Untitled Document PDF

Match the Evolutionary Mechanism: In the following list of scenarios, what do you think is most likely to be responsible for the trait in the population: natural selection or genetic drift? a) The bright coloration of a poisonous snake, where coloration is unrelated to mating success: ______________...

Match the Evolutionary Mechanism: In the following list of scenarios, what do you think is most likely to be responsible for the trait in the population: natural selection or genetic drift? a) The bright coloration of a poisonous snake, where coloration is unrelated to mating success: ___________________ b) Albino coloration in a small, isolated population of the endangered kangaroo rat: ___________________ c) The production of increasingly large, sweet fruits by a tree: ___________________ d) A small, isolated population of indigenous people in a remote tropic forest, where all have the same blood type: ___________________ INTRODUCTION: Charles Darwin wrote about evolution before we knew anything about mutations or inheritance. The modern version of evolution incorporates what we have since learned about genetics. Today, we define evolution as a change in allele frequencies within a population over time. When evolution is studied at the level of population changes from one generation to the next, it is sometimes referred to as microevolution, because this is the smallest scale at which evolution can happen. As these generational changes accumulate over longer periods of time, isolated populations may diverge and give rise to new species. Such broad patterns of change are sometimes called “macroevolution”. In other words, macroevolutionary patterns of change results from the accumulated effects of microevolution. A population is defined as a group of individuals of the same species that live in the same area and potentially interbreed. In most populations, individuals have obvious, and not so obvious, differences in traits. For genetically determined traits in sexually reproducing species, the sources of this variation are mutation, independent assortment of chromosomes during gamete formation, crossing-over (also during gamete formation), and random fertilization. We can characterize the genetic make-up of an entire population by describing its gene pool, which consists of all the alleles (variations) for all the genes of all the individuals in that population. However, the gene pool will not remain constant over time. For a particular gene of interest, we can calculate the frequency of each existing allele at different time intervals. In doing so, we can track changes in allele frequencies to document evolution and learn something about the underlying mechanisms causing change. Mutation, migration, natural selection, and genetic drift are all mechanisms that lead to evolution; in other words, they are possible reasons for the allele frequencies within a population to change from one generation to the next. Darwin’s hypothesis (now a theory) for how populations evolve introduced natural selection as the mechanism for change. Natural selection occurs when there is genetic variation among individuals within a population and individuals with different heritable traits experience different degrees of reproductive success. In this process, alleles that make an individual better able to survive and reproduce are “selected for” – and thus they become more common in the population over time. Alleles that are detrimental to an individual’s survival and reproductive success are “selected against” – e.g., individuals that are not as good at finding food, shelter, mates, etc. do not pass on as many copies of their genes to future generations compared to the more “fit” individuals, because they do not have as many offspring. This process leads to predictable evolutionary change in the traits of a population. You have probably heard the phrase "survival of the fittest” in the context of natural selection, but that phrase did not originate with Darwin, and it misinterprets Darwin’s meaning of the word “fitness.” Fitness, in biological terms, is a measure of reproductive success and is defined as the number of surviving offspring an individual produces; it represents their contribution to the next generation. You may also be familiar with the term artificial selection. In artificial selection, humans directly choose which traits (and underlying alleles) they want in a population and then selectively breed the individuals with those traits. In natural selection, environmental factors determine which traits are more likely to get passed on to future generations. There are many examples of artificial selection, especially if we think of the success in breeding dogs, most livestock (like horses and cattle), or many kinds of plants to suit our purposes. Natural selection and artificial selection are both straightforward concepts, although natural selection is sometimes harder to imagine than artificial selection due to natural environments being much less homogenous than cultivated environments. This can make it more difficult to appreciate how the process of natural selection leads to adaptation, in which populations become better suited to their current environment. Heritable traits that are favorable in a particular environment and lead to better survival and reproductive success (called adaptations, n.) will increase in frequency in subsequent generations. Over time, this leads to a population that is overall better suited (aka, adapted) to that environment. Camouflage, or “cryptic coloration,” is an example of an adaptation that helps many animals survive to reproduce. While a change in allele frequencies due to natural selection is driven by selective pressures that favor some traits over others, genetic drift is a random change in allele frequencies in a population due to chance events. Because genetic drift is a random process, it does not result in adaptive evolution, and “good” and “bad” alleles (in terms of the fitness they confer) have an equal chance of becoming more common in the next generation. The smaller the population is the more likely this random sampling of alleles is to bring about significant changes in the gene pool of that population, sometimes resulting in the complete loss of alleles. For example, if a diploid individual is accidentally killed by a falling tree, the loss of those two alleles is more likely to alter overall allele frequencies in a population of ten individuals than in a population of one Hundred. Gel Electrophoresis and Forensics Criminology. While the use of molecular biology in crime labs is not biotechnology per se, it is certainly an area where genetic tools are being used. DNA profiling (formerly referred to as DNA “fingerprinting”) is a widely used technique that is based on the fact that every human (and other sexually reproducing organisms) has a unique combination of DNA base pairs, thanks to crossing over during meiosis as well as new mutations in DNA sequences. When a sample of DNA is “cut” (i.e., chemical bonds are broken) into small fragments using one or more restriction enzymes, the resulting pattern of pieces forms a unique profile, or “fingerprint”, for that individual. DNA can be a powerful source of evidence both for convicting and for exonerating criminal suspects. To manipulate DNA and identify fragments to work with, geneticists first conduct a restriction digest. A restriction digest uses special enzymes called restriction enzymes that cut DNA at specific points along the molecule identified by the order of the nucleotide bases. For example, the restriction enzyme called BamH1 cuts DNA at the base pair sequence “GGATCC” wherever it appears in the genome. It cuts a strand of DNA by breaking the covalent bond between the two adjacent G nucleotides. Because the restriction site sequence is a palindrome (reads the same forward on one strand and backward on the complimentary strand), the cut is staggered. Once both strands are cut, the few hydrogen bonds located between the two restriction sites are not strong enough to hold the DNA molecule together. In this way, restriction digests chop the DNA into small pieces. Example: BamH1 will cut this piece of DNA as follows: ↓ DNA Strand: CGTCGGATCCAGGATAGGCTCTA GCAGCCTAGGTCCTATCCGAGAT ↑ After restriction digest with this enzyme, the following two fragments of DNA will be generated: CGTCG GATCCAGGATAGGCTCTA GCAGCCTAG GTCCTATCCGAGAT Because everyone’s genetic makeup is different, when any two people’s DNA is exposed to the same restriction enzyme, a different number of DNA fragments of different lengths may be generated (except in the case of identical twins). After the digest is complete, you need to separate the DNA fragments so that you can produce a DNA profile. The way DNA fragments are separated is through electrophoresis, or the movement (“phoresis”) of charged molecules through an electric field (“electro”). DNA is negatively charged, due to the many phosphate groups in its backbone. When placed in an electric field, DNA fragments will move toward the positive pole of the field, with fragments of different sizes moving at different rates through a porous gel. Small fragments move faster than large ones, and medium-sized ones travel at speeds in between. Researchers capitalize on this difference in migration rate to separate DNA fragments of different sizes from each other. The pattern that results is the DNA profile. The more restriction enzymes that are used, the more discerning a DNA profile will be. However, it is still easier to exclude a person as a possible match (i.e., easier to exonerate than convict based on DNA profiling). Keep in mind that forensic DNA is just one piece of evidence, and investigators still need multiple lines of evidence that tell a consistent story. PART 1 EXERCISE Gel Electrophoresis Scenario: You are attempting to solve a crime in which a person was robbed at an ATM machine. There was a struggle and blood was left at the scene. A witness saw a a person flees the area, and two possible suspects have been identified. You have been able to obtain the assailant’s DNA by collecting blood samples from the crime scene (this is your DNA evidence). You also have a DNA sample from the victim, and DNA samples from the two suspects. To process the evidence, you will be working with three others at your lab station (i.e., one set of DNA samples will be loaded by each table of students). Each of you will be assigned one of the four DNA samples to load into the electrophoresis gel. You will be provided with the following materials: Human Genetics In 1866, Gregor Mendel presented the results of his experiments on the inheritance of traits in the garden pea. Unfortunately, Mendel’s results were not understood by his audience at the time. Almost 150 years later, however, most biologists now take the importance of Mendel’s work for granted. Recent advances in molecular genetics and genetic engineering techniques have allowed the “test-tube” production of products such as insulin, human growth hormone, bovine growth hormones, tomatoes that resist rotting, cloned animals, and plants and cats that glow in the dark. These technological advances have been controversial in many cases, and in the future, you will be expected to make decisions about issues related to biotechnology applications. To make an educated judgment, you must thoroughly understand the mechanisms of genetics (and evolution!). The genetics problems in this exercise will help get you started. Every sexually reproducing organism has at least two units of genetic information for most traits – one from the maternal parent and one from the paternal parent; these bits of information are genes. Recall from your reading that most eukaryotic organisms are diploid; i.e., they contain pairs of homologous chromosomes, one member of each pair coming from each parent. Since there are at least two different versions of most genes, a new word is needed to distinguish them from the concept of a “gene” – that word is allele. So, except for individuals who inherit an X and a Y sex chromosome, humans have at least two alleles for each gene – one on the maternal chromosome and the other on the (homologous) paternal chromosome. A good analogy to this lies in chemistry: alleles are to genes as isotopes are to elements – different versions of the same thing. And to continue the analogy; just as elements can have one, two, three, or more isotopes, genes can have one, two, or three or more alleles. Different alleles code for slightly different products, which result in varying expression of traits within a population. For example, the alleles that code for blue eye color and those that code for brown eye color result in different pigments produced in the iris of human eyes. Those different pigments are coded for by different eye pigment alleles. ABO blood types Human blood is made up of approximately 55% plasma (which, itself is 90% water) and 45% cells. The most numerous blood cell type is the red blood cell, which transports oxygen from the lungs throughout the body. Like other cells, the cell membranes of red blood cells have molecules embedded in the phospholipid bilayer. Some of these molecules, called antigens, project from the surface and allow the immune system to recognize cells as either a normal component of an individual’s blood or as something foreign. The ABO blood types result from the presence or absence of two antigens, A and B, on the surface of red blood cells. The immune system produces antibodies in the blood plasma for the antigens not normally present in an individual. For example, Type A blood has the A antigen on its red blood cells and anti-B antibodies in the plasma. When antibodies detect a foreign antigen (“anti-body gen-erator”), they will initiate the destruction of foreign cells through a process called agglutination (clumping). In the case of human ABO blood types (phenotypes), the antigen characteristics of red blood cells are determined by a single gene that has three possible alleles: IA, IB, and i. The IA allele carries the genetic instructions for building antigen A and the IB allele carries the instructions for building antigen B, but the allele i does not carry the necessary information for producing any antigens. This is an example of multiple allele inheritance and means that each of us inherits two of the three alleles. The IA and IB alleles are co-dominant (meaning a heterozygote will express both traits), and both are equally dominant over the recessive i allele. Make sure you understand this before you proceed. Rh factors. Another important antigen found on the surface of red blood cells is the Rh factor. Blood containing this antigen is said to be “Rh positive”, and blood lacking this antigen is said to be “Rh negative”. Rh blood type is determined by two alleles, Rh+ and Rh-. Rh+ is dominant over Rh-. We often report ABO blood type and Rh blood type in a combined manner. Hence you may be A+, A-, B+, B-, AB+, AB-, O+, or O- with the plus or minus signs indicating the Rh factor phenotype. However, the Rh factor gene is inherited independently of the ABO gene, meaning these are not linked genes and they obey Mendel’s law of independent assortment. Synthetic blood typing activity. Knowing someone’s blood type can be useful in many situations. For example, people can receive blood transfusions of only certain blood types, depending on their own blood type. If incompatible blood types are mixed, the antibody response leads to serious and sometimes fatal consequences. In addition to medical applications, ABO/Rh blood types are often used in the field of forensics. A comparison of blood types may exclude an individual as a possible biological parent or child. Or, if a sample of blood is collected at a crime scene, that blood can be compared to other samples to help rule out possible suspects or victims. A simple way to determine a person’s blood type is to test samples of the blood using antisera, solutions with high levels of either anti-A, anti-B, or anti-Rh antibodies. Several drops of each type of antiserum are added to separate samples of the blood. If a reaction occurs, then the corresponding antigen is present. The nuclei of eukaryotic cells contain chromosomes along which genes are arranged (genes are sections of double stranded DNA that form discrete units of hereditary information that influence traits such as eye color or height). Diploid cells contain two copies of each chromosome. Structural proteins in the chromosomes (called histones) organize the DNA and participate in DNA folding and condensation. To prepare for division, cells duplicate their chromosomes, which are passed on to daughter cells, thus preserving the diploid condition. This process is the mechanism for passing on hereditary information to the next generation. In single-celled organisms and the somatic cells (cells other than a sperm or egg cell) of multicellular organisms, the nucleus divides by mitosis into two daughter nuclei. These daughter nuclei have the same number of chromosomes with the same genes as the parent cell. Meiosis is a different type of nuclear division that occurs only in specific cells of multicellular organisms as part of sexual reproduction. In meiosis, diploid nuclei of germ cells in ovaries or testes (or sporangia in plants) divide twice, but the DNA replicates only once. This process results in four daughter nuclei with different copies of chromosomes and genes. These daughter nuclei are haploid, containing only one copy of each chromosome. When two of these cells fuse during fertilization, the diploid condition is restored. Generally in both mitosis and meiosis, after nuclear division the cytoplasm divides by a process called cytokinesis. in somatic cells, events from the beginning of one cell division to the beginning of the next are collectively called the cell cycle (see figure). The cell cycle is divided into two major phases: interphase (further subdivided into G1, S, and G2) and the M phase. Interphase is a time of cell growth and development and preparation for cell division. The M phase (mitotic phase) represents the division of the nucleus and cytoplasm and is subdivided into four phases: prophase, metaphase, anaphase, and telophase, which concludes in cytokinesis. A. Modeling the cell cycle and mitosis in an animal cell. Scientists often use models to represent natural structures and processes that are too small, too large, too slow, too fast, or too complex to investigate directly. Scientists develop their models from observations and experimental data, usually accumulated from a variety of resources. Today in lab you will observe some computer models of cell division, and then you will build your own models of cell division. Using these models will enhance your understanding of the structure of cells and of the behavior of chromosomes, centrosomes, membranes, and microtubules during the cell cycle. As you build your model, practice narrating through each stage of the cell cycle. Take turns with a lab partner to demonstrate the model to each other to reinforce your understanding. You may want to have your text open to chapter 8 as a reference. Your mitosis model cell will be a diploid cell (2n) with four chromosomes (2n = 4), just like the one you will observe online. This means that you will have two homologous pairs of chromosomes. One pair will be long chromosomes and the other pair will be short Working with a hands-on model: Model mitosis and cytokinesis. In the M phase, the nucleus divides, followed by division of the cytoplasm. Nuclear division is called mitosis, and division of the cytoplasm is referred to as cytokinesis. Mitosis is further divided into subphases: prophase, metaphase, anaphase, and telophase. It is important to recognize that while we discuss mitosis (and later meiosis) in terms of discrete phases, the process is continuous, with no real pause or break between “phases.” Dividing the process into phases makes it easier to discuss. a. Prophase: Start with the chromosomes piled in the center of the cell. Prophase begins when chromosomes begin to coil and condense, and they become visible using a compound microscope. Centrosomes move to the poles of the nucleus, and as they do, a mitotic spindle begins to form. The mitotic spindle consists of microtubules, or “spindle fibers,” growing outward from centrioles toward the chromosomes. (Refer to Fig. 8.7 in your text.) Nucleoli disappear and the nuclear membrane breaks apart during this phase (you can erase it from the cell). Some spindle fibers attach to sister chromatids at the centromere, and push/pull the chromosomes toward the middle of the cell. Move the centromeres of your chromosomes to lie on an imaginary plane (the equator of the cell) midway between the two poles established by the centrosomes (in your cell, this plane is defined by the line where the edges of your pieces of paper meet). b. Metaphase: In metaphase, the spindle fibers align the chromosomes along the metaphase plate in a single file so that one sister chromatid of each the chromosome is facing a separate pole. At this stage, each sister chromatid is attached to a spindle fiber from an opposite end of the cell. c. Anaphase: In anaphase, sister chromatids are pulled apart by spindle fibers. Spindle fibers that are not attached to chromosomes elongate, making the cell longer. For each chromosome, hold onto the centromere and pull the two white pop beads apart to move the separated sister chromatids to their respective poles. At this point, chromatids are now called chromosomes, and anaphase ends as the chromosomes reach the poles. d. Telophase: Telophase is essentially the reverse of prophase. The mitotic the spindle breaks down, chromosomes begin to uncoil, and nucleoli reappear. A a nuclear membrane forms around each new cluster of chromosomes. Draw a new nuclear membrane on each piece of paper and place one set of chromosomes inside each nucleus. Cytokinesis: Leave the two new chromosome masses at the poles and gently move your two pieces of paper apart. You have now formed two new cells that should look exactly like the cell you started with. The end of telophase marks the end of nuclear division, or mitosis. Division of the cytoplasm, or cytokinesis, results in the formation of two separate cells. In animal cells, a cleavage furrow forms at the equator and eventually pinches the parent cytoplasm in two. In plant cells, a cell plate begins to form in the center of the equatorial plane and grows until it eventually extends across the cell, dividing the cytoplasm in two. Cell wall materials are secreted into the space between the membranes of the cell plate.. Model Interphase. This stage is similar in cells undergoing either mitosis or meiosis and we will repeat the procedure from before. a. Pile all the assembled chromosomes in the nucleus of your original model cell on scrap paper to represent the uncoiled chromosomes as a mass of chromatin in G1. b. As before, duplicate the chromosomes in your model cell to represent DNA 43 replication in the S (synthesis) phase. Make a second strand that is identical to the first strand in each chromosome. In replicating chromosomes, two beads will be used to form the new centromere, but recall that the centromere in a cell is a single unit until it splits in metaphase. In your model, you will still consider each pair of beads to be the single centromere. c. Now switch to the two-page model cell you created for modeling mitosis. This is still representing cell growth. c. Duplicate the centrosome (add a second pair of centrioles to your model). d. Do not disturb the chromosomes to represent G2. As in mitosis, enzymes and Other proteins necessary for cell division are synthesized during this phase. 3. Meiosis I. Meiosis consists of two consecutive nuclear divisions, called meiosis I and meiosis II. When the first division begins, the chromosomes coil and condense, as in mitosis. Meiosis I is very different from mitosis, however, and the differences immediately become apparent. a. Meiosis begins with the chromosomes piled in the nucleus of your cell. As chromosomes begin to coil and condense, prophase I begins. Each The chromosome is double-stranded, made up of two sister chromatids. Centrosomes are located outside the nucleus. b. Prophase I: Separate the two centrosomes and move them to the poles of the nucleus. Nucleoli disappear and the nuclear envelope breaks down (erase it as before). The mitotic spindle begins to form as in mitosis. Move each homologous chromosome to pair with its partner. Because the chromosomes are double-stranded, each newly paired double-chromosome the complex is made of four strands. This complex is called a tetrad, and there should be two tetrads in your cell. Within each tetrad, non-sister chromatids exchange pieces with each other in a process called “crossing over.” This effectively shuffles the genetic information contained on a given chromatid. In this process, a segment from one chromatid will break and exchange with a segment at the exact same location on a non-sister chromatid in the tetrad. This is significant, because crossing over produces new allelic combinations among genes along a chromatid. Genes are often expressed in different forms. For example, when the gene for seed color is expressed in pea plants, the seed may be green or yellow. Alternative forms of genes are called alleles. New allele combinations within a particular chromosome occur most often as a result of crossing over. Represent the phenomenon of crossing over by detaching and exchanging identical segments of any two non-sister chromatids in a tetrad. Late in prophase I, tetrads move toward the equator. Move your tetrads midway between the two poles (along the seam between pages). e. Metaphase I: To represent metaphase I, position the tetrads so that one chromosome (with two sister chromatids) faces one pole and the other chromosome (with its two sister chromatids) faces the opposite pole Meiosis II. The events that take place in meiosis II are similar to the events of mitosis. Meiosis I results in two nuclei with half the number of chromosomes as the parent cell, but the chromosomes are double-stranded (made of two chromatids), just as they are at the beginning of mitosis. The events in meiosis II must change double-stranded chromosomes into single-stranded chromosomes. As meiosis II begins, two new spindles begin to form, establishing the axes for the dispersal of chromosomes to each new nucleus. Duplicate the centrosomes in each new cell from meiosis I. a. Prophase II: Separate the centrosomes in each cell and move them to the poles. Pile the chromosomes in the center of each cell. The events that take place in prophase II are similar to those of a mitotic prophase. In each new cell, nucleoli break down, the nuclear membrane (if formed) breaks down, and a new spindle forms. Spindle fibers attach to sister chromatids at the centromere of each chromosome and push/pull the chromosomes toward the center of the cell. b. Metaphase II: Align the chromosomes at the metaphase plate so that each sister chromatid faces an opposite pole. c. Anaphase II: Pull the sister chromatids apart at the centromere and move them to the poles. As before, once chromatids have been separated, they become full-fledged chromosomes. d. Telophase II: Pile the two sets of chromosomes at the poles. The mitotic spindle breaks down, nucleoli appear, and nuclear membranes form around each cluster of chromosomes as the chromosomes uncoil. Draw a nuclear membrane around each pile of chromosomes at each end of both cells. Cytokinesis follows meiosis II. Carefully tear or cut each piece of paper in half to represent cytokinesis