Lecture 4 - Nucleic Acid Analysis PDF

CH4306 Bioanalytical Techniques Assoc Prof TAN Meng How N1.2-B2-33 [email protected] 1 Lecture 4 – Nucleic Acid Analysis 2 Today’s Outline • Extraction of nucleic acids • Polymerase chain reaction (PCR) Loading… • Quantitative real-time PCR • Low throughput sequencing • High throughput seque...

CH4306 Bioanalytical Techniques Assoc Prof TAN Meng How N1.2-B2-33 [email protected] 1 Lecture 4 – Nucleic Acid Analysis 2 Today’s Outline • Extraction of nucleic acids • Polymerase chain reaction (PCR) Loading… • Quantitative real-time PCR • Low throughput sequencing • High throughput sequencing 3 1) 2) 3) Isolation of Nucleic Acids: Cell Lysis To isolate DNA and RNA from living cells, the cells themselves have to be broken apart to release their inner contents. Cellular walls may be ruptured in three different ways: more water outside By treatment with a hypotonic solution (which has lower solute concentration than inside the cell) -> mater enters call borts cell outside , By treatment with detergents, such as sodium dodecyl sulfate (SDS) or Triton X-100 By treatment with an enzyme that has cell lytic properties, such as lysozyme aftcells wi cell wall bacteria cell ↳ cellfase peptide glyeah wall breakdawn : ↳ cell wall plant break down . 4 • Separation of DNA by Cesium Chloride DNA can be separated from RNA and protein due to differences in buoyant density. ultracentridge requires drawing produm before spinning air & resistance as its -> spinning at pur ~high lightest density of fops Heavist af the bottom , • A sample is mixed with cesium chloride (CsCl) and centrifuged at very high speeds (e.g., 50,000 rpm) in an ultracentrifuge for many hours. • As the tubes spin, a stable, linear gradient of CsCl (with the lightest density at the top and the heaviest density at the bottom) is formed. • • Loading… Upon centrifugation, the different macromolecules in the sample form distinct bands depending on their buoyant densities: - RNA has a relatively high density and sinks to the bottom of the tube. - Proteins have a relatively low density and float on the top. - DNA molecules have an intermediate density and are thus concentrated close to the middle of the tube. lightest H 2'or sinks to the battin The separated DNA can be removed from the centrifugation tube with a syringe. 5 What are plasmids? The term, plasmid, was first coined in 1952 by the late American molecular biologist Joshua Lederberg, who was 33 years old when he won the 1958 Nobel Prize in Physiology or Medicine for discovering that bacteria can mate and exchange genes (bacterial conjugation). A plasmid is a small DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules. Plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. This provides a selection pressure for the organism to keep the plasmid. spe X - ·↳ plasmid-tminic Agical contene i Plasmids may be present in an individual cell in varying number, ranging from one to several hundreds. The normal number of copies of plasmid that may be found in a single cell is called the copy number. bind o replication machinery well id origins don't they have four capy # . , 6 Isolating plasmids using CsCl c superciled swinded • CsCl density gradient centrifugation is capable of separating chromosomal DNA from plasmid DNA in the presence of ethidium bromide. • This fluorescent intercalator binds between the two DNA strands. Upon binding, it causes a decrease in buoyant density due to the partial unwinding of the double helix. • More ethidium bromide is bound to the linear, chromosomal DNA than the supercoiled, plasmid DNA. Hence, the density of chromosomal DNA decreases by 0.125g/ml, whereas the density of plasmid DNA decreases by only 0.085g/ml. This difference is sufficient to resolve the two types of DNA. • Ethidium bromide fluoresces upon irradiation with UV light. This effect is used to visualise the two bands. Higher band lower band Supercoiled DNA 7 Isolation of plasmids using miniprep • Minipreparation of plasmid DNA (frequently called “miniprep”) is a rapid, small-scale isolation of plasmid DNA from bacteria. • Buffer B1 contains RNase A to degrade RNA in the sample. It also contains EDTA, which chelates divalent cations (Mg2+ and Ca2+). Since these cations are required for DNase activity, EDTA helps to preserve the integrity of the DNA. DNAseneedMg4/cat Par action DNAast cannot perfor . . • Buffer B2 contains SDS, which solubilizes the cell membrane, and NaOH, which denatures DNA. SDS also helps to remove any proteins from the DNA. • Buffer B3 contains potassium acetate, which decreases the alkalinity (pH) of the solution. When why this happens, smaller pieces of DNA (e.g. plasmids) range atten when H plasmid neanneal can be renatured. Since it is impossible to properly small large DNA cannot Leanneal When anneal large pieces of genomic DNA, they remain vortex crazily itlareals genomic DNA causing single-stranded and stick with SDS and denatured if to meanneal cellular proteins through hydrophobic interactions, - - is , can . . 8 • • v Phenol-chloroform extraction Phenol and chloroform can be used to purify DNA or RNA. organic Phenol is added to the aqueous sample containing proteins and nucleic acids. Since phenol and water are generally immiscible, two phases are formed. Phenol is the more dense of the two liquids so it sits on the bottom. ↳ doesn't mix Vortex : rigorouslyto Racephen into agressphase . • The phases are then mixed thoroughly. This forces the phenol into the water layer where it forms an emulsion of droplets throughout. The proteins are denatured by the phenol and partition into the organic phase, while the nucleic acids stay in the water. • Then, the mixture is centrifuged and the phases separate. The aqueous phase containing DNA/RNA can now be collected and the phenol/protein solution is discarded. slightly solublein water , -contamination can occor 9 Phenol-chloroform extraction • Although phenol and water are generally immiscible, a small amount of phenol can still dissolve in the water, thereby contaminating the DNA/RNA solution. • To remove any residual phenol, the solution is mixed well with another organic solvent, chloroform, and then centrifuged. Any contaminating phenol will be partitioned into the organic phase. Subsequently, the aqueous phase is collected. • To purify the nucleic acids, they are precipitated with either ethanol or isopropanol. Often, glycogen is added as a carrier to aid in the precipitation. The precipitate is washed and resuspended in a water or a suitable buffer. • If RNA is desired, the solution is treated with Dnase. However, if DNA is desired, the solution is treated with RNAse instead. Phenol and chloroform are both hazardous and volatile chemicals, so the experiment must be performed in the fume hood with appropriate protective wear. • sometimes glyesgen cames my blue dye to track 10 Polymerase Chain Reaction (PCR) Polymerase chain reaction (PCR) is a method by which a few fragments of DNA can be duplicated into millions in a few hours. This makes PCR a very useful method in forensic science, as it means that very small amounts of DNA found in blood or hair samples, could be amplified and sequenced to reveal a person's identity. Loading… Today, PCR is a central technique in biochemistry and molecular biology. The inventor of PCR was awarded a Nobel Prize in 1993. 11 Overview of how PCR works A Common Objective of PCR Original DNA template: ATG TAA Aim to have many copies of a particular gene: ATG TAA 13 First cycle - anneal ATG TAA 14 First cycle - extend ATG TAA 15 Second cycle - anneal ATG TAA 16 Second cycle - extend ATG TAA 17 Focus on newly synthesized strands ATG TAA 18 Third cycle - anneal ATG TAA 19 Third cycle - extend ATG TAA 20 Fourth cycle - anneal ATG TAA 21 Fourth cycle - extend ATG TAA 22 Typical PCR conditions 1) Ensure all DNA molecules are denatured 2) Heat activate “Hot Start” DNA polymerase Annealing temperature can be adjusted. HotstartDNA polymerase - has an antibody conjogated at the active site 95oC for 3 minutes ↳ Denatories antibody osed because mostDNA pul has a base level activity at This is . which shots rom temp · apactivity at rose temp . } 95oC for 30 seconds 60oC for 30 seconds 30 cycles 72oC for 1 minute is DewaterMerete epE 72oC for 5 minutes time IRAM A pilymerase 4oC hold G To continue the experiment latos To chill the Dep machine . 23 ↓ Final 22 for another TMH course Designing PCR Primers needed to amplify • GC content = 40-60% constrained by • Tm is usually between 50 to 65oC (the Tm for the forward and reverse primers should be similar) preperably • Length of each primer is usually between 15 to 30 nucleotides better • Sequences are ideally unique Longer the primer binds tosensitivity likely that • Example of a gene: what -> ↳useless criteria : is primer 20 , 70 Short more other bases- GGCAGCCCAGTTTCGCGAAGGCTGTCGGCGCGCCGCGGCCCGCAGGCACCC GGCACGCGCCTTCCCCGCAGGCACCCGGCACGCGCCTTCCCCGCCGCCACG ATGCCCAAGAGGAAGGTCAGCTCCGCCGAAGGCGCCGCCAAGGAAGAGCCC AAGAGGAGATCGGCGCGGTTGTCAGCTAAACCTCCTGCAAAAGTGGAAGCG AAGCCGAAAAAGGCAGCAGCGAAGGATAAATCTTCAGACAAAAAAGTGCAA ACAAAAGGGAAAAGGGGAGCAAAGGGAAAACAGGCCGAAGTGGCTAACCAA GAAACTAAAGAAGACTTACCTGCGGAAAACGGGGAAACGAAGACTGAGGAG AGTCCAGCCTCTGATGAAGCAGGAGAGAAAGAAGCCAAGTCTGATTAATAA CCATATACCATGTCTTATCAGTGGTCCCTGTCTCCCTTCTTGTACAATCCA GAGGAATATTTTTATCAACTATTTTGTAAATGCAAGTTTTTTAGTAGCTCT Forward primer: ATGCCCAAGAGGAAGGTCAGCT Reverse primer: TTAATCAGACTTGGCTTCTTTCTCTCCTGC Site-directed mutagenesis in Mismatch between primers (w/ motation the middle sp the amplification primed Drilling-circle . autant CE (11) . original plasmid is methylatedDNA . Extendthe primer lewithfoenbone watching Site-directed mutagenesis is a molecular biology method that is used to make specific and intentional changes to the DNA sequence of a gene and any gene products. Motation in confor , extend primer length . DpnI restriction site: get Get rid o original template Insta perfect circle staggered nick cat the end&2 , rid op siginal plasmid thereis a , primers cli cells repair the 25 wisks E . . : Number of DNA copies In theory, the number of DNA copies is doubled during each cycle, resulting in an exponential amplification. The theoretically predicted number of DNA molecules, Nm, at the end of the reaction depends on the initial number of DNA copies, N0, in the reaction mixture and the number of cycles, n: However, this theoretical number is never achieved due to a number of limiting factors, including the depletion of the reagents and the amplification of longer strands during the first few cycles. In practice, the number of DNA molecules can be approximated by the following equation: 1 Reality doesn't dable everytime . where x is the efficiency of the reaction. It can have a value between 0 and 1. 26 Amplification curve As the reaction proceeds, a plateau (saturation) phase is reached. Continued thermal cycling does not lead to the production of significant amounts of product anymore. There are several reasons for this: (1) (2) Depletion of the reagents, i.e. the depletion of primers and nucleotides. Phosphates that are released, during the reaction act as inhibitors to the ↳ inhibits enzyme. prymeraseAngeles usewhereatteene (3) The DNA polymerase deteriorates after repeated cycling. (4) Another limiting factor is that hybridisation of longer strands of DNA occurs at higher temperatures than hybridisation of a ssDNA and a primer. Thus, as the reaction mixture is cooled down after denaturation from 95 to 60oC, two ssDNA can hybridise to form dsDNA before any primer annealing can take place. competes free 27 Mons harder Moreantisenstat get , Dar A I watchingthe machine as it progresses . Real-time PCR How muchopatargetwe have at the beginning? • In regular PCR, one is only concerned about the final product. • However, sometimes we want to obtain more information from a PCR. For example, which one of the four samples shown on the left has the most amount of starting template? • To answer the question, we need to monitor the formation of products as the reaction proceeds. Usually a fluorescent marker is employed. The increase in products after each cycle can be recorded as an increase in fluorescence. • The PCR reaction is placed into a real-time PCR machine that watches the reaction occur with a camera or detector. 28 Monitoring formation of PCR products To track the progress of a PCR reaction, one can choose from three major detection schemes. Most people use either an intercalating dye (e.g. SYBR green) or a hydrolysis probe (e.g. Taqman). Another method that relies on two hybridization probes can also be used. All three technologies are designed to generate fluorescence during the PCR, which allows your real time PCR machine to monitor the reaction in “real time”. Loading… ↳ has target & spinterest does not have target op interest . 29 Detection Method 1 i) kinds to any double-strandedDNA SYBR green is by far the most commonly used intercalating dye. The dye is weakly fluorescent in it’s own right but in the presence of double stranded DNA, the dye intercalates with (binds into) the DNA double helix. This alters the structure of the dye and causes it to fluoresce much more. As the PCR creates more DNA, more dye can bind and more fluorescence is generated. genericRNA binding dye, but of doesn't ensome that a specific Rewnside itis : a target is amplified 30 infact prope Detection Method 2 not Plosrescent as avenchers is ~ close to floorphone quenches signal . In the hydrolysis probe technique, both ends of the probe have molecules attached. The 5’ end of the probe is labelled with a fluorescent reporter molecule (e.g. FAM is a green reporter that is commonly used). On the 3’ end of the probe is a quencher molecule that effectively absorbs the fluorescence from the reporter fluorochrome. Therefore, when the reporter and quencher are physically close to each other (i.e. the probe is intact), the overall level of fluorescence output is low. Tag + Tagpolymerase like Daeman - it dows the away probe - . Tagman During the PCR, the probe binds downstream of the primer. The probe is then cleaved by the polymerase enzyme during the reaction due to the exonuclease activity of the polymerase. By cleaving the probe the reporter and quencher are separated, which means that the quencher no longer has its effect over the reporter and the level of fluorescence increases. Hence, with every cycle of PCR, more probe is cleaved and 31 more fluorescence is generated. Detection Method 3 used when asisanne notcommon is a Two sequence-specific oligonucleotide probes, labeled with different dyes, are used. The two probes are designed to bind to adjacent sequences in the target. A donor dye is attached to the 3' end of the first probe, while an acceptor dye is attached to the 5' end of the second probe. As a result, the two dyes are in close proximity. During real-time PCR, excitation is performed at a wavelength specific to the donor dye. For example, fluorescein (the donor dye) can be excited by a blue light source and emits green fluorescent light at a slightly longer wavelength. At close proximity, the energy emitted from the first (donor) probe excites the acceptor dye attached to the second hybridization probe that is only 1–5 nucleotides away. The acceptor dye then emits fluorescent light at a different wavelength. The reaction is monitored at the emission wavelength of the acceptor dye during the annealing phase. After each subsequent PCR cycle, more hybridization probes can anneal, resulting in higher fluorescence signals. 32 Melting curve analysis ↳ non-specific amplification&auwnside) Researchers often use melting curve analysis to assess whether their SYBR green-based real-time PCR assays have produced single, specific products. It is an assessment of the dissociationcharacteristics of double-stranded DNA during heating. As the temperature is raised, the double strand begins to dissociate, leading to a change in fluorescence intensity. proble-prak eat celuepchabts popiduc pesired ↳ : I The temperature at which 50% of DNA is denatured is known as the melting point. Every PCR product has its own unique melting point. ↳ single peak : might also have more w/ close melting print . Melting curve analysis is fast, but not always accurate. To confirm, one should always run the PCR products on an agarose gel. 33 Reverse Transcription The classic view of the central dogma of biology states that “the coded genetic information hard-wired into DNA is transcribed into individual transportable cassettes, composed of messenger RNA (mRNA); each mRNA cassette contains the program for synthesis of a particular protein (or small number of proteins).” RT Reverse transcription is the synthesis of single-stranded DNA (complementary DNA, or cDNA) using single-stranded RNA as a template, mediated by reverse transcriptases (RTs). The cDNA can be used as a template for amplification by PCR or to generate a cDNA library. 34 Retroviruses A retrovirus is a virus that uses RNA and not DNA as the genetic material. It replicates in a host cell through the process of reverse transcription. The virus uses its own reverse transcriptase enzyme to produce DNA from its RNA genome Examples of retroviruses include: (1) Rous sarcoma virus, which carries a src oncogene (encoding a tyrosine kinase) (2) Human immunodeficiency virus (HIV), which infects immune cells and causes the immune system to eventually fail (3) Hepatitis virus, which affects the functioning of the liver and is readily transmitted through contaminated food like raw cockles 35 Differential gene expression • Recall that genes can be expressed at different levels. In the example below, gene A is transcribed and translated much more efficiently than gene B. We can determine the transcript levels of gene A and gene B: - Reverse transcribe the RNA into cDNA Set up real-time PCR using the cDNA as a template ↓ complementary DNA : reverse transcribed RNA 2) Threshold cycle What is a Ct value? In real-time PCR, there is some background fluorescence, in addition to the true signal. We need to eliminate this background in order to glean meaningful information from the experiment. Detect Porescence value in inversely proportionate to the aut of target at the right the beginning Ct is at over backgroud · . To do so, we (or the software in the real-time PCR machine) set a threshold level, known as the Ct value (or “threshold cycle”). It indicates the number of cycles it took to detect a real signal (above background fluorescence) from your samples and is usually somewhere in the beginning of the exponential phase of the amplification. Ct values are inversely proportional to the amount of targeted nucleic acid that is in your sample. 37 Measuring gene expression – Absolute quantification ↳ Boild a calibration core . A standard curve is generated using known amounts of target DNA (the Ct value is measured for each reaction containing a known amount of DNA). Results from actual experiments are compared with the standard curve. 38 Measuring gene expression – Relative quantification • • Absolute quantification can be cumbersome. Frequently, we want to measure the expression levels of many genes. Additionally, the genes that we want to examine will change from experiment to experiment. It is tedious to generate multiple standard curves. -compare value against a housekeeping gene - bette tested A popular and faster alternative is relative quantification. First, we choose a gene that we believe is stably expressed in the biological context under investigation. Such a gene is known as a housekeeping gene. Common housekeeping genes include GAPDH and ACTB. All Ct Gaytskeleton values are normalized to that of the housekeeping gene (e.g. Ct of elements expression level gene A minus Ct of GAPDH). Second, we choose a baseline experimental condition, for example the first timepoint of a timecourse experiment or an unperturbed state. All other experimental conditions cells normal (ACTB) are normalized to this baseline. ① ↳expressio is in a cell - e cancer I neuronal differentiation Rom pluripotent (cannsture ACTB • Note that it is important to select the correct housekeeping gene. 39 Normalized expression of a gene In quantitative real-time PCR (qRT-PCR), the amplification of a targeted DNA molecule is monitored continuously throughout the reaction (i.e. in real-time). In contrast, in conventional PCR, one only checks the final amplification products at the end. To calculate fold changes in gene expression, we can apply the following: Fold change = 2- ( Ct) where Ct = Cttarget Cthousekeeping ( W Ct) = Ctexperiment Ctcontrol L E L I - L Example of qPCR Lung Tumor ↳ amplified in Every sample is Normal Lung Lung Cancer baded s times. taken the and 41 Final exam calculate (lectore 4) &*: know how to Example of qPCR - calculations calculate Rold Dop gene-Pinal exam Highly expressed herskeaping gane 2 5 - 807 - - 17 . 928 2618 . - 828 5 82 - - . 3 2- 21 788 . Above 1 : up-regulated Less than 1 : - 2 N Downregulated 42 . qPCR assay for COVID-19 43 Disadvantages of qPCR • The qPCR equipment is expensive (> S$20,000). Hence, poorer communities will not be able to afford the instruments. • Trained personnel with technical know-how are also needed to operate the specialized equipment and interpret the results. • Furthermore, qPCR has a slow turnaround time. Even excluding the time needed to transport samples to centralized test facilities, it usually takes around 2 hours to set up and run the reactions. 44 Loop-Mediated Isothermal Amplification (LAMP) c: complement Findin argate patent just expired ↑ are : primers, Bind behind primer F3 : displacement primer e ↳BSP polymerase Strand ~ Thes a displacing activity intramolecular hybridization & same as Forward interns o properties - intramolecular hubrizetich Free extends by self priming concativate into magers bugerchains latter pattorn o multiple domb bett . 45 Direct RT-LAMP assay for COVID-19 46 Colorimetric detection of LAMP products string reagent at norm temp also can furn it to orange . For new nedestrieto comein . • A proton is released with every dNTP that is incorporated. • In the presence of a lightly buffered solution, this leads to a decrease in pH, due to the large amount of DNA made in LAMP. • at neutral pink, dpH : orange 47 Addition of a pH indicator into the reaction enables visual detection of products. Use of probe to enhance specificity arenche I Plotrophone Colorimetric LAMP is prone to false positives. To increase target specificity, an additional probe (such as a molecular beacon) can be added. ↳ cop region Don incorporates a RNAest The cleavable hairpin beacon (CHB) is like the molecular beacon, except that a few ribonucleotides are used in its loop. Upon binding to the target, a short region of RNA-DNA duplex is created. Hence, an RNAse H enzyme can be added to cleave the RNA, permanently separating the fluorophore from the quencher. wo plorescence close fgf Both Ruarphone Squencher are 48 . , Maxam-Gilbert sequencing 3/ 223 32 H2K Difficult to ↑ a automator use wohagerin , A A a G a galreadbutta A betterfas-l o argest sequencing : 7 2 2 Brasmallest - , 49 L sequencing by synthesis Sanger sequencing . depends an chain termination by AdNTP C will be incoporated TAG GA AT D ② Dow Pe will S products be terminated straight away A . T A G 9 A T C 50 Pyrosequencing y conting #ed pyrophosphates released . • Pyrosequencing is a method of DNA sequencing based on the "sequencing by synthesis" principle. • It differs from Sanger sequencing, in that it relies on the detection of pyrophosphate release on nucleotide incorporation, rather than chain termination with dideoxynucleotides. • It was developed in the late 1990s by Pål Nyrén and Mostafa Ronaghi in Sweden and formed the basis of the 454 high throughput DNA sequencing machine, which was used to decipher the genome of James Watson in 2007. 51 How does pyrosequencing work? template • Biotinylated single-stranded DNA is immobilized on streptavidin-coated beads. • A primer is hybridized to one end of the single strand. • The following four enzymes are added to the reaction mixture: - DNA polymerase - ATP sulfurylase - Luciferase - Apyrase degrades nucleotide -> • The following two substrates are added to the reaction mixture: - Adenosine 5’ phosphosulfate (APS) -> Iphosphatef/supate qp - Luciferin • Next, one of the four deoxynucleotide triphosphates (dNTPs), dATP, dGTP, 52 dCTP or dTTP, is added to the reaction mixture. How does pyrosequencing work? • If the nucleotide is complementary to the next base in the strand, then DNA polymerase catalyses its incorporation, with the release of a pyrophosphate (PPi). • The amount of PPi released is equimolar to the amount of nucleotide incorporated. For example, if three nucleotides are incorporated, then three molecules of PPi are released. • However, a limitation of pyrosequencing is that large numbers of the same base in a row, homopolymeric regions, cannot be detected easily. Homopolymeric regions longer than 10 bases cannot be resolved. camera just sees that it is to - bright . 53 • How does pyrosequencing work? The release of PPi triggers a series of enzyme-catalysed reactions: (1) The enzyme ATP sulfurylase catalyses the reaction of PPi with the substrate APS to form adenosine triphosphate (ATP). (2) The enzyme luciferase catalyses the reaction of ATP with the substrate luciferin, generating oxyluciferin and visible light. • This light can be detected by a charged coupled device (CCD) camera as a peak in a so-called pyrogram. • Any excess nucleotide dNTP and any excess ATP are degraded by the nucleotide degrading enzyme apyrase to their respective mono-and diphosphates. • When degradation is complete, the next dNTP can be added. The addition of dNTPs is performed iteratively, one at a time. • The natural dATP was found to interfere with the luciferase reaction and so deoxyadenosine α-thio triphosphate (dATP-αS) is used instead. 54 Summary of pyrosequencing Limitations : > 18 55 Development of new sequencing technologies is one of the biggest breakthroughs of the 21st century Rapidly decreasing costs of sequencing – outpacing Moore’s Law The global NGS market is growing rapidly • From $1.3B in 2012 to almost $3B in 2017. • Asian market is growing the fastest • Its market share increased from 18% in 2012 to 22.5% in 2017. • The current market leader is Illumina, but there are new companies emerging. 58 An overview of Illumina sequencing • Millions of DNA molecules are immobilized on a surface • On the popular Illumina machine, sequencing by synthesis is employed with fluorescently-labeled nucleotides Illumina sequencing uses reversible terminators Indestite is blocked at any time . 60 Identifying nucleotide sequences Each SNA is Great T w G sped fast s milecote sequenced that . yellow A 61 Transcriptome analysis – RNA sequencing ↳aue • Disadvantages of DNA microarrays: - Requires a priori knowledge of the transcripts - Cannot be used to quantify highly expressed genes, as probes will have saturated - Background noise from cross-hybridization can be high - Low information content • RNA-seq utilizes ultra-high throughput sequencing technology to provide a snapshot of the RNA presence and quantity in a cell. • RNA-seq overcomes the weaknesses of DNA microarrays. • Since the actual sequences of individual RNA molecules are revealed, one can use the information to study: nearly expressed genes are hardt - alternatively spliced transcripts detect as they get - post-transcriptional modifications, like RNA editing out competed - gene fusions or novel transcripts - mutations or SNPs - changes in gene expression are lowly . Non-coding RNAs genes : expressed An overview of RNA-seq Selection of desired RNA population (usually polyA RNA or rRNA-depleted RNA) Fragmentation of RNA (if using random hexamers) First strand synthesis (reverse transcription) Second strand synthesis End repair Addition of ‘A’ base to 3’ ends Adapter ligation Library amplification (including barcoding) 63 Depletion of rRNAs RNAaSe My Ribosomal RNAs (rRNAs) are highly abundant in the cell. They will dominate most of the sequencing reads. However, most researchers are not interested in rRNAs. Hence, there is a need to get rid of rRNAs from the total RNA pool before proceeding with library construction. 64 Selection of desired RNA species Alternatively, many researchers will like to study protein-coding genes. To do so, they have to select specifically for mRNAs. Since mRNAs are polyadenylated at their 3’ends, they can use oligo(dT) beads to pull out the mRNAs. poly-A-tail selection 65 First strand cDNA synthesis with oligo(dT) 66 Second strand synthesis -> starts degrading RNA . Reaction is performed at 16oC. and strand at lower is performed c Ribonuclease H (RNase H) is a family of non-sequence-specific endonucleases that catalyze the cleavage of RNA. It specifically degrades only the RNA in RNA:DNA hybrids. 67 First strand synthesis with random hexamers A problem with using an oligo(dT) primer for first strand synthesis is that the sequencing library often ends up with a strong 3’ end bias. This is because to capture an entire transcript, the quality of the RNA must be very high (i.e. there must be no degradation). To circumvent the problem, one may use random hexamers instead. Randomly bind 1st strand synthesis 2nd strand synthesis 68 Obtaining an Illumina library After 2nd strand synthesis, the dsDNAs are phosphorylated at their 5’ ends, followed by the addition of an ‘A’ at their 3’ ends using an N-terminal truncation of DNA polymerase I (known as Klenow fragment) that retains polymerase activity but has lost exonuclease activity. commen sequences staggered ends are Dor ligation than adaptery- ↳complementas complementat better plontends ab part Y-shaped queveled arms nat · s I nottheare ands , sequencie e 69 Y-shaped adapters I ams o 5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’ |||||||||||| Base 3’ CACTGACCTCAAGTCTGCACACGAGAAGGCTAG 5’ paring Patmsgy Library insert: 5’ NNNNNN......NNNNNNA 3’ |||||| |||||| 3’ ANNNNNN......NNNNNN 5’ arms of y ( 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 3’ |||||||||||| armsYG 3’ TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA 5’ 70 Library amplification Universal forward primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC 18 cycle synthesized : s strand tp neverse 2nd cycle synthesize top : strand . 5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’ |||||||||||| 3’ CACTGACCTCAAGTCTGCACACGAGAAGGCTAG 5’ Reverse primer with barcode: Barco de poll6 di samples - to differentiate each sample CAAGCAGAAGACGGCATACGAGAT(barcode)GTGACTGGAGTTCAGACGTG Reverse 5’ ↓ complements barcode, : Basa pairs GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 3’ |||||||||||| 3’ TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA 5’ 71 Final library structure how understand libraries . to get 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT – 3’ TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA - (Bold orange: universal forward primer) - Library insert - AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC(barcode)ATCTCGTATGCCGTCTTCTGCTTG 3’ - TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG(barcode)TAGAGCATACGGCAGAAGACGAAC 5’ (Bold purple: reverse primer with barcode) 72 The UCSC Genome Browser (http://genome.ucsc.edu/) Importance of strand information Do sequencing reads that map here originate from the MUTYH or TOE1 gene? 74 Using dUTP to create strand specificity replace dTTP WI dO TP : 75 Removing the marked second strand digests away -> Uracil-DNA glycosylase (UDG), also known as uracil N-glycosylase (UNG), exists ubiquitously among prokaryotes and eukaryotes. It prevents mutagenesis by eliminating uracil from DNA molecules (uracil bases occur in DNA from cytosine deamination). purple 76 Stranded mRNA-seq PolyA selection Fragmentation of RNA First strand synthesis (reverse transcription) Second strand synthesis using dUTP instead of dTTP End repair Addition of ‘A’ base to 3’ ends Adapter ligation Treatment with UDG Library amplification (including barcoding) 77