Lecture 3 - Tan.pdf

CH4306 Bioanalytical Techniques Assoc Prof TAN Meng How N1.2-B2-33 [email protected] 1 Lecture 3: Optical Spectroscopy & Molecular Recognition 2 Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy Loading… 2) Molecular Recognition • • • •...

CH4306 Bioanalytical Techniques Assoc Prof TAN Meng How N1.2-B2-33 [email protected] 1 Lecture 3: Optical Spectroscopy & Molecular Recognition 2 Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy Loading… 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 3 Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 4 Light – an introduction Light is electromagnetic radiation that can be described either as a wave with a particular wavelength or as particles (photons) with a particular energy. (This concept is known as wave-particle duality in quantum mechanics.) Zapph Loading… The wavelength or its corresponding photon energy is the most important property of light. In bioanalysis, optical methods (such as absorption spectroscopy and fluorescence spectroscopy) are typically applied in the UV and visible wavelengths (200–800 nm). In a vacuum, light travels in a straight line with a speed of 3 x 108 m s-1. However, light can interact with matter. When light is exposed to a material, we can observe interactions such as transmission, absorption, absorption and re-emission, scattering, reflection, refraction, interference, and diffraction of light. The detection of light after these interactions reveals information about the sample or properties of its surface. 5 Light absorption • Absorption of light results in the transitions of a molecule from a ground state into an excited state. • The absorption reduces the light intensity from Io (its initial value) to I (intensity of transmitted light). ↳ gone ~ multiple tha Beginning wavelength 6 Absorption spectrum The absorbance and transmittance of light depends on the wavelength. Therefore, the wavelength should be given together with the measured values. A scan over wavelengths is called an absorption spectrum. Every substance has a typical absorption spectrum, with peak absorbance at particular wavelengths. SRNA alosors DNA maximally at 288 am . Absorption measurements at different wavelengths can be used to assess the purity of a solution, e.g. of DNA. To determine the protein contamination in a DNA solution, the absorbance at 260 nm is compared to the absorbance at 280 nm. DNA absorbs most strongly at 260nm, while the aromatic amino acids tyrosine and tryptophan absorb at larger wavelengths than DNA, namely at 274 nm and 280 nm respectively. The ratio A260/A280 equals 1.8 for a pure DNA solution; smaller values indicate the presence of proteins. For a pure RNA solution, one can expect A260/A280 = 2. with contamination A2804: ratio to around , 1 3-1 . . 4 1 . . 8 7 Beer-Lambert law The Beer-Lambert law relates the attenuation of light to the properties of the material through which the light is travelling: A concentrations ↑ , ↑b ↑ A - light enconters , unstauos pre . proportional . The extinction coefficient (also called absorptivity or proportionality constant), , is specific to a molecular species at a given wavelength. It is often given in L mol-1 cm-1 (note that 1M = 1 mol L-1), but can also be given in L g-1 cm-1. 8 Measuring nucleic acid concentrations • The linear relation between concentration and absorbance as described in the Beer–Lambert law is frequently used to determine the concentration of a chemical species. • To obtain a good sensitivity, these measurements are preferably done at the maximum absorption wavelength of the species. • For example, DNA concentration is estimated by measuring the absorbance at 260 nm and the concentration can be determined by using the extinction coefficient of 0.020 L mg–1 cm–1 for double stranded DNA and 0.027 L mg–1 cm–1 for single stranded DNA. • Often, the absorbance of a sample like DNA is measured using a cuvette. Here, a portion of the initial light intensity is lost due to reflection and scattering of the light at the cuvette. In particular, these losses occur at the boundaries of the different materials (air–cuvette and cuvette–solvent). In addition, the solvent may absorb light or may contain absorbing contaminations or scattering particles. These reductions are considered by measuring both the absorbance of the sample solution and the absorbance of the sample-free solvent (“blank”). We 9 then subtract the blank measurement from the sample measurement. NanoDrop • A NanoDrop is an increasingly common lab spectrophotometer (from Thermo Fisher) that can measure DNA, RNA, and protein concentrations with only ~ 1 µL of sample. • The NanoDrop instrument does not use a cuvette (which most traditional UV-Vis spectrophotometers do). Instead, it uses the surface tension of aqueous solutions to form a column of sample between two pedestals and directs the light through it. This enables the instrument to measure the concentrations of tiny volumes of sample (~ 1 µL; even the smallest 1 cm path length cuvette requires ~ 50 µL). Hence, the concentration of precious samples can be quantified. • Just like traditional cuvette-based UV-Vis spectrophotometers, Nanodrop also works by the principle of the Beer-Lambert law. 10 Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy Loading… 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 11 What is luminescence? • Emission of light from a chemical species or a material is called luminescence. • Photon emission as a result of a chemical or biochemical reaction is referred to as chemiluminescence or biochemiluminescence respectively. • produce light inthe presence of asubstrate A prominent example is luciferase, a class of oxidative enzymes that produce bioluminescence. Many organisms regulate their light production using different luciferases in a variety of light-emitting reactions. The majority of studied luciferases have been found in animals, including fireflies, and many marine iRWciDerase pot animals such as jellyfish. ↓ lights under al is GMP/ ↑ light , strong thecanter othing Promoter a regulatoryelement , • Luciferases are widely used in then the abilitystrengt ee determined for example as C biotechnology, regulatory element festing reporter genes. Although luciferases do not require an external light source, they require the addition of a consumable substrate (e.g. luciferin). can be . 12 . What is photoluminescence? • Photon emission after photon absorption is termed photoluminescence. There are two types of photoluminescence: fluorescence or phosphorescence. ↓ relente light very Dast • Fluorescence is the emission of light by a substance that has absorbed light or other electromagnetic radiation (in nanoseconds). The emitted light usually has a longer wavelength than the absorbed radiation (Stokes shift). release light I very slowly • Phosphorescence is a process in which energy absorbed by a substance is released relatively slowly in the form of light. This is because the electron which absorbed the photon (energy) undergoes an unusual “intersystem crossing” and gets trapped in a higher energy state with only rare, kinetically unfavored transitions available to return to its original lower energy state. • Fluorescent materials cease to glow nearly immediately when the radiation source stops, unlike phosphorescent materials, which continue to emit light for some time after. 13 Examples of photoluminescence • A striking example of fluorescence occurs when the absorbed radiation is in the ultraviolet region of the spectrum, and thus invisible to the human eye, while the emitted light is in the visible region, which gives the fluorescent substance a distinct color that can be seen only when exposed to UV light. Fluorescent minerals emit visible light when exposed to ultraviolet light. • Everyday examples of phosphorescent materials are the glow-in-the-dark toys, stickers, paint, and clock dials that glow after being charged with a bright light such as in any normal reading or room light. Glow-in-the-dark body paint. 14 Jablonski Diagram Professor Alexander Jablonski (1898-1980) was a Polish physicist who, in 1933, first illustrated the absorption and emission of light by fluorophores in his now famous diagram, which illustrates the activation from ground state to excited state and the emission of a photon on return to ground state once more. the photon illustrates what happens fo when it is excited . There is not a direct return to ground state as the flurophore can pass through alternative states of energy. After an electron absorbs a high-energy photon, the system is excited electronically and vibrationally. The system relaxes vibrationally, and eventually fluoresces at a longer wavelength. 15 need I d understa What is a fluorochrome? • A fluorochrome is a chemical that fluoresces, especially one used as a label in biological research. • Each fluorochrome has unique and characteristic spectra for absorption (usually similar to excitation) and emission. Emitted spectrum every Floorochromehasan at the longer wavelength Emitted photo will always - will always bemuch weakerfran absorption spectrum be . at stoke shipt • These absorption and emission spectra show relative fluorescence intensities. ↳ Both absorption same semified spectrum will never bethe . • For a given fluorochrome, the manufacturer indicates the wavelength for the peak of the illumination excitation intensity and the wavelength for the peak of fluorescence emission intensity. 16 . When a fluorochrome absorbs a photon, its electrons are excited to a higher energy state. The electrons of the fluorochrome remain in the excited state for about 10−8 seconds before returning back to the ground state, with the concomitant emission of another photon. Stokes Shift ↳ there is an energy less (dissipated as heat+ transperredto sorsonding - The H28 moleates) . emitted phapon has less energythan absorbed phifen : This emitted photon usually has less energy than the absorbed photon due to two reasons: (1) Some of the energy is dissipated as heat. (2) A fluorophore is surrounded by water molecules. Part of the excess energy of the excited vibrational mode can be transferred to the surrounding water molecules (in a process known as vibrational relaxation). The energy difference between the absorbed photon and the emitted photon is known as the Stokes shift. 17 Why is there an increase in wavelength? light ↳Bandsprecht where C Re X Travelengt h is the Planck constant (6.63 x 10-34 J.s) f is the frequency c is the speed of light in vacuum (3.00 x 108 m s-1) Is the wavelength • When electrons drop from the excited state to the ground state, there is some loss of vibrational energy. Emitted phot has less I, It x4 - emitted platon has , , buger wavelength • From the Planck-Einstein equation, we can see that the photon energy varies inversely with wavelength. Hence, the emission spectrum is shifted to longer wavelengths than the excitation spectrum • The emission intensity peak is usually lower than the excitation peak. • The emission curve is often a mirror image of the excitation curve, but shifted to longer wavelengths. 18 Maximising fluorescence • The greater the Stokes shift, the easier it is to separate excitation light from emission light. • Any spectral overlap must be eliminated, in fluorescence microscopy, by means of the appropriate selection of an excitation filter. Otherwise, the much brighter excitation light will overwhelm the weaker emitted fluorescence light, significantly diminishing specimen contrast. • In order to achieve maximum fluorescence intensity, the fluorochrome is usually excited at the wavelength at the peak of the excitation curve, and the emission detection is selected at the peak wavelength of the emission curve. • The selections of excitation wavelengths and emission wavelengths are controlled by appropriate filters. 19 Some excitation light sources • Xenon arc lamp ↳ Xenon gas pass electricity thre ionised . - Produces light by passing electricity through ionized xenon gas at high pressure. - Produces a bright white light that closely mimics natural sunlight. - Used in movie projectors in theaters, in searchlights, and for specialized uses in industry and research to simulate sunlight. ↓ liquit at one temperature • Mercury vapor lamp hersageinsbased a I conductive becomes electrically . - Uses an electric arc through vaporized mercury to produce light. - Longer bulb lifetime than incandescent light bulbs (around 24,000 hours). - The mercury in the lamp is a liquid at room temperatures. It takes 4-7 minutes to heat up and become ionized (so mercury vapor lamps are considered slow-starting). 20 Some excitation light sources • Metal halide lamp improve th initial valde e la - Produces light by an electric arc through a gaseous mixture of vaporized mercury and metal halides (usually compounds of metals with bromine or iodine). - Similar to mercury vapor lamps, but contain additional metal halide compounds in the quartz arc tube, which improve the efficiency and color rendition of the light. • High power light-emitting diode (LED) - Lower energy consumption and much longer lifetime than mercury lamp or metal halide lamp. (Currently very popular in fluorescence microscopes.) • Lasers : not osed in regularlab-based microsepes . - Lasers are most widely used for more complex fluorescence microscopy techniques like confocal microscopy and total internal reflection fluorescence microscopy, while xenon lamps, mercury lamps, and LEDs are commonly used for widefield epifluorescence microscopes. 21 know a e hetfinde - ee Semiconductors An (intrinsic) semiconductor like silicon has low electrical conductivity at room temperature. Doping (by adding a small amount of impurity to silicon) can improve its electrical conductivity. The new semiconductor formed is called an extrinsic semiconductor. There are two types of extrinsic semiconductors: (1) A p-type semiconductor is formed by doping silicon with a trivalent (number of valence electrons=3) element like indium, boron or aluminium (2) An n-type semiconductor is formed by doping silicon with a pentavalent (number of valence electrons=5) element like arsenic or antimony. Since silicon is tetravalent (number of valence electrons=4), an n-type semiconductor will have an excess of electrons or negative charge carriers (surplus of electrons that can be donated to other elements), whereas a p-type semiconductor will have a surplus of holes or positive charge carriers. 22 A p-n junction To make a p-n junction, we dope a wafer of silicon with a trivalent impurity on one side and a pentavalent impurity on the other side. Three phenomena occur at a p-n junction: (1) Diffusion: A p-type semiconductor can accept electrons from an n-type semiconductor. When an electron leaves the n-side region, it leaves behind an ionised donor (a positive charge) at the n-side. Similarly when a hole is diffused to n-side, it leaves behind an ionised acceptor (a negative charge) at the p-side. This movement of electrons from n-side to p-side and the movement of holes from p-side to n-side is called diffusion. (2) Formation of space charge: When more and more electrons leaves the n-region & more and more holes leaves the p-region, positive charges get accumulated near the nside junction and negative charges get accumulated near the p-side junction, giving rise to a depletion region. (3) Drift: An electric field directed from positive charge to negative charge is formed in the depletion region. This electric field causes electrons to move from p side to n side and holes to move from n side to p side. This motion of charge carriers due to electric field is known as drift. The drift current is opposite in direction to the diffusion current. 23 At equilibrium, diffusion current is exactly equal and opposite to drift current. What is a diode? A diode is a piece of semiconductor material with a p–n junction connected to two electrical terminals. It is a circuit element that allows a flow of electricity in one direction but not in the other (opposite) direction. Bias is the application of a voltage across a p–n junction; forward bias is in the direction of easy current flow, and reverse bias is in the direction of little or no current flow. Forward bias: The p-type is connected with the positive terminal of the power supply and the n-type is connected with the negative terminal. The holes in the p-type region and the electrons in the n-type region are pushed toward the junction and start to neutralize the depletion zone, reducing its width. Reverse bias: The p-type is connected to the negative terminal of the power supply, causing the holes in the p side to be pulled away from the junction and widening the depletion region. Likewise, because the n-type is connected to the positive terminal, the electrons will also be pulled away from the junction, with similar effect. This increases the voltage barrier causing a high resistance to the flow of charge carriers, thus allowing minimal electric current to cross the p–n junction. 24 Illustration of bias Forward bias: Reverse bias: 25 Detecting fluorescence emission ? How to detect Porescence usewesharas herae feentener e itshasa eLange barriert current a re i • Photodiode plus separate and minos charhat and the wildin ? de ticDietteimmediately e changcan , enteSee - A photodiode is a semiconductor device that converts light into current. - The common, traditional solar cell used to generate electric solar power is a large area photodiode. - A photodiode is basically a p–n junction (or a variant of it). - It is usually operated with no or reverse bias. - When a photon of sufficient energy strikes the diode, it creates an electronhole pair. - If the absorption occurs in the junction's depletion region, these carriers are immediately separated by the built-in electric field of the depletion region. Holes move toward the anode (p-type), and electrons toward the cathode (ntype), and a photocurrent is produced. 26 Detecting fluorescence emission • Photomultiplier tube (PMT) - A PMT contains a photocathode, several dynodes, and an anode. - When the photocathode is struck by a photon, the absorbed energy causes an electron to be emitted (photoelectric effect). decken o comed evt , dresse triggersseveral - The electrons emitted from the cathode are accelerated toward the first dynode, which is maintained 90 to 100 V positive with respect to the cathode. Each accelerated photoelectron that strikes the dynode surface produces several electrons. These electrons are then accelerated toward the second dynode, held 90 to 100 V more positive than the first dynode, and each electron that strikes the surface of the second dynode produces several more electrons, which are then accelerated toward the third dynode, and so on. - The current produced by incident light is multiplied by as much as 100 million times 27 due to the secondary emissions from the dynodes. Fluorescein • Fluorescein is a common dye for labelling DNA and protein. • It was first synthesized in 1871. • Fluorescein has an absorption maximum at 494 nm and emission maximum of 512 nm (in water). 28 Cyanine • Cyanine is a synthetic dye family belonging to polymethine group. (Polymethines are compounds made up from an odd number of methine groups (CH) bound together by alternating single and double bonds.) • Cyanines have many uses as fluorescent dyes, particularly in biomedical imaging. Depending on the structure, they cover the spectrum from infrared (IR) to ultraviolet (UV). Loading… • Cy3 and Cy5 are the most popular. Cy3 fluoresces greenish yellow (~550 nm excitation, ~570 nm emission), while Cy5 is fluorescent in the red region (~650 excitation, 670 nm emission). 29 Some terminology The quantum yield of a molecule is defined as the ratio of emitted photons to absorbed photons. It is usually below 1, because the relaxation from the first excited state to the ground state can occur via non-radiative processes. A good fluorophore is a molecule that has a high quantum yield, for example fluorescein with a quantum yield of 0.93 (in 0.1 M NaOH). Fluorescence intensity is the number of detected photons per unit time, collected from a given sample. The spectrum of the fluorophore shows the wavelength-resolved fluorescence intensity. The fluorescence region and the shape is characteristic of a fluorophore. Fluorescence lifetime (t) is the time required for the molecule to return from the excited state to the ground state. This characteristic decay time is very sensitive to the environment, e.g. solvent or the presence of quenchers. Note that the relaxation of a molecule is a random process and hence, the lifetime refers to a statistic value (some fluorophores emit earlier and others later than t). For fluorescence lifetime measurements, a pulsed excitation light source is required and the time between excitation and photon arrival on the detector is determined. This process occurs within nanoseconds and the detector must be able to 30 measure in this fast time range. Bleaching and saturation The more photons are detected from a sample, the better is the signal and hence, the sensitivity of the measurements. In principle, we can measure with stronger excitation light intensities to obtain a higher fluorescence signal. However, there are limitations: vertimedie weakens signals as Rusroscence resp D phot bleaching (i) Photo bleaching. With continuous excitation, the fluorescence signal will decrease over time. The reason for this is a potential photochemical reaction of the fluorophore when it is in the excited state. The reaction destroys the fluorophore irreversibly. Photostable dyes are able to undergo more excitation-emission cycles before bleaching. The higher the light intensities, the more probable the reaction will occur and thus the faster the bleaching will be. Therefore, there is a compromise between increasing the excitation light intensity (getting more signal) and reducing it to minimize photo bleaching. The phenomenon of photo bleaching has to be taken into consideration for data acquisition and analysis. Pertimelapse experiment Excitation light is veryhigh . (ii) Photo saturation. At very high excitation light intensities it may happen in rare cases that all dyes are already in the excited state or in the “triplet state”. As a result, the incoming light is not absorbed anymore. 31 Quenching -> water is Damas a quencher The fluorescence of a solution can be reduced or annihilated by a molecular process called quenching, of which there are two main types: dynamic quenching and static quenching. 0250 tomp A transper energy . (i) Dynamic quenching occurs when the fluorophore is in the excited state. Collisions with other species (ions, molecules) in solution result in relaxation of the fluorophore without photon emission, i.e. the energy is transferred to the so-called quencher. Neither the fluorophore nor the quencher is chemically altered. The reduction in fluorescence depends on the probability of collisions and is therefore a function of the quencher concentration. (ii) Static quenching. A quencher can also form a non-fluorescent complex with the fluorophore in the ground state. Here, the reduction of the fluorescence intensity depends on the binding constant of the quencher to the fluorophore Static Quenching depends on how fightly Wrencher binds to Plauphore . Dynamic Quenching Fluorophore Quencher 32 Fluorescence resonance energy transfer (FRET) • Fluorescence (or Förster) resonance energy transfer (FRET) is the transfer of energy from a fluorophore in the excited state to a fluorescent or non-fluorescent acceptor molecule. This acceptor molecule is typically in close proximity to the donor fluorophore, e.g. bound to the same molecule such as DNA. • FRET occurs efficiently, when the donor’s emission spectrum strongly overlaps with the acceptor’s absorption spectrum. The process does not involve the emission of a photon by the donor and reabsorption by the acceptor. Instead, the energy is transferred via dipole–dipole interactions. Hereby, the orientation of the dipoles of donor and acceptor molecules determines the efficiency of the energy transfer. Since the energy transfer also strongly depends on the distance of donor and acceptor molecules, FRET measurements can be used as a distance indicator. accept call metecoles herdose 2 - determine are amdecules To in . a transper is amount op energy on distance highly dependent 33 Some FRET equations • The rate of energy transfer (ket) is given by the Förster equation: ene inversel td: fluorescence lifetime of the donor in the absence of the acceptor molecule R: the distance of donor and acceptor molecules R0: the Förster distance, at which the fluorescence energy transfer is 50 % efficient. • The efficiency of the energy transfer (E) is the fraction of photon energy that is absorbed by the donor and transferred to the acceptor. It can be expressed as: • In FRET experiments, the donor is excited at a wavelength at which the acceptor is not or only weakly absorbing. 34 Green fluorescent protein (GFP) & its mutants color Rew A A practions GFP was found in the jellyfish Aequorea victoria in 1961 by Osamu Shimomura. It has been genetically modified since to improve photostability and quantum yield. The chromophoric group of GFP is formed autocatalytically during protein folding. The chromophore is surrounded by the protein backbone forming a β-barrel structure. ↳ can be bed in by altering - a , The importance of GFP lies in the possibility of it attaching to other proteins in the cell. This allows visualisation of target proteins in living cells and organisms, e.g. to observe protein movements or accumulations in specific parts of the cell or organism. Developed mutants of GFP are fluorescent in other wavelength regions, e.g. the yellow fluorescent protein, YFP, or the cyan fluorescent protein, CFP. 35 Application of GFP & its variants The major application of fluorescence spectroscopy in biology is the visualisation and tracking of tagged molecules in complex environments such as cells, smaller organisms and tissue. By means of fluorescence microscopy, it is possible to observe distinct parts of the cells, e.g. the nucleus, the cytosol, the cell membrane and organelles. One can see the presence of target molecules in distinct areas and can visualise changes or movements of these molecules. 36 Limitation of conventional fluorescence microscopes Bright-field or wide-field fluorescence microscopes are commonly used to obtain images of individual cells (e.g. bacterial cells or mammalian cells). Thick sample / negutar plorescence widescrpy -> Blurry . Individual cells are thin. Additionally, mammalian cells are typically grown in the lab as an adherent two-dimensional culture in a dish or multi-well plate. Issues arise when one tries to take images of thick specimens, such as tissue samples or three-dimensional organoids. 37 Confocal microscopy • Confocal microscopy was developed to overcome some limitations of traditional wide-field fluorescence microscopes. • In this technique, the sample is illuminated by the light of a tightly focused (monochromatic) laser (point illumination). No excitation occurs at all other positions outside of the focus. • By use of a pinhole, emitted light from above and below the focus is blocked and does not reach the detector. Hence, in confocal microscopy, the background signals from regions away from the laser focus are low. • However, as much of the light from sample fluorescence is blocked at the pinhole, this increased resolution is at the cost of decreased signal intensity. To offset this drop in signal after the pinhole, long exposures are often required and the light intensity is detected by a very sensitive detector. • As only one point in the sample is illuminated at a time, 2D or 3D imaging requires scanning over a regular raster (i.e., a rectangular pattern of parallel scanning lines) in the specimen. In confocal laser scanning microscopes, the laser focus is moved quickly all over the sample. At every point, the fluorescence intensity is measured and finally put together to a full image. This process requires a few hundred microseconds for a sample size of a few tens of micrometers. • • Images of the specimen can be taken at various heights of the sample (“z-stack”) and combined to obtain a 3D image at high resolution. 38 Microscope schematics (a) In a conventional wide-field fluorescence microscope, the entire specimen is flooded evenly in light from a light source. All parts of the specimen in the optical path are excited at the same time and the resulting fluorescence is detected by the microscope's photodetector or camera, including a large unfocused background part. (b) A confocal microscope uses point illumination and a pinhole in an optically conjugate plane in front of the detector to eliminate out-of-focus signal. As only light produced by fluorescence very close to the focal plane can be detected, the image's optical resolution, particularly in the sample depth direction, is much better than that of wide-field microscopes. 39 Image Comparison regular Prescence microscopy ampreal microscopy These are a series of images that compare traditional widefield and laser scanning confocal fluorescence microscopy. (a) A thick section of fluorescently stained human medulla in widefield fluorescence exhibits a large amount of glare from fluorescent structures above and below the focal plane. (d) When imaged with a confocal microscope, the medulla thick section reveals a significant degree of structural detail. (b) Widefield fluorescence imaging of whole rabbit muscle fibers stained with fluorescein produce blurred images lacking in detail. (e) Confocal microscopy reveals a highly striated topography in the same specimen. (c) Autofluorescence in a sunflower pollen grain produces an indistinct outline of the basic external morphology, but yields no indication of the internal structure. (f) A thin optical section of the same grain acquired with confocal techniques 40 displays a dramatic difference between the particle core and the surrounding envelope. Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 41 Modes of Detection • Many methods have been developed to probe for the presence of certain DNA or RNA sequences or certain proteins. • Ideally, we should be able to “see” the final results, although DNA, RNA, and proteins are really far too small to be seen by the naked eye. • There are two modes of detection that are commonly used: (1) Fluorescence (2) Radioactivity 42 Radioactivity • A radioactive isotope (also called radioisotope) is any of several species of the same chemical element with different masses whose nuclei are unstable and dissipate excess energy by spontaneously emitting radiation. The isotopes have the same number of protons but different number of neutrons. • Radioisotopes are commonly used to detect very small amounts of DNA, RNA, or protein (in the femtogram [1x10-15 gram] to picogram [1x10-12 gram] levels). • A radioactive isotope is introduced into DNA, RNA, or protein for quantification purposes and its presence can be detected by: - sensitive radiation detectors such as Geiger counters and liquid scintillation counters - exposure to X-ray films (autoradiography) or phosphor storage screens 43 Common radioisotopes used commonly sed to 32P is frequently used for detecting DNA and RNA and has the highest Label emission energy of all common research radioisotopes. This is a major advantage in experiments for which sensitivity is a primary consideration. Its maximum specific activity is 9131 Ci/mmol. not labelled proteins 35S is used to label proteins and nucleic acids. Cysteine is an amino acid oxygen containing a thiol group (-SH), which can be labelled by S-35. Since replace ~I Ser nucleotides do not contain a sulfur group, the oxygen on one of the phosphate groups can be substituted with a sulfur. This thiophosphate acts the same as a normal phosphate group, although there is a slight bias against it by most polymerases. The maximum theoretical specific activity is 1,494 Ci/mmol. 3H is used to detect DNA and RNA. It is a very low energy emitter, with a maximum theoretical specific activity of 28.8 Ci/mmol. However, there is often more than one tritium atom per molecule: for example, tritiated UTP is sold by most suppliers with carbons 5 and 6 each bonded to a tritium atom. 125I is used to radiolabel proteins, usually at tyrosine residues. Unbound iodine is volatile and must be handled in a fume hood. Its maximum specific activity is 2,176 Ci/mmol. 44 How long do radioisotopes last? • The term half-life is defined as the time it takes for one-half of the atoms of a radioactive material to decay. It is independent of the original quantity. • Different radioisotopes have different half-lifes. For example, P-32 has a half-life of 14.29 days, S-35 has a half-life of 87 days, while C-14 has a long half-life of 5,730 years. 45 Radiation sickness Radiation sickness is a condition where there is damage to the body occurring as a result of large doses of radiation received by the body over a short period of time. The radiation causes cellular degradation due to damage to DNA and other key molecular structures within the cells. Eyes: High doses can trigger cataracts months later. Thyroid: Hormone glands vulnerable to cancer. Radioactive iodine builds up in thyroid. Children most at risk. Lungs: Vulnerable to DNA damage when radioactive material is breathed in. Stomach: Vulnerable if radioactive material is swallowed. Reproductive organs: High doses can cause sterility. Skin: High doses cause redness and burning. Bone marrow: Site of production of red and white blood cells. Radiation can lead 46 to leukemia and other immune system diseases. Safety in using radioactivity Gel mobility shipt essay -> here Pap e sensfineHa replace We need to be careful when using radioactivity in the lab. For example, the high-energy beta emissions from 32P can present a substantial skin ↳ emits gamma not the and eye dose hazard. same as ratration that , breaks theDNA . Common safety measures include the following: - Designate special area for handling radioisotopes and clearly label all containers. work behind the shield - Store radioisotopes like 32P behind lead shielding. - Work behind acrylic glass shields and wear safety goggles to protect eyes from radiation. - Practise routine operations to improve dexterity and speed before using radioisotopes like 32P. - Handle potentially volatile chemical forms in ventilated enclosures. - Isolate radioactive waste in clearly labelled shielded containers and hold for decay. - Always check work area and work clothes (e.g. lab coat) for accidental 47 spills after every experiment. - Go for regular health checks to detect symptoms of radiation sickness. e pha Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 48 What are restriction endonucleases? Restriction endonucleases (or restriction enzymes) recognize and cleave specific DNA sequences, i.e. they are DNA-cutting enzymes that only cleave at particular positions. The sequence of nucleotides that is recognized by each restriction enzyme is known as its restriction site. For example, BamHI recognizes GGATCC, while EcoRI recognizes GAATTC. The enzymes can cut their DNA substrate within the recognition site or outside the recognition site (i.e. the recognition and cleavage sites may be separate from each other). 49 Where do restriction enzymes come from? They are usually isolated from bacteria Restriction enzymes are usually named after the bacteria they are isolated from. For example: EcoRI – isolated from E. coli strain R HindIII – isolated from Haemophilus influenzae strain Rd • Nobel Prize in 1978 was awarded for discovery of restriction enzymes 50 If bacteria produce these enzymes, why isn’t the bacterial DNA digested by them? ➢ Probability of finding a target of: 4 bases – 1/256 5 bases – 1/1024 6 bases – 1/4096 8 bases – 1/65,536 ➢ Restriction endonucleases protect bacteria from invasion by foreign DNA (like phage) (Restrict the host range of the virus) ➢ Bacteria use methylation to protect their chromosomal DNA; invading viral DNA is not methylated ➢ Many restriction enzymes cannot cleave methylated DNA 51 Restriction enzymes often function as homodimers editoring 5 ' EcoRI on DNA G A A T T C C T T A A G an 5 a cartoon 'view Hence, restriction sites are often (but not always) palindromic. 52 Sticky ends vs. blunt ends Upon cleavage, restriction enzymes often leave a single stranded overhang (“sticky” end). The overhang can be either 5’ or 3’. Sometimes restriction enzymes leave a “blunt” end. (5’ overhang) is blout of 53 5’-TCAGATCGTACTTGAGAATTCGGGCT-3’ 3’-AGTCTAGCATGAACTCTTAAGCCCGA-5’ not between o EcoR I 5’-TCAGATCGTACTTGAG 3’AGTCTAGCATGAACTCTTAA AATTCGGGCT3’ GCCCGA-5’ Sticky ends 54 Fragment 1 5’-TCAGATCGTACTTGAGAATTCGGGCT-3’ 3’-AGTCTAGCATGAACTCTTAAGCCCGA-5’ Fragment 2 5’-CTAGGACCGAATTCAAGTACGGACC-3’ 3’-GATCCTGGCTTAAGTTCATGCCTGG-5’ EcoR I 5’-TCAGATCGTACTTGAG AATTCGGGCT-3’ 3’-AGTCTAGCATGAACTCTTAA GCCCGA-5’ 5’-CTAGGACCG AATTCAAGTACGGACC 3’ 3’-GATCCTGGCTTAA GTTCATGCCTGG 55 5’ A new recombinant DNA molecule 5’-TCAGATCGTACTTGAGAATTCAAGTACGGACC-3’ 3’-AGTCTAGCATGAACTCTTAAGTTCATGCCTGG-5’ DNA ligase seals the nicks between the two strands, reforming covalent phosphodiester bonds 56 What is happening in the DNA backbone? e PhasPe Restriction Enzyme DNA Ligase 57 Analogies Fancy Restriction Enzyme recognise speci ' Sequence DNA Ligase Summary of DNA cut-and-paste Examples of restriction enzymes EcoRI cuts between Gand A -overhang sameas E BamHI SmaI XmaI befarach generates workin inthe it encounters when CCCGGG B'overhang end is and NotI base Par laste KpnI I Bloat auf middle , Between gl 8 base-pair after Hundreds of enzymes are available (for example, see: http://www.neb.sg/products/restriction-endonucleases) s company that is very active inthis field . 60 Type II vs type IIs restriction enzymes • Type II enzymes cut within their recognition sequences. EcoRI: BamHI: • Type IIs enzymes cut outside of their recognition sequences. BsmBI: out I base away at the tip , and B base away at the better 112 base pairs BbsI: BsaI: 11 at thetep , G pains atthe better The “N”s are useful for designing unique overhangs I basepair atthe top , I lease pair at the lettern . Overview of Southern Blot A Southern blot is a method for detection of a specific DNA sequence in DNA samples. It was invented by Sir Edwin Southern, Professor Emeritus at University of Oxford. 62 over non-specific exposed areas salman herring sperm - Details of Southern Blot Procedure block ↓ 1) 2) 3) 4) 5) 6) 7) . Restriction endonucleases are used to cut high-molecular-weight DNA strands into smaller fragments. The DNA fragments are then electrophoresed on an agarose gel to separate them by size. The DNA gel is placed into an alkaline solution (typically containing sodium hydroxide) to denature the double-stranded DNA and destroy any residual RNA that may still be present. A sheet of nitrocellulose (or nylon) membrane is placed on top of the gel. Pressure is applied evenly to the gel (by placing a stack of paper towels on top of the membrane and gel) to ensure good and even contact between gel and membrane. Buffer transfer by capillary action is then used to move the DNA from the gel onto the membrane. The membrane is then baked at 80oC for 2 hours or exposed to ultraviolet radiation to permanently attach the transferred DNA to the membrane. The membrane is then exposed to a hybridization probe. The probe is labelled so that it can be detected, usually by incorporating radioactivity or tagging the molecule with a fluorescent or chromogenic dye. To ensure the specificity of the binding of the probe to the sample DNA, most common hybridization methods use salmon or herring sperm DNA for blocking of the membrane surface and detergents such as SDS to reduce non-specific binding. After hybridization, excess probe is washed from the membrane and the pattern of hybridization is visualized on X-ray film by autoradiography in the case of a radioactive or fluorescent probe, or by development of colour on the membrane if a chromogenic63 detection method is used. Restriction fragment length polymorphism • Restriction fragment length polymorphism (RFLP) is a technique that exploits variations in homologous DNA sequences. choose a SNP restriction enzyme that cuts at the specific site a . • The basic technique for the detection of RFLPs involves: - Fragmenting a sample of DNA using a restriction enzyme - Separating the resulting DNA fragments by length using agarose gel electrophoresis - Transferring the DNA to a membrane via Southern blot - Hybridizing to the membrane a labeled DNA probe to determine the length of the fragments that are complementary to the probe. • An RFLP occurs when the length of a detected fragment varies between individuals. Each fragment length is considered an allele. 64 Example 1 of RFLP A small segment of the genome is being detected by a DNA probe (thicker line). In allele "A", the genome is cleaved by a restriction enzyme at three nearby sites (triangles), but only the rightmost fragment will be detected by the probe. In allele "a", restriction site 2 has been lost by a mutation, so the probe now detects the larger fused fragment running from sites 1 to 3. The second diagram shows how this fragment size variation would look on a Southern blot, and how each allele (two per individual) might be inherited in members of a family. Hybridize between sugments '2'and'3' alloe allele ↓ enzyme s cuts at , position I tabolishes the 2'position Restriction . 65 Example 2 of RFLP The probe and restriction enzyme are chosen to detect a region of the genome that includes a variable number tandem repeat segment (boxes in schematic diagram). In allele "c" there are five repeats in the VNTR, and the probe detects a longer fragment between the two restriction sites. In allele "d" there are only two repeats in the VNTR, so the probe detects a shorter fragment between the same two restriction sites. ①knwipyschave trindestide repeat Applicability to diseases: 2 Trinucleotide repeat disorders are a set of genetic disorders caused by trinucleotide repeat expansion, a kind of mutation where trinucleotide repeats in certain genes exceed the normal, stable threshold (which varies from gene to gene). Currently, nine neurologic disorders (e.g. Huntington’s disease) are known to be caused by an increased number of CAG repeats, typically in coding regions. During protein synthesis, the expanded CAG repeats are translated into a series of uninterrupted glutamine residues forming what is known as a polyglutamine tract ("polyQ"). Such polyglutamine tracts may be subject to increased aggregation. Some RNA-binding proteins may also recognize and bind to the CAG repeats to cause disease. 66 RNA What is Northern Blot? Western-Auteins • A variation of Southern blot, but used for the detection of RNA instead. >electrophoresis separate RNA by size : . • Developed in 1977 at Stanford University. • Totally cellular RNA is separated by size, transferred to a membrane (blotted), and detected by a complementary (radioactive-labelled) probe that hybridizes to a specific species of RNA. • Used in studies of gene expression, e.g. to determine whether a specific mRNA is present in different cell types. • Reveals information about the RNA identity, size, and abundance. • Only measures steady state RNA levels and not transcription rates or RNA stability. 67 Northern Blot Workflow Arha is non-coding tRNA and RNA : 382 getrid? RNA a disinterest deares Antase-H duplex -RNA-BNA Hart : mRNAin cell have long DelyAtails bead use 777 -conjugated / magnetic . a ↑ Alkaline Step is IOR as if degrades RNA RNA is denatured using glyoxal Heat at 65° r a Rew of , passivetransport . minutes. you quickly bad it membrane . Hybridiza proble Praction • Similar to Southern blot minority • mRNA (RNAs with a poly(A) tail) can be isolated using oligo (dT) beads • RNAs have to be denatured, for example, using glyoxal 68 Fluorescence in situ hybridization at the localization • Fluorescence in situ hybridization (FISH) is originally a cytogenetic technique that uses fluorescent probes that bind to only those parts of the chromosome with a high degree of sequence complementarity. • It is used to detect and localize the presence or absence of specific DNA sequences on chromosomes. • FISH can also be used to detect and localize specific RNA targets (mRNA, lncRNA, and miRNA) in cells, circulating tumor cells, and tissue samples. In this context, it can help define the spatial-temporal patterns of gene expression. permeablise cell or that proble can bind visualize where RNASDNA is 69 magnet and been Beate Example of DNA-FISH FISH is often used for finding specific features in DNA for use in genetic counseling, medicine, and species identification. A cell positive for the bcr-abl rearrangement (associated with chronic myelogenous leukemia) using FISH. The chromosomes can be seen in blue. The chromosome that is labeled with green and red spots (upper left) is the one where the rearrangement is present. proble is right welttapet bar i as e Detect bar abled translocation between Chr 9 and chr22 . halpor bar posed Durings tyt / with ablkinase , kinase drives calls is now abl which hyperactiveLeukemic Proliferation of , . 70 Bisicr Example of RNA-FISH not wellconserved witswedish Single-cell identification in microbial communities - Based on the patchy conservation of rRNA, 71 oligonucleotide probes can be designed with specificities to particular types of microorganisms. e i southern Northern Biof : start ps e DNA arrays • In traditional biomolecular methods, one gene is analyzed at a time. This becomes very time consuming and tedious. • In recent years, a new technology has become available that allows massively parallel analysis on a single device, the so-called DNA chip or DNA microarray. • This technique makes use of the molecular recognition of two strands of oligonucleotides which only bind to each other (hybridise) if they are complementary to each other. in complement base aufischs complementary protes pairing immetgese Brute e 72 Principle of DNA Arrays On a DNA array, there are large numbers of DNA molecules or oligonucleotides which are immobilised onto a substrate like a glass slide or a nylon membrane in the form of spots. cor-labelled sample Labelled DNA samples can only hybridize with certain spots on the array, i.e. those containing a matching oligonucleotide sequence. This results in a characteristic pattern (a fingerprint) of colored and uncolored spots. Hybridize todisequence / ↓genel gener nothing binds there 73 . Cy3 and Cy5 are commonly used Absolute misarray : quantictheabsoluteFather won a . Two DNA samples that are differentially labeled can be hybridized to the same array. comparativel Differential away-> hybridise & disamples to the #Dimetric array ? I . I . commonly dyes that and by 5 used are cy3 2 chip - sample is hybridized to chip same are ↓ Grach . d Red . see the coler ofthe array . 74 Genes can be expressed with different efficiencies used to Microarray gene expressions understand I were • Gene A is transcribed and translated much more efficiently than gene B. Transcriptome analysis - DNA microarrays absent in Why are dits tark " yellow sample AAB : equal ABB Single-stranded DNA probes are adhered to the surface of the chip - - soppresses expressio ab gene e : prctes(hesperative ofgene . Bright red: up-regulation Bright green: down-regulation Yellow: no change Today’s Outline 1) Optical Spectroscopy • Absorption of UV and visible light • Fluorescence spectroscopy 2) Molecular Recognition • • • • Modes of detection Recognition of nucleic acids Recognition of proteins Biosensors 77 prijifing tested What are antibodies? met An antibody (Ab), also known as an immunoglobulin (Ig), is a large, Y-shaped protein produced mainly by plasma cells that is used by the immune system to identify and neutralize pathogens such as bacteria and viruses. Each antibody consists of four subunits – two identical light chains (L), with a molecular weight of about 25kDa, and two identical heavy chains (H), with a molecular weight of about 50kDa. These subunits are associated via disulfide bonds and non-covalent interactions. There are five classes of antibodies: IgA, IgD, IgE, IgG (most common in the body), and IgM. These classes are determined by the five different types of heavy chains. There are also two types of light chains, which can appear in any of the five Ig classes. 78 More details on antibodies Within the antibody molecule, there are constant (C) and variable (V) regions. The constant regions are the same for every antibody of that class. The variable regions make up the paratopes of the antibody, which target and bind to the antigen of interest. The paratopes are located at the N-terminal tips of the Y-shape. Each antibody molecule has two identical paratopes for the antigen. Hence, the antibody is bivalent. There are two types of antibodies: (1) Polyclonal antibodies are a mixture of antibodies as produced by a host upon injection of an antigen. They can bind to several different parts (epitopes) on the this way antigen. 2) experiments more reproducible (2) Monoclonal antibodies bind to only one particular epitope on the antigen. They are more specific and reproducible. are . 79 Cleavage of antibodies Immunoglobulins can be cleaved into fragments: (1) The enzyme papain cleaves IgG into three fragments – two identical Fab fragments originating from the arms of the Y-shape and a Fc fragment from the stem of the Y-shape. As the Fab fragments contain the paratopes, they retain the antigen binding (ab) ability. (2) The enzyme pepsin cleaves an antibody at the stem below the hinge region, resulting in a F(ab)2 fragment with the arms of the Y-shape still being joined. This F(ab)2 fragment contains both paratopes. Occasionally, the Fab or F(ab)2 fragments are used in immunoassays, instead of the whole immunoglobulin molecule. constant region bind non-specifically may are not frother proteins that interest . 80 Antigens An antigen is a molecule (e.g. a toxin or other foreign substance) that induces an immune response in the body, especially the production of antibodies. Antibody presents milecule carrier ↳ immone system who There are two classes of antigens: , don't anfibety is generated (i betwe an need carrier anymaul ↳ once aufigen) complete incomplete . (1) Complete or full antigens induce an immune response by themselves. They are usually reasonably sized proteins (kDa range). These full antigens can have several copies of the same epitope or they can contain several different epitopes that bind to different antibodies (multi-determinant). For small molecules/drugs (2) Incomplete antigens, also called haptens, are lower molecular weight molecules like the drug theophylline (180Da) or the steroid hormone cortisone (362Da). They cannot induce an immune response by themselves. However, if attached to a protein carrier, the production of specific antibodies against these haptens can be triggered. Once produced, these anti-hapten antibodies will recognize the hapten even without the protein carrier. Haptens usually only feature a single epitope. 81 Details on epitopes • An epitope (binding site of the antigen) makes up only a small area of the total antigen structure. • (1) (2) Epitopes can be: Continuous – common in fibrous proteins Discontinuous – common in globular proteins and helical structures and are generated through folding. Discontinuous epitopes can be destroyed upon denaturation, for example, if disulfide bonds are split. • Antibodies are capable of distinguishing between antigens even if they are chemically very similar. It is the overall three-dimensional structure of the antigen that defines its affinity and interaction with an antibody. Arfer this region antibody necergnises recognise unfolding doesn'tdi lock . ↳ , dre to . 82 Antibody-antigen complex formation • If the paratope of the antibody matches the epitope of any antigen, an AbAg complex is formed. • An antibody only reacts with a matching antigen and with this specific antigen only. This high specificity enables direct analysis of complex sample mixtures, such as blood and urine. Loading… • The affinity of antibody to antigen is very high and binding occurs even at very low concentrations. Hence, immunoassays typically have high sensitivity (low limits of detection). 83 antibody Competitive immunoassays precipitation immons : sitety to precipitate • A limited amount of antibody is used, which is insufficient to bind with all the antigen molecules of the assay. • The sample containing an unknown amount of antigen is mixed with a fixed and known amount of labelled antigen. • The unlabelled and labelled antigens compete for binding to the antibody. ~little anfigen labelled antigen 84 Non-competitive immunoassays • The antigen sample is incubated with an excess of antibody reagent, hence not all the antibody binding sites will be occupied. • To detect the amount of antigen attached to an antibody, a second labelled antibody is added, which binds to another epitope of the antigen. • Non-competitive assays are better suited for large analyte molecules, which are likely to have several epitopes (at least two binding sites are required on the analyte molecule). ↑ antigen the , brighter the signal is going ti be . 85 Home Pregnancy Test Rich Dogs tr study embryo development . • The concentration of the hormone human chorionic gonadotropin (hCG) (which appears in the urine) increases rapidly during the first weeks of pregnancy. • The adsorbent test strip is encased in plastic with a sample input window, a test window, and a (positive) control window. • A drop of urine is applied at the input window and the liquid moves along the strip by capillary action. • There are two types of antibodies on the strip that recognize hCG – (1) the capture antibody that is covalently fixed to the device surface; (2) the tracer antibody, which is labelled with a dye and is impregnated on the surface but not permanently attached. 86 Home Pregnancy Test • If hCG is present, it forms a complex with the tracer antibody as the urine flows along the test strip. • The complex then continues to move along the adsorbent material and passes over the area with the immobilized capture antibody. • A sandwich is formed, with hCG in between the immobilized capture antibody and the tracer antibody. • The amount of sandwich complexes formed is directly proportional to the amount of hCG present. If the hCG concentration exceeds a threshold, the dye color becomes visible to the naked eye. Label 2 - gold haus particles that precipitate epiotes 87 Overview of ELISA In ELISA (enzyme-linked immunosorbent assay), the enzyme label acts as a catalyst for the conversion of a colourless substrate to a coloured product. One single enzyme molecule can catalyse the conversion of a large number of substrate molecules and thus generate a large signal. This signal amplification enables the quantitative analysis of low sample concentrations. For example, hormones in blood are often analysed with ELISA. 88 ELISA for HIV ↳ detects HIV antibodies in blood • HIV antigens are immobilized on the surface of a microtitre well. • The sample, possibly containing HIV antibodies, is added and then left to incubate. • After washing, a secondary antibody with an enzymatic label and targeted towards the HIV antibodies is added. This secondary antibody binds to the HIV antibodies, if they are present. • After another wash, the appropriate enzyme substrate is added. If any secondary antibodies are bound, then a colour reaction occurs. • The colour intensity can be measured with a spectrophotometer. e 89 Western Blot Northern iference betwee Sofhernt Western - : ↓ ⑪ needfipte Rielt an electric us passine transcen capillary by action Western Blot is a technique to detect specific proteins in a biological sample. It uses gel electrophoresis to separate proteins. The proteins are then transferred to a membrane (typically nitrocellulose or PVDF), where they are stained with antibodies specific to the target protein. The gel electrophoresis step is included in western blot analysis to resolve the issue of the cross-reactivity of antibodies. 90 Detection in Western Blot The secondary antibody is commonly linked to an enzyme called horseradish peroxidase (HRP). HRP catalyzes the conversion of chromogenic substrates into colored products, and produces light when acting on chemiluminescent substrates. In general, detection by chemiluminescent substrates is favoured. The sensitivity is 10- to 100-fold greater, and quantifying of light emission is possible over a wide dynamic range, whereas that for coloured precipitates is much more limited, about one order of magnitude less. Stripping filters are 91 also much easier when chemiluminescent substrates are used. Measuring protein stability Halk-like + - DRibosome inhibitor & patioactivity Pulse chaseexperiment : The half-life of a protein can be determined by a pulse-chase experiment: Pulse of 35S is added to cells followed by a chase of cold methionine. At regular time points, cells are harvested and lysed. The protein-of-interest is immunoprecipitated using an antibody. Half-life, t1/2 = ln2 / , where = degradation constant 92 Dresbinding spaligand the enhances taprotein a protein ↳ either at Thermal Shift Assay X-ray presence/absencecrystal lography pexperiment optimal . stability In liged done is grctural bobermolting Butter Dis Finding : . - ~ high : Best stabilityof binding high's unfolded proteins aggregates dyge At binds Duse , between ↓bording and prfein s protein At behydrophobertin , Duldets are bird residues protein Miscell expres hydropholest region zuenchednoteles binds fr hydrophobic residues ↓ bette