Vision Collage of Medicine Year 2 Level 3 Lecture 10 Mutation 1 PDF

# Vision Collage of Medicine ## Year 2 Level 3 Lecture 10 ### Mutation 1 By Dr. Ezat Mersal ## Objectives - Gene mutation - Types of gene mutation - Consequences of mutations ## Mutations Mutation: a change in the sequence of an organism's genetic material. ### Mistakes in DNA replication (Mutat...

# Vision Collage of Medicine ## Year 2 Level 3 Lecture 10 ### Mutation 1 By Dr. Ezat Mersal ## Objectives - Gene mutation - Types of gene mutation - Consequences of mutations ## Mutations Mutation: a change in the sequence of an organism's genetic material. ### Mistakes in DNA replication (Mutation) DNA replication is not perfect. Errors occur in DNA replication, when the incorrect base is incorporated into the growing DNA strand. This leads to mismatched base pairs, or mispairs. DNA polymerases have proofreading activity, and a DNA repair enzyme has evolved to correct these mistakes. Occasionally, mispairs survive and are incorporated into the genome in the next round of replication. These mutations may have no consequence, they may result in the death of the organism, they may result in a genetic disease or cancer, or they may give the organism a competitive advantage over its neighbors, which leads to evolution by natural selection. © 2015 John Wiley & Sons, Inc. All rights reserved. ## Types of Mutations ### 1. Synonymous Mutation Nucleotide sequence is changed, protein sequence is the same. Since genetic code is degenerate, different codons can code for the same amino acid. Synonymous mutations do not affect functioning of the gene product. ``` GUCAUGUUUAGCUCAAUCAGGAAGUGU Val Met Phe Ser Ser Ile Arg Lys Cys GUCAUGUUCAGCUCAAUCAGGAAGUGU Val Met Phe Ser Ser Ile Arg Lys Cys ``` wild type mutant © 2015 John Wiley & Sons, Inc. All rights reserved. ### 2. Missense Mutation Substitution of a nucleotide in the gene sequence that results in substitution of an amino acid in the encoded protein. Nonsense mutations may or may not affect the functioning of the gene product. ``` GUCAUGUUUAGCUCAAUCAGGAAGUGU Val Met Phe Ser Ser Ile Arg Lys Cys GUCAUGUUGAGCUCAAUCAGGAAGUGU Val Met Leu Ser Ser Ile Arg Lys Cys ``` wild type mutant © 2015 John Wiley & Sons, Inc. All rights reserved. ### 3. Nonsense Mutation Substitution of a nucleotide in the gene sequence that results in generation of a stop codon. Only truncated protein can be produced from the mutant gene. Nonsense mutations usually lead to the production of inactive gene product. | DNA level | TTC | ATC | |------------|-------|-------| | mRNA level | AAG | UAG | | Protein level | Lys | STOP | In the m RNA, the three stop codons are: UAA / UAG/UGA © 2015 John Wiley & Sons, Inc. All rights reserved. Here is a diagram of the structure for a nonsense mutation: **Normal:** mRNA: AUGAAGUUUGGCGCUAUUGCAG Protein: Met Lys Phe Gly Ala Leu Gln **Nonsense:** mRNA: AUGUAGUUUGGCGCUAUUGCAG Protein: Met STOP **Nonsense Mutation** © 2015 John Wiley & Sons, Inc. All rights reserved. ### 4. Frame-shift Mutation Addition or deletion of a nucleotide in the gene sequence results in a change in the reading frame. A significant part of the encoded protein can have an incorrect amino acid sequence. Frame-shift mutations usually lead to the production of an inactive gene product. ``` GUCAUGUUUAGCUCAAUCAGGAAGUGU Val Met Phe Ser Ser Ile Arg Lys Cys GUCAUGUUUAAGCUCAAUCAGGAAGUGU Val Met Phe Lys Leu Asn Gln Glu Val ``` wild type mutant added nucleotide © 2015 John Wiley & Sons, Inc. All rights reserved. ### Point Mutations - Silent - Nonsense - Missense (conservative, non-conservative) Here is a diagram of the structure for point mutations: | DNA level | TTC | TTT | ATC | TCC | TGC | |------------|-------|-------|-------|-------|-------| | mRNA level | AAG | AAA | UAG | AGG | ACG | | Protein level | Lys | Lys | STOP | Arg | Thr | © 2015 John Wiley & Sons, Inc. All rights reserved. ### 5. Promoter Mutation Can alter the regulation of transcription or translation. Can also, decrease the affinity of RNA Polymerase for a promotor site, so the result is a decreased product of protein. ### 6. Transcription Factors Genes or Enhancer Sequences Mutations The result is a decreased product of protein. ### 7. Splice Site Mutations Those that occur in intron-exon boundaries, alter the splicing signal that is necessary for proper excision of an inton. © 2015 John Wiley & Sons, Inc. All rights reserved. ## Consequences of mutations ### Most mutations are neutral - 97% DNA neither codes for protein or RNA, nor indirectly affects gene function - A new variant in the 1.5 coding regions may or may not result in a change in amino acid - Variants that change amino acid may not affect function ### Certain mutations have functional effect and even cause disease - Gain-of-function mutations often produce dominant disorders - Loss-of-function mutations result in recessive disease - Missense mutations differ in severity - Conservative amino acid substitution substitutes chemically similar amino acid, less likely to alter function - Nonconservative amino acid substitution substitutes chemically different amino acid, more likely to alter function - Consequences of mutations vary and are often context-specific - Nonsense mutation results in premature termination of translation - Truncated polypeptides often are nonfunctional - Point mutation in non-coding region may affect transcription, RNA splicing, and protein assembling © 2015 John Wiley & Sons, Inc. All rights reserved. ## Mutation and Genetic Variation - For every gene, there are many different alleles. - Alleles are versions of the same gene that differ in their DNA base sequence. - Alleles are generated by mutations, which are changes in the DNA base sequence. © 2015 John Wiley & Sons, Inc. All rights reserved. ## Genetic Variations Cause Inherited Diseases | | | | |--------|-----------|-------------| | **Genetic Diseases** | **Complex Diseases** | **Environmental Diseases** | | Cystic fibrosis | Alzheimer disease | Influenza | | Down syndrome | Cardiovascular Disease | Hepatitis | | Sickle cell disease | Diabetes (type 2) | Measles | | Turner syndrome | Parkinson Disease | | © 2015 John Wiley & Sons, Inc. All rights reserved. ## Reference Books - Basic genetics : a human approach / BSCS. Dubuque, IA, Kendall/Hunt Pub. Co., c1999. 147 p. QH431.B305 1999 - Genes, ethnicity, and ageing. Edited by Lincoln H. Schmitt, Leonard Freedman, Rayma Pervan. Nedlands, Australia, Centre for Human Biology, University of Western Australia; Singapore, River Edge, NJ, World Scientific, c1995. 100 p.QH455.G45 1995 - Genetic polymorphisms and susceptibility to disease. Edited by M. S. Miller and M. Т. Cronin. New York, Taylor & Francis, 2000. 266 p.