Zoology Modules Lecture Notes PDF

Introduction You are about to start learning about the science of life, i.e. Biology, and then later on the course, you will focus on the study of animals, i.e. Zoology. A good way to start your study of biology is to focus for a moment on life. This is not a simple question as it appears, mainly be...

Introduction You are about to start learning about the science of life, i.e. Biology, and then later on the course, you will focus on the study of animals, i.e. Zoology. A good way to start your study of biology is to focus for a moment on life. This is not a simple question as it appears, mainly because life itself is not a simple concept. Living organisms are manifestations of life. They exhibit certain general properties that we recognize as the definition of life. Organisms are built by assembling large molecules, much as a house is assembled from building blocks. Some of the building blocks are long chains of similar units joined in a row. Among these that make up the bodies of organisms are carbohydrates and lipids (molecules that give us energy), proteins (molecules that speed up specific chemical reactions), and nucleic acids (molecules in which hereditary information is stored). Theories on the Origin of Life As we have already discovered, biology is the science of life. But exactly what is the origin of life? That is a hard question to answer. Until now, we are not really certain where life came from. There are still several theories about its origin. Below are just some of them. Divine Creation Theory Life is believed to have been created by the Almighty God, based on the book of Genesis of the Holy Bible. As Christians, we believed that God created all living things. Cosmozoic or Interplanetary Theory Life is believed to have been originated from protoplasm in the form of a resistant spore coming from outer planets propelled by radiation pressure. The spore reached the Earth and started the first form of life. This theory was put forward by Richter (1865) and strongly supported by Arrhenius (1908). No scientific experiment were given to support the theory, as a result, the hypothesis did not receive much attention. Abiogenesis or Spontaneous Generation Theory Life is believed to have been originated spontaneously from non-living materials. This theory was first comprehensively postulated by Aristotle in his book “On the Generation of Animals” around 350 BC. He explained that organisms such as rats, flies and maggots suddenly emerged from rotting meat, hay and other decomposable items. The theory suggests that organisms do not descend from a parent organism and only require that certain conditions in their environment be fulfilled in order for creation to occur. This theory was disproved by Francesco Redi, an Italian scientist in 1668, and by Louis Pasteur, a French chemist in 1865. Chemical Evolution of Life Theory (Oparin-Haldane Hypothesis and Miller-Urey Experiment) Life is believed to have been appeared in the warm, primitive ocean and was heterotrophic rather than autotrophic. Aleksandr Oparin, a Russian biochemist, proposed this theory in 1924 suspecting that life on Earth was developed through gradual chemical evolution of carbon-based molecules in a “primodial soup”. At just about the same time, British biologist, J. B. S. Haldane, independently proposed a similar theory. Both believed that organic molecules could be formed from non-living materials in the presence of an external energy source, such as UV radiation and that the primitive atmosphere was reducing, having very low amounts of free oxygen, with ammonia and water vapor, among other gases. This theory was tested by American chemists, Harold Urey and Stanley Miller, in 1953. In what became known as the Miller-Urey experiment, they successfully produced organic molecules, including amino acids, from some of the inorganic components thought to have been present on primitive Earth such as a mixture of four gases, water vapor, methane, ammonia, and molecular hydrogen. Image source: https://study.com/academy/lesson/8-characteristics-of-life-in-biology.html Image source: https://www.tes.com/lessons/g6jxxNX1GdTbnw/14-matter-mixtures-solutions Image source: https://study.com/academy/lesson/what-are-inorganic-compounds-definition-characteristics-examples.html More on Inorganic compounds :) Image source: https://saylordotorg.github.io/text_general-chemistry-principles-patterns-and-applications-v1.0/s28-organic- compounds.html More on organic compounds :) Hi. Since we did not discuss the nucleic acids, it is a great help if you will view this before taking the quiz. Please remember these points. 1. The two strands of a DNA have complementary base pairs so that Adenine (A) would always with Thymine (T) and Guanine (G) with Cytosine (C). This is because 2 hydrogen bonds link A and T while 3 H bonds link G and C. Because of these H bonds, there is a strict pairing between the bases (A=T; C=G). Take note of the example below: DNA strand 1 sequence: ATCGGCAACTCGATAGTCATT  DNA strand 2 sequence: TAGCCGTTGAGCTATCAGTAA Note: the bases are strictly paired 2. Prior to protein synthesis, a gene in the DNA is transcribed to become an mRNA Hypothetical gene: TAGCCGTTGAGCTATCAGTAA mRNA: AUCGGCAACUCGAUAGUCAUU Note: Adenine is replaced with Uracil (U) in an mRNA 3. The mRNA now is used as a template in protein synthesis (translation). Please see video.