2. Transcription initiation 3. Chain elongation 4. Chain termination 45  Bacterial RNA Polymerase A single type of RNA polymerase catalyzes transcription of all RNAs in E. coli 1. Bacterial Promoter Recognition A promoter is a double-stranded DNA sequence that is the RNA polymerase binding site Required for the initiation of transcription The promoter is located a short distance upstream of the coding sequence, within a few nucleotides of +1 RNA polymerase is attracted to promoters by the presence of consensus sequences 46 47  Transcription Steps 2. Initiation – at 3’ end of gene – binding of RNA polymerase to promoter – unwinding of DNA at the beginning of the gene 48 Chapter 3: Gene function © 2002 by W. H. Freeman and Company 3. Elongation – addition of nucleotides ONLY to 3’ end like DNA, RNA must be synthesized in the 5' to 3' direction – complementary base pairing based on the exposed DNA template – RNA polymerase joins the ribonucleotides to form an mRNA strand – as RNA polymerase advances, the process continues – when the DNA that has been transcribed, re-winds to form a double helix 49  Elongation Diagram Transcription of 2 genes in opposite directions 50 Chapter 3: Gene function © 2002 by W. H. Freeman and Company  4. Termination – at 3’ end of transcript – terminated beyond protein coding segment 3’ UTR 5’UTR coding region 3’UTR – occurs when RNA Pol recognizes specific signals – 40 bp long GC rich sequence followed by > 6 A’s forms a hairpin loop, followed by terminal run of U’s serves as signal for release of RNA pol & termination of transcription Transcription Animation Chapter 3: Gene function © 2002 by W. H. Fig. 3-10 51 Freeman and Company  Protein Structure Protein is polymer of amino acids (polypeptide) – each amino acid has R group conferring unique properties – amino acids connected by peptide bond – each polypeptide has amino end and carboxyl end Structures – primary: amino acid sequence 52  Protein Structure – secondary: hydrogen bonding, -helix and -sheet – tertiary: folding of secondary structure – quaternary: two/ more tertiary structures joined by weak bond Tertiary Structure Secondary Structure 73 53 Photo Source: Text, Pearson Quaternary Structure  Translation Overview The process by which mRNA is converted to the amino acid sequence of a polypeptide In bacteria, this process takes place in the cytoplasm In the first step of the process, all the components needed for translation come together – these components include mRNA, tRNA and ribosomal units 54  Role of mRNA in Translation mRNA is the product of transcription – it is a single-strand of ribonucleotides that is complementary to its gene template The purpose of mRNA is to carry the genetic code from DNA to the ribosome for translation mRNA is read in a series of triplets called codons – e.g. mRNA sequence AUG AAG CAC UAC has four codons – each codon corresponds to one amino acid – AUG codes for the amino acid Met (also START codon), AAG codes for Lys, CAC codes for His and UAC codes for Tyr – the dictionary of the genetic code tells us which of the 20 amino acids that a codon designates 55  The Genetic Code 4 x 4 x 4 = 64 possible codons Redundant/ degenerate - most aa are signalled by several different codons – e.g. the amino acid Leu is coded for by six different codons – genetic code contains 3 codons to signal STOP – AUG signals codes for Met but also signals START 56  Example: Protein Translation Given mRNA: UAAUGCUAGACGUGUUCUAGGA ▪ Scan the transcript and find the start codon (AUG) → that’s the point where translation begins UAAUGCUAGACGUGUUCUAGGA ▪ From there, read the 3 letter codons and find the corresponding aminoacid from the Genetic Code until you encounter a STOP codon UA AUG CUA GAC GUG UUC UAG GA Met Leu Asp Val Phe STOP 57  Role of tRNA in Translation transfer RNA (tRNA) is a single strand of 80 ribonucleotides It assumes a cloverleaf configuration because of interactions between the nitrogenous bases It functions as an interpreter between nucleic acid and peptide sequences by picking up amino acids and matching them to the proper codons in mRNA 58 Structure of tRNA (e.g. Alanine tRNA) – clover leaf shape – middle loop carries the Anticodon complementary to mRNA codon bind by RNA-RNA base pairing – amino acid attaches to the 3’ end of tRNA molecule – the proper amino acid is joined to tRNA by the enzyme aminoacyl-tRNA synthetase Chapter 3: Gene function © 2002 by W. H. 59  tRNA Wobble Hypothesis – some tRNAs recognize more than one codon due to relaxation of the complementation rule of base pairing between the anticodon and codon in the third position – this relaxation is called the Wobble Chapter 3: Gene function © 2002 by W. H. I = inosine, a rare base found in tRNA 60 Freeman and Company (in anticodon) Role of Ribosome & rRNA in Translation Prokaryotic Ribosome – 20 nm in diameter – composed of 65% ribosomal RNA and 35% ribosomal proteins (ribonucleoprotein or RNP) – large subunit (contains 23 S and 5 S rRNA) – small subunit (contains 16S rRNA) 61 Chapter 3: Gene function © 2002 by W. H. Freeman and Company  Stages of Translation Initiation – ribosome recognition prokaryotes: mRNA Shine-Delgarno sequence which hydrogen bonds with rRNA – helps recruit ribosome to mRNA to initiate protein synthesis by aligning it with 3’ end of 16S rRNA (next to initiation codon) – tRNAMeti (initiator) binds to AUG (START) codon – a formyl group is added to Met while attached to the initiator, making N-formylmethionine (fMet) – formyl group is later removed Elongation: use of elongation factors (proteins) – guide binding and movement of tRNAs and ribosome Termination – ribosome pauses at stop codon (nonsense codons) – release factor binds, polypeptide released, ribosome complex dissociates 62  3 tRNA binding sites on ribosome – A site (aminoacyl site), accepts incoming charged tRNA – P site (peptidyl site), peptide bond – E site (exit site) Amino terminus synthesized first, beginning near 5’ end of mRNA Free End Growing End 63 Chapter 3: Gene function © 2002 by