Introduction to Molecular Genetics and Genomics PDF

C H A P T E R 1 Introduction to Molecular Genetics and Genomics CHAPTER OUTLINE PRINCIPLES 1.1 DNA: The Genetic Material Inherited traits are affected by genes. Experimental Proof of the Genetic...

C H A P T E R 1 Introduction to Molecular Genetics and Genomics CHAPTER OUTLINE PRINCIPLES 1.1 DNA: The Genetic Material Inherited traits are affected by genes. Experimental Proof of the Genetic Function of DNA Genes are composed of the chemical deoxyribonucleic acid Genetic Role of DNA in (DNA). Bacteriophage DNA replicates to form copies of itself that are identical 1.2 DNA Structure: The Double Helix (except for rare mutations). 1.3 An Overview of DNA Replication DNA contains a genetic code specifying what types of enzymes and other proteins are made in cells. 1.4 Genes and Proteins Inborn Errors of Metabolism as a DNA occasionally mutates, and the mutant forms specify Cause of Hereditary Disease altered proteins that have reduced activity or stability. Mutant Genes and Defective Proteins A mutant enzyme is an “inborn error of metabolism” that 1.5 Gene Expression: The Central Dogma blocks one step in a biochemical pathway for the metabolism Transcription of small molecules. Translation The Genetic Code Traits are affected by environment as well as by genes. 1.6 Mutation Organisms change genetically through generations in the Protein Folding and Stability process of biological evolution. 1.7 Genes and Environment 1.8 Evolution: From Genes to Genomes, from Proteins to Proteomes The Molecular Unity of Life Natural Selection and Diversity CONNECTIONS Shear Madness Alfred D. Hershey and Martha Chase 1952 Independent Functions of Viral Protein and Nucleic Acid in Growth of Bacteriophage The Black Urine Disease Archibald E. Garrod 1908 Inborn Errors of Metabolism 1  E ach species of living organism has a unique set of inherited characteristics that makes it different from other species. Each species has its own develop- mental plan—often described as a sort of terms of the abstract rules by which heredi- tary elements (he called them “factors”) are transmitted from parents to offspring. His objects of study were garden peas, with variable traits like pea color and plant “blueprint” for building the organism— height. At one time genetics could be stud- which is encoded in the DNA molecules pre- ied only through the progeny produced sent in its cells. This developmental plan from matings. Genetic differences between determines the characteristics that are in- species were impossible to define, because herited. Because organisms in the same organisms of different species usually do not species share the same developmental plan, mate, or they produce hybrid progeny that organisms that are members of the same die or are sterile. This approach to the study species usually resemble one another, al- of genetics is often referred to as classical ge- though some notable exceptions usually are netics, or organismic or morphological ge- differences between males and females. For netics. Given the advances of molecular, or example, it is easy to distinguish a human modern, genetics, it is possible to study dif- being from a chimpanzee or a gorilla. A hu- ferences between species through the com- man being habitually stands upright and has parison and analysis of the DNA itself. There long legs, relatively little body hair, a large is no fundamental distinction between clas- brain, and a flat face with a prominent nose, sical and molecular genetics. They are dif- jutting chin, distinct lips, and small teeth. ferent and complementary ways of studying All of these traits are inherited—part of our the same thing: the function of the genetic developmental plan—and help set us apart material. In this book we include many ex- as Homo sapiens. amples showing how molecular and classi- But human beings are by no means cal genetics can be used in combination to identical. Many traits, or observable charac- enhance the power of genetic analysis. teristics, differ from one person to another. The foundation of genetics as a molecu- There is a great deal of variation in hair lar science dates back to 1869, just three color, eye color, skin color, height, weight, years after Mendel reported his exper- personality traits, and other characteristics. iments. It was in 1869 that Friedrich Some human traits are transmitted biologi- Miescher discovered a new type of weak cally, others culturally. The color of our acid, abundant in the nuclei of white blood eyes results from biological inheritance, but cells. Miescher’s weak acid turned out to be the native language we learned as a child the chemical substance we now call DNA results from cultural inheritance. Many (deoxyribonucleic acid). For many years traits are influenced jointly by biological in- the biological function of DNA was un- heritance and environmental factors. For known, and no role in heredity was as- example, weight is determined in part by cribed to it. This first section shows how inheritance but also in part by environ- DNA was eventually isolated and identified ment: how much food we eat, its nutri- as the material that genes are made of. tional content, our exercise regimen, and so forth. Genetics is the study of biologically inherited traits, including traits that are in- fluenced in part by the environment. 1.1 DNA: The Genetic Material The fundamental concept of genetics is That the cell nucleus plays a key role in in- that: heritance was recognized in the 1870s by the observation that the nuclei of male and Inherited traits are determined by the ele- female reproductive cells undergo fusion in ments of heredity that are transmitted from parents to offspring in reproduction; these the process of fertilization. Soon thereafter, elements of heredity are called genes. chromosomes were first observed inside the nucleus as thread-like objects that The existence of genes and the rules become visible in the light microscope governing their transmission from gen- when the cell is stained with certain dyes. eration to generation were first articulated Chromosomes were found to exhibit a by Gregor Mendel in 1866 (Chapter 3). characteristic “splitting” behavior in which Mendel’s formulation of inheritance was in each daughter cell formed by cell division 2 Chapter 1 Introduction to Molecular Genetics and Genomics receives an identical complement of chro- as the genetic material, and DNA was as- mosomes (Chapter 4). Further evidence for sumed to function merely as the structural the importance of chromosomes was pro- framework of the chromosomes. The ex- vided by the observation that, whereas the periments described below finally demon- number of chromosomes in each cell may strated that DNA is the genetic material. differ among biological species, the number of chromosomes is nearly always constant within the cells of any particular species. Experimental Proof of the Genetic These features of chromosomes were well Function of DNA understood by about 1900, and they made An important first step was taken by it seem likely that chromosomes were the Frederick Griffith in 1928 when he demon- carriers of the genes. strated that a physical trait can be passed By the 1920s, several lines of indirect from one cell to another. He was working evidence began to suggest a close relation- with two strains of the bacterium ship between chromosomes and DNA. Streptococcus pneumoniae identified as S and Microscopic studies with special stains R. When a bacterial cell is grown on solid showed that DNA is present in chromo- medium, it undergoes repeated cell divi- somes. Chromosomes also contain various sions to form a visible clump of cells called a types of proteins, but the amount and kinds colony. The S type of S. pneumoniae synthe- of chromosomal proteins differ greatly from sizes a gelatinous capsule composed of one cell type to another, whereas the complex carbohydrate (polysaccharide). amount of DNA per cell is constant. The enveloping capsule makes each colony Furthermore, nearly all of the DNA present large and gives it a glistening or smooth (S) in cells of higher organisms is present in the appearance. This capsule also enables the chromosomes. These arguments for DNA as bacterium to cause pneumonia by protect- the genetic material were unconvincing, ing it from the defense mechanisms of an however, because crude chemical analyses infected animal. The R strains of S. pneumo- had suggested (erroneously, as it turned niae are unable to synthesize the capsular out) that DNA lacks the chemical diversity polysaccharide; they form small colonies needed in a genetic substance. The favored that have a rough (R) surface (Figure 1.1). candidate for the genetic material was pro- This strain of the bacterium does not cause tein, because proteins were known to be an pneumonia, because without the capsule exceedingly diverse collection of molecules. the bacteria are inactivated by the immune Proteins therefore became widely accepted system of the host. Both types of bacteria FPO R strain S strain Figure 1.1 Colonies of rough (R, the small colonies) and smooth (S, the large colonies) strains of Streptococcus pneumoniae. The S colonies are larger because of the gelatinous capsule on the S cells. [Photograph from O. T. Avery, C. M. MacLeod, and M. McCarty. Reproduced from the Journal of Experimental Medicine, 1944, vol. 79, p. 137 by copyright permission of The Rockefeller University Press.] 1.1 DNA: The Genetic Material 3  Living Living Heat-killed Living R cells plus S cells R cells S cells heat-killed S cells Mouse contracts Mouse remains Mouse remains Mouse contracts pneumonia healthy healthy pneumonia S colonies isolated R colonies isolated No colonies isolated R and S colonies isolated from tissue of dead mouse from tissue from tissue from tissue of dead mouse Figure 1.2 The Griffith's experiment demonstrating bacterial transformation. A mouse remains healthy if injected with either the nonvirulent R strain of S. pneumoniae or heat-killed cell fragments of the usually virulent S strain. R cells in the presence of heat-killed S cells are transformed into the virulent S strain, causing pneumonia in the mouse. “breed true” in the sense that the progeny until 1944 that the chemical substance re- formed by cell division have the capsular sponsible for changing the R cells into S type of the parent, either S or R. cells was identified. In a milestone experi- Mice injected with living S cells get ment, Oswald Avery, Colin MacLeod, and pneumonia. Mice injected either with living Maclyn McCarty showed that the sub- R cells or with heat-killed S cells remain stance causing the transformation of R cells healthy. Here is Griffith’s critical finding: into S cells was DNA. In doing these exper- mice injected with a mixture of living R cells iments, they first had to develop chemical and heat-killed S cells contract the disease— procedures for isolating almost pure DNA they often die of pneumonia (Figure 1.2). from cells, which had never been done be- Bacteria isolated from blood samples of fore. When they added DNA isolated from these dead mice produce S cultures with a S cells to growing cultures of R cells, they capsule typical of the injected S cells, even observed transformation: A few cells of though the injected S cells had been killed type S cells were produced. Although the by heat. Evidently, the injected material DNA preparations contained traces of pro- from the dead S cells includes a substance tein and RNA (ribonucleic acid, an abun- that can be transferred to living R cells and dant cellular macromolecule chemically confer the ability to resist the immunologi- related to DNA), the transforming activity cal system of the mouse and cause pneumo- was not altered by treatments that de- nia. In other words, the R bacteria can be stroyed either protein or RNA. However, changed—or undergo transformation— treatments that destroyed DNA eliminated into S bacteria. Furthermore, the new char- the transforming activity (Figure 1.3). These acteristics are inherited by descendants of experiments implied that the substance re- the transformed bacteria. sponsible for genetic transformation was Transformation in Streptococcus was orig- the DNA of the cell—hence that DNA is the inally discovered in 1928, but it was not genetic material. 4 Chapter 1 Introduction to Molecular Genetics and Genomics (A) The transforming activity in S cells is not destroyed by heat. Cells killed by heat Plate on agar medium S cell extract (contains mostly DNA with a little R colonies and Culture of S cells protein and RNA) Culture of R cells a few S colonies (B) The transforming activity is not destroyed by either protease or RNase. Protease or RNase Plate on agar medium Conclusion: Transforming activity not protein or RNA S cell extract R colonies and Culture of R cells a few S colonies (C) The transforming activity is destroyed by DNase. DNase Plate on agar medium Conclusion: Transforming activity most likely DNA S cell extract R colonies only Culture of R cells Figure 1.3 A diagram of the Avery–MacLeod–McCarty experiment that demonstrated that DNA is the active material in bacterial transformation. (A) Purified DNA extracted from heat-killed S cells can convert some living R cells into S cells, but the material may still contain undetectable traces of protein and/or RNA. (B) The transforming activity is not destroyed by either protease or RNase. (C) The transforming activity is destroyed by DNase and so probably consists of DNA. 1.1 DNA: The Genetic Material 5  radioactive isotopes of the two elements. Hershey and Chase produced particles con- Protein Head taining radioactive DNA by infecting E. coli (protein DNA and DNA) cells that had been grown for several gen- erations in a medium that included 32P (a radioactive isotope of phosphorus) and then collecting the phage progeny. Other parti- cles containing labeled proteins were ob- Tail tained in the same way, by using medium (protein that included 35S (a radioactive isotope of only) sulfur). In the experiments summarized in Figure 1.5, nonradioactive E. coli cells were infected with phage labeled with either 32P (part A) or 35S (part B) in order to follow the DNA (A) (B) and proteins individually. Infected cells Figure 1.4 (A) Drawing of E. coli phage T2, showing various components. were separated from unattached phage par- The DNA is confined to the interior of the head. (B) An electron micro- ticles by centrifugation, resuspended in graph of phage T4, a closely related phage. [Electron micrograph courtesy fresh medium, and then swirled violently in of Robley Williams.] a kitchen blender to shear attached phage material from the cell surfaces. This treat- ment was found to have no effect on the subsequent course of the infection, which implies that the phage genetic material Genetic Role of DNA in must enter the infected cells very soon after Bacteriophage phage attachment. The kitchen blender A second pivotal finding was reported by turned out to be the critical piece of equip- Alfred Hershey and Martha Chase in 1952. ment. Other methods had been tried to tear They studied cells of the intestinal the phage heads from the bacterial cell sur- bacterium Escherichia coli after infection by face, but nothing had worked reliably. the virus T2. A virus that attacks bacterial Hershey later explained, “We tried various cells is called a bacteriophage, a term of- grinding arrangements, with results that ten shortened to phage. Bacteriophage weren’t very encouraging. When Margaret means “bacteria-eater.” The structure of a McDonald loaned us her kitchen blender, bacteriophage T2 particle is illustrated in the experiment promptly succeeded.” Figure 1.4. It is exceedingly small, yet it has a After the phage heads were removed by complex structure composed of head the blender treatment, the infected bacteria (which contains the phage DNA), collar, were examined. Most of the radioactivity tail, and tail fibers. (The head of a human from 32P-labeled phage was found to be as- sperm is about 30–50 times larger in both sociated with the bacteria, whereas only a length and width than the head of T2.) small fraction of the 35S radioactivity was Hershey and Chase were already aware present in the infected cells. The retention that T2 infection proceeds via the attach- of most of the labeled DNA, contrasted with ment of a phage particle by the tip of its tail the loss of most of the labeled protein, im- to the bacterial cell wall, entry of phage ma- plied that a T2 phage transfers most of its terial into the cell, multiplication of this DNA, but very little of its protein, to the cell material to form a hundred or more prog- it infects. The critical finding (Figure 1.5) eny phage, and release of the progeny phage by bursting (lysis) of the bacterial host cell. They also knew that T2 particles Figure 1.5 (on facing page) The Hershey–Chase were composed of DNA and protein in ap- (“blender”) experiment demonstrating that proximately equal amounts. DNA, not protein, is responsible for directing Because DNA contains phosphorus but the reproduction of phage T2 in infected E. coli cells. (A) Radioactive DNA is transmitted to no sulfur, whereas most proteins contain progeny phage in substantial amounts. sulfur but no phosphorus, it is possible to la- (B) Radioactive protein is transmitted to bel DNA and proteins differentially by using progeny phage in negligible amounts. 6 Chapter 1 Introduction to Molecular Genetics and Genomics (A) (B) Infection with Infection with nonradioactive nonradioactive T2 phage T2 phage E. coli cells grown E. coli cells grown in 32P-containing in 35S-containing medium (labels DNA) medium (labels protein) Phage reproduction; Phage reproduction; cell lysis releases cell lysis releases DNA-labeled progeny protein-labeled phage progeny phage DNA-labeled phage Protein-labeled phage used to infect used to infect nonradioactive cells nonradioactive cells After infection, part of phage After infection, part of phage remaining attached to cells is remaining attached to cells is removed by violent agitation removed by violent agitation in a kitchen blender in a kitchen blender Infecting Infected cell Infecting Infected cell labeled DNA nonlabeled DNA Phage reproduction; cell lysis Phage reproduction; cell releases progeny phage that lysis releases progeny contain some 32P-labeled DNA phage that contain almost from the parental phage DNA no 35S-labeled protein Conclusion: DNA from an infecting parental phage is inherited in the progeny phage 1.1 DNA: The Genetic Material 7  Shear Madness Margaret McDonald loaned us her ferred from parental to progeny phage Alfred D. Hershey and kitchen blender the experiment promptly at yields of about 30 phage per infected Martha Chase 1952 succeeded.” bacterium.... [Incomplete separation Cold Spring Harbor Laboratories, of phage heads] explains a mistaken Cold Spring Harbor, New York The work [of others] has shown that preliminary report of the transfer of 35S Independent Functions of Viral Protein bacteriophages T2, T , 3 from parental to progeny and Nucleic Acid in Growth of and T4 multiply in the Our experiments phage.... The following Bacteriophage bacterial cell in a non-in- show clearly that questions remain unan- fective [immature] form. swered. (1) Does any sul- a physical Published a full eight years after the paper Little else is known about fur-free phage material of Avery, MacLeod, and McCarty, the ex- the vegetative [growth] separation of the other than DNA enter the periments of Hershey and Chase get equal phase of these viruses. phage T2 into cell? (2) If so, is it trans- billing. Why? Some historians of science The experiments reported genetic and ferred to the phage prog- suggest that the Avery et al. experiments in this paper show that eny? (3) Is the transfer of nongenetic parts were “ahead of their time.” Others sug- one of the first steps in the phosphorus to progeny gest that Hershey had special standing be- growth of T2 is the release is possible. direct or indirect?... Our cause he was a member of the “in group” from its protein coat of experiments show clearly of phage molecular geneticists. Max the nucleic acid of the virus particle, that a physical separation of the phage Delbrück was the acknowledged leader of after which the bulk of the sulfur-con- T2 into genetic and nongenetic parts is this group, with Salvador Luria close be- taining protein has no further func- possible. The chemical identification of hind. (Delbrück, Luria, and Hershey tion.... Anderson has obtained the genetic part must wait until some of shared a 1969 Nobel Prize.) Another pos- electron micrographs indicating that the questions above have been an- sible reason is that whereas the experi- phage T2 attaches to bacteria by its swered.... The sulfur-containing ments of Avery et al. were feats of strength tail.... It ought to be a simple matter to protein of resting phage particles is con- in biochemistry, those of Hershey and break the empty phage coats off the in- fined to a protective coat that is respon- Chase were quintessentially genetic. fected bacteria, leaving the phage DNA sible for the adsorption to bacteria, and Which macromolecule gets into the hered- inside the cells.... When a suspension functions as an instrument for the injec- itary action, and which does not? Buried of cells with 35S- or 32P-labeled phage tion of the phage DNA into the cell. This in the middle of this paper, and retained was spun in a blender at 10,000 revolu- protein probably has no function in the in the excerpt, is a sentence admitting tions per minute,... 75 to 80 percent of growth of the intracellular phage. The that an earlier publication by the re- the phage sulfur can be stripped from DNA has some function. Further chemi- searchers was a misinterpretation of their the infected cells.... These facts show cal inferences should not be drawn from preliminary results. This shows that even that the bulk of the phage sulfur re- the experiments presented. first-rate scientists, then and now, are mains at the cell surface during infec- sometimes misled by their preliminary tion.... Little or no 35S is contained in Source: Journal of General Physiology 36: data. Hershey later explained, “We tried the mature phage progeny.... Identical 39–56 various grinding arrangements, with re- experiments starting with phage labeled sults that weren´t very encouraging. When with 32P show that phosphorus is trans- was that about 50 percent of the transferred Chase are regarded as classics in the demon- 32P-labeled DNA, but less than 1 percent of stration that genes consist of DNA. At the the transferred 35S-labeled protein, was in- present time, the equivalent of the transfor- herited by the progeny phage particles. mation experiment is carried out daily in Hershey and Chase interpreted this result to many research laboratories throughout the mean that the genetic material in T2 phage world, usually with bacteria, yeast, or ani- is DNA. mal or plant cells grown in culture. These The experiments of Avery, MacLeod, experiments indicate that DNA is the ge- and McCarty and those of Hershey and netic material in these organisms as well as 8 Chapter 1 Introduction to Molecular Genetics and Genomics in phage T2. Although there are no known They are examined in Chapter 2. A key exceptions to the generalization that DNA is point for our present purposes is that the the genetic material in all cellular organisms bases in the double helix are paired as and many viruses, in a few types of viruses shown in Figure 1.6B. That is: the genetic material consists of RNA. At any position on the paired strands of a DNA molecule, if one strand has an A, then the partner strand has a T; and if one strand has a 1.2 DNA Structure: G, then the partner strand has a C. The Double Helix The pairing between A and T and be- tween G and C is said to be comple- The inference that DNA is the genetic mate- mentary; the complement of A is T, and rial still left many questions unanswered. the complement of G is C. The complemen- How is the DNA in a gene duplicated when tary pairing means that each base along one a cell divides? How does the DNA in a gene strand of the DNA is matched with a base in control a hereditary trait? What happens to the opposite position on the other strand. the DNA when a mutation (a change in the Furthermore: DNA) takes place in a gene? In the early 1950s, a number of researchers began to try Nothing restricts the sequence of bases in a to understand the detailed molecular struc- single strand, so any sequence could be ture of DNA in hopes that the structure present along one strand. alone would suggest answers to these ques- This principle explains how only four bases tions. In 1953 James Watson and Francis in DNA can code for the huge amount of in- Crick at Cambridge University proposed the formation needed to make an organism. It first essentially correct three-dimensional structure of the DNA molecule. The struc- ture was dazzling in its elegance and revo- lutionary in suggesting how DNA duplicates (A) (B) 3’ 5’ itself, controls hereditary traits, and under- T A goes mutation. Even while their tin-and- GC wire model of the DNA molecule was still A T incomplete, Crick would visit his favorite pub and exclaim “we have discovered the secret of life.” CG In the Watson–Crick structure, DNA CG consists of two long chains of subunits, each GC twisted around the other to form a double- T A Paired stranded helix. The double helix is right- nucleotides handed, which means that as one looks GC along the barrel, each chain follows a clock- T A wise path as it progresses. You can visualize G C the right-handed coiling in part A of Figure T A 1.6 if you imagine yourself looking up into the structure from the bottom. The dark T A spheres outline the “backbone” of each in- A T dividual strand, and they coil in a clockwise G C direction. The subunits of each strand are T A nucleotides, each of which contains any one of four chemical constituents called CG bases attached to a phosphorylated mole- T A cule of the 5-carbon sugar deoxyribose. G C The four bases in DNA are 5’ 3’ Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Figure 1.6 Molecular structure of the DNA double helix in the standard “B form.” (A) A space-filling model, in which each atom is depicted as a The chemical structures of the nucleotides sphere. (B) A diagram highlighting the helical strands around the outside and bases need not concern us at this time. of the molecule and the AT and GC base pairs inside. 1.2 DNA Structure: The Double Helix 9  is the sequence of bases along the DNA that In the remainder of this chapter, we discuss encodes the genetic information, and the some of the implications of these clues. sequence is completely unrestricted. The complementary pairing is also called Watson–Crick pairing. In the three- 1.3 An Overview of DNA dimensional structure in Figure 1.6A, the Replication base pairs are represented by the lighter spheres filling the interior of the double Watson and Crick noted that the structure helix. The base pairs lie almost flat, stacked of DNA itself suggested a mechanism for its on top of one another perpendicular to the replication. “It has not escaped our notice,” long axis of the double helix, like pennies in they wrote, “that the specific base pairing a roll. When discussing a DNA molecule, we have postulated immediately suggests a biologists frequently refer to the individual copying mechanism.” The copying process strands as single-stranded DNA and to in which a single DNA molecule becomes the double helix as double-stranded two identical molecules is called repli- DNA or duplex DNA. cation. The replication mechanism that Each DNA strand has a polarity, or di- Watson and Crick had in mind is illustrated rectionality, like a chain of circus elephants in Figure 1.7. linked trunk to tail. In this analogy, each As shown in part A of Figure 1.7, the elephant corresponds to one nucleotide strands of the original (parent) duplex sep- along the DNA strand. The polarity is deter- arate, and each individual strand serves as a mined by the direction in which the nu- pattern, or template, for the synthesis of a cleotides are pointing. The “trunk” end of new strand (replica). The replica strands are the strand is called the 3' end of the strand, synthesized by the addition of successive and the “tail” end is called the 5' end. In nucleotides in such a way that each base in double-stranded DNA, the paired strands the replica is complementary (in the are oriented in opposite directions, the 5' Watson–Crick pairing sense) to the base end of one strand aligned with the 3' end of across the way in the template strand the other. The molecular basis of the polar- (Figure 1.7B). Although the mechanism in ity, and the reason for the opposite orienta- Figure 1.7 is simple in principle, it is a com- tion of the strands in duplex DNA, are plex process that is fraught with geometri- explained in Chapter 2. In illustrating DNA cal problems and requires a variety of molecules in this book, we use an arrow- enzymes and other proteins. The details are like ribbon to represent the backbone, and examined in Chapter 6. The end result of we use tabs jutting off the ribbon to repre- replication is that a single double-stranded sent the nucleotides. The polarity of a DNA molecule becomes replicated into two strand is indicated by the direction of the copies with identical sequences: arrow-like ribbon. The tail of the arrow rep- 5'-ACGCTTGC-3' resents the 5' end of the DNA strand, the 3'-TGCGAACG-5' head the 3' end. 5'-ACGCTTGC-3' 5'-ACGCTTGC-3' Beyond the most optimistic hopes, 3'-TGCGAACG-5' 3'-TGCGAACG-5' knowledge of the structure of DNA imme- diately gave clues to its function: Here the bases in the newly synthesized strands are shown in red. In the duplex on 1. The sequence of bases in DNA could be copied by using each of the separate the left, the top strand is the template from “partner” strands as a pattern for the the parental molecule and the bottom creation of a new partner strand with a strand is newly synthesized; in the duplex complementary sequence of bases. on the right, the bottom strand is the tem- 2. The DNA could contain genetic information plate from the parental molecule and the in coded form in the sequence of bases, top strand is newly synthesized. Note in analogous to letters printed on a strip of Figure 1.7B that in the synthesis of each paper. new strand, new nucleotides are added 3. Changes in genetic information (mutations) only to the 3' end of the growing chain: could result from errors in copying in which The obligatory elongation of a DNA strand the base sequence of the DNA became only at the 3' end is an essential feature of altered. DNA replication. 10 Chapter 1 Introduction to Molecular Genetics and Genomics (A) (B) Parent molecule of DNA 5’ 3’ T A ACGCT TGC CG TGCGAACG A T 3’ 5’ CG CG Parent duplex Template strand Complement of 5’ 3’ A “T” adds “A” GC T A ACGCT TGC TGCGAACG Complement of 3’ 5’ CG G “C” adds “G” Template strand T A C G T A C Complement of T A “G” adds “C” 5’ 3’ 5’ A T ACGCT TGC A A T G TGCGAACG Complement of C G 5’ 3’ 5’ “G” adds “C” C CG CG GC GC T A And so forth T A Daughter duplex CG 5’ 3’ 5’ CG T A T A ACGCT TGC ACG CG ACG TGCGAACG CG T A 5’ 3’ 5’ T A TA TA Template A T strands A T 5’ 3’ 5’ 3’ ACGCT TGC ACGCT TGC TGCGAACG TGCGAACG 3’ 5’ 3’ 5’ Replica strands Daughter molecules of DNA Figure 1.7 Replication of DNA. (A) Replication of a DNA duplex as originally envisioned by Watson and Crick. As the parental strands separate, each parental strand serves as a template for the formation of a new daughter strand by means of AT and GC base pairing. (B) Greater detail showing how each of the parental strands serves as a template for the production of a comple- mentary daughter strand, which grows in length by the successive addition of single nucleotides to the 3' end. the complex and diverse DNA codes is pro- 1.4 Genes and Proteins tein, a class of macromolecules that carries Now that we have some basic understand- out most of the activities in the cell. Cells ing of the structural makeup of the genetic are largely made up of proteins: structural blueprint, how does this developmental proteins that give the cell rigidity and mo- plan become a complex living organism? If bility, proteins that form pores in the cell the code is thought of as a string of letters membrane to control the traffic of small on a sheet of paper, then the genes are molecules into and out of the cell, and re- made up of distinct words that form sen- ceptor proteins that regulate cellular activi- tences and paragraphs that give meaning to ties in response to molecular signals from the pattern of letters. What is created from the growth medium or from other cells. 1.4 Genes and Proteins 11  Proteins are also responsible for most of the metabolic activities of cells. They are essen- tial for the synthesis and breakdown of or- ganic molecules and for generating the chemical energy needed for cellular activi- ties. In 1878 the term enzyme was intro- duced to refer to the biological catalysts that accelerate biochemical reactions in cells. By 1900, thanks largely to the work of the German biochemist Emil Fischer, enzymes were shown to be proteins. As often hap- pens in science, nature’s “mistakes” provide clues as to how things work. Such was the case in establishing a relationship between Figure 1.8 Urine from a person with alkapto- genes and disease, because a “mistake” in a nuria turns black because of the oxidation of the gene (a mutation) can result in a “mistake” homogentisic acid that it contains. [Courtesy of (lack of function) in the corresponding pro- Daniel De Aguiar.] tein. This provided a fruitful avenue of re- search for the study of genetics. rare, with an incidence of about one in 200,000 people, it was well known even be- Inborn Errors of Metabolism as a fore Garrod studied it. The disease itself is Cause of Hereditary Disease relatively mild, but it has one striking symp- It was at the turn of the twentieth century tom: The urine of the patient turns black that the British physician Archibald Garrod because of the oxidation of homogentisic realized that certain heritable diseases fol- acid (Figure 1.8). This is why alkaptonuria is lowed the rules of transmission that also called black urine disease. An early case Mendel had described for his garden peas. was described in the year 1649: In 1908 Garrod gave a series of lectures in The patient was a boy who passed black which he proposed a fundamental hypoth- urine and who, at the age of fourteen years, esis about the relationship between hered- was submitted to a drastic course of treatment ity, enzymes, and disease: that had for its aim the subduing of the fiery heat of his viscera, which was supposed Any hereditary disease in which cellular to bring about the condition in question by metabolism is abnormal results from an charring and blackening his bile. Among inherited defect in an enzyme. the measures prescribed were bleedings, purgation, baths, a cold and watery diet, and Such diseases became known as inborn drugs galore. None of these had any obvious errors of metabolism, a term still in use effect, and eventually the patient, who tired today. of the futile and superfluous therapy, resolved Garrod studied a number of inborn er- to let things take their natural course. None of rors of metabolism in which the patients the predicted evils ensued. He married, begat excreted abnormal substances in the urine. a large family, and lived a long and healthy One of these was alkaptonuria. In this life, always passing urine black as ink. case, the abnormal substance excreted is (Recounted by Garrod, 1908.) homogentisic acid: Garrod was primarily interested in the OH biochemistry of alkaptonuria, but he took O note of family studies that indicated that the CH2 C disease was inherited as though it were due CH to a defect in a single gene. As to the bio- HO chemistry, he deduced that the problem in alkaptonuria was the patients’ inability to An early name for homogentisic acid was break down the phenyl ring of six carbons alkapton, hence the name alkaptonuria for that is present in homogentisic acid. Where the disease. Even though alkaptonuria is does this ring come from? Most animals 12 Chapter 1 Introduction to Molecular Genetics and Genomics obtain it from foods in their diet. Garrod Benzene ring proposed that homogentisic acid originates as a breakdown product of two amino acids, C C NH2 O phenylalanine and tyrosine, which also C C CH2 C C contain a phenyl ring. An amino acid is C C H OH one of the “building blocks” from which Phenylalanine (a normal amino acid) proteins are made. Phenylalanine and Each arrow tyrosine are constituents of normal pro- represents one teins. The scheme that illustrates the rela- 1 step in the tionship between the molecules is shown in biochemical Figure 1.9. Any such sequence of biochemical pathway. reactions is called a biochemical pathway NH2 O C C or a metabolic pathway. Each arrow in the pathway represents a single step depict- HO C C CH2 C C ing the transition from the “input” or C C H OH substrate molecule, shown at the head of Tyrosine (a normal amino acid) the arrow, to the “output” or product molecule, shown at the tip. Biochemical 2 pathways are usually oriented either verti- cally with the arrows pointing down, as in C C O O Figure 1.9, or horizontally, with the arrows pointing from left to right. Garrod did not HO C C CH2 C C know all of the details of the pathway in C C H OH Figure 1.9, but he did understand that the 4-Hydroxyphenylpyruvic acid key step in the breakdown of homogentisic acid is the breaking open of the phenyl ring 3 and that the phenyl ring in homogentisic In the next step acid comes from dietary phenylalanine and the benzene ring tyrosine. OH is opened at this What allows each step in a biochemical position. C C O pathway to occur? Garrod correctly sur- C C CH2 C mised that each step requires a specific en- C C OH zyme to catalyze the reaction for the OH chemical transformation. Persons with an inborn error of metabolism, such as alkap- Homogentisic acid (formerly known as alkapton) tonuria, have a defect in a single step of a metabolic pathway because they lack a This is the step that is blocked functional enzyme for that step. When an enzyme in a pathway is defective, the path- way is said to have a block at that step. X 4 in alkaptonuria; homogentisic acid accumulates. One frequent result of a blocked pathway is that the substrate of the defective enzyme O O O accumulates. Observing the accumulation of homogentisic acid in patients with alkap- C CH CH C CH2 C CH2 C tonuria, Garrod proposed that there must HO O OH be an enzyme whose function is to open 4-Maleylacetoacetic acid the phenyl ring of homogentisic acid and that this enzyme is missing in these pa- tients. Isolation of the enzyme that opens the phenyl ring of homogentisic acid was Further breakdown not actually achieved until 50 years after Garrod’s lectures. In normal people it is Figure 1.9 Metabolic pathway for the breakdown of phenylalanine and tyrosine. Each step in the pathway, found in cells of the liver, and just as Garrod represented by an arrow, requires a specific enzyme to had predicted, the enzyme is defective in catalyze the reaction. The key step in the breakdown of patients with alkaptonuria. homogentisic acid is the breaking open of the phenyl ring. 1.4 Genes and Proteins 13  The Black Urine Disease To students of heredity the inborn errors in the urine originally called alkapton] is Archibald E. Garrod 1908 of metabolism offer a promising field of homogentisic acid, the excretion of St. Bartholomew’s Hospital, investigation.... It was pointed out [by which is the essential feature of the London, England others] that the mode of incidence of alkaptonuric.... Homogentisic acid is a Inborn Errors of Metabolism alkaptonuria finds a ready explanation if product of normal metabolism.... The the anomaly be regarded as a most likely sources of the Although he was a distinguished physi- rare recessive character in We may further benzene ring in homo- cian, Garrod’s lectures on the relationship the Mendelian sense.... Of conceive that gentisic acid are phenyl- between heredity and congenital defects in the cases of alkaptonuria a alanine and tyrosine, the splitting of metabolism had no impact when they very large proportion have [because when these were delivered. The important concept been in the children of first the benzene ring in amino acids are adminis- that one gene corresponds to one enzyme cousin marriages.... It is normal tered to an alkaptonuric] (the “one gene–one enzyme hypothesis”) also noteworthy that, if one metabolism is the they cause a very con- was developed independently in the 1940s takes families with five or spicuous increase in the work of a special by George W. Beadle and Edward L. more children [with both par- output of homogentisic Tatum, who used the bread mold ents normal and at least one enzyme and that in acid.... Where the al- Neurospora crassa as their experimental child affected with alkap- congenital kaptonuric differs from organism. When Beadle finally became tonuria], the totals work out alkaptonuria this the normal individual is aware of Inborn Errors of Metabolism, in strict conformity to in having no power of enzyme is wanting. he was generous in praising it. This excerpt Mendel’s law, i.e. 57 [normal destroying homogentisic shows Garrod at his best, interweaving children] : 19 [affected chil- acid when formed—in history, clinical medicine, heredity, and dren] in the proportions 3 : 1.... Of in- other words of breaking up the benzene biochemistry in his account of alkap- born errors of metabolism, alkaptonuria ring of that compound.... We may fur- tonuria. The excerpt also illustrates how is that of which we know most. In itself it ther conceive that the splitting of the the severity of a genetic disease depends is a trifling matter, inconvenient rather benzene ring in normal metabolism is on its social context. Garrod writes as than harmful.... Indications of the the work of a special enzyme and that in though alkaptonuria were a harmless anomaly may be detected in early med- congenital alkaptonuria this enzyme is curiosity. This is indeed largely true when ical writings, such as that in 1584 of a wanting. the life expectancy is short. With today’s schoolboy who, although he enjoyed longer life span, alkaptonuria patients ac- good health, continuously excreted cumulate the dark pigment in their carti- black urine; and that in 1609 of a monk Source: Originally published in London, lage and joints and eventually develop who exhibited a similar peculiarity and England, by the Oxford University Press. severe arthritis. stated that he had done so all his life.... Excerpts from the reprinted edition in Harry Harris. 1963. Garrod’s Inborn Errors of There are no sufficient grounds [for Metabolism. London, England: Oxford doubting that the blackening substance University Press. The pathway for the breakdown of clinical consequences of defects in the other phenylalanine and tyrosine, as it is under- enzymes. Unlike alkaptonuria, which is a stood today, is shown in Figure 1.10. In this relatively benign inherited disease, the oth- figure the emphasis is on the enzymes ers are very serious. The condition known rather than on the structures of the as phenylketonuria (PKU) results from metabolites, or small molecules, on which the absence of (or a defect in) the enzyme the enzymes act. Each step in the pathway phenylalanine hydroxylase (PAH). requires the presence of a particular en- When this step in the pathway is blocked, zyme that catalyzes that step. Although phenylalanine accumulates. The excess Garrod knew only about alkaptonuria, in phenylalanine is broken down into harmful which the defective enzyme is homogentisic metabolites that cause defects in myelin for- acid 1,2 dioxygenase, we now know the mation that damage a child’s developing 14 Chapter 1 Introduction to Molecular Genetics and Genomics nervous system and lead to severe mental Phenylalanine retardation. A defect in this Each step in a 1 enzyme leads to However, if PKU is diagnosed in children metabolic pathway Phenylalanine soon enough after birth, they can be placed hydroxylase accumulation of requires a different phenylalanine and on a specially formulated diet low in pheny- enzyme. to phenylketonuria. lalanine. The child is allowed only as much phenylalanine as can be used in the synthe- Tyrosine sis of proteins, so excess phenylalanine does A defect in this 2 enzyme leads to not accumulate. The special diet is very Tyrosine aminotransferase accumulation of strict. It excludes meat, poultry, fish, eggs, tyrosine and to milk and milk products, legumes, nuts, and tyrosinemia type II. bakery goods manufactured with regular flour. These foods are replaced by an expen- 4-Hydroxyphenyl- sive synthetic formula. With the special pyruvic acid diet, however, the detrimental effects of ex- A defect in this 3 enzyme leads to cess phenylalanine on mental development Each enzyme is 4-Hydroxyphenyl- encoded in a pyruvic acid accumulation of can largely be avoided, although in adult dioxygenase 4-hydroxyphenyl- different gene. women with PKU who are pregnant, the fe- pyruvic acid and to tus is at risk. In many countries, including tyrosinemia type III. the United States, all newborn babies have Homogentisic acid their blood tested for chemical signs of PKU. A defect in this Routine screening is cost-effective because 4 enzyme leads to Homogentisic acid PKU is relatively common. In the United 1,2-dioxygenase accumulation of States, the incidence is about 1 in 8000 homogentisic acid and to alkaptonuria. among Caucasian births. The disease is less common in other ethnic groups. 4-Maleylacetoacetic acid In the metabolic pathway in Figure 1.10, defects in the breakdown of tyrosine or of 4-hydroxyphenylpyruvic acid lead to types of tyrosinemia. These are also severe Further breakdown diseases. Type II is associated with skin le- Figure 1.10 Inborn errors of metabolism that sions and mental retardation, Type III with affect the breakdown of phenylalanine and severe liver dysfunction. tyrosine. An inherited disease results when any of the enzymes is missing or defective. Alkapto- nuria results from a mutant homogentisic acid Mutant Genes and Defective 1,2 dioxygenase phenylketonuria results from a mutant phenylalanine hydroxylase. Proteins It follows from Garrod’s work that a defec- tive enzyme results from a mutant gene, but how? Garrod did not speculate. For all he use the standard typographical convention knew, genes were enzymes. This would have that genes are written in italic type, whereas been a logical hypothesis at the time. We gene products are not printed in italics. This now know that the relationship between convention is convenient, because it means genes and enzymes is somewhat indirect. that the protein product of a gene can be With a few exceptions, each enzyme is en- represented with the same symbol as the coded in a particular sequence of nucleotides gene itself, but whereas the gene symbol is present in a region of DNA. The DNA region in italics, the protein symbol is not. that codes for the enzyme, as well as adja- cent regions that regulate when and in The gene PAH on the long arm of chromo- some 12 encodes phenylalanine hydroxylase which cells the enzyme is produced, make (PAH). up the “gene” that encodes the enzyme. The gene TAT on the long arm of chromo- The genes for the enzymes in the bio- some 16 encodes tyrosine aminotransferase chemical pathway in Figure 1.10 have all (TAT). been identified and the nucleotide se- The gene HPD on the long arm of chromo- quence of the DNA determined. In the fol- some 12 encodes 4-hydroxyphenylpyruvic lowing list, and throughout this book, we acid dioxygenase (HPD). 1.4 Genes and Proteins 15  The gene HGD on the long arm of chromo- chains; each polypeptide chain consists some 3 encodes homogentisic acid 1,2 of a linear sequence of amino acids con- dioxygenase (HGD). nected end to end. For example, the en- Next we turn to the issue of how genes code zyme PAH consists of four identical for enzymes and other proteins. polypeptide chains, each 452 amino acids in length. In the decoding of DNA, each successive “code word” in the DNA specifies the next amino acid to be added to the 1.5 Gene Expression: polypeptide chain as it is being made. The amount of DNA required to code for the The Central Dogma polypeptide chain of PAH is therefore Watson and Crick were correct in proposing 452  3  1356 nucleotide pairs. The en- that the genetic information in DNA is con- tire gene is very much longer—about tained in the sequence of bases in a manner 90,000 nucleotide pairs. Only 1.5 percent of analogous to letters printed on a strip of pa- the gene is devoted to coding for the amino per. In a region of DNA that directs the syn- acids. The noncoding part includes some se- thesis of a protein, the genetic code for the quences that control the activity of the protein is contained in only one strand, and gene, but it is not known how much of the it is decoded in a linear order. A typical pro- gene is involved in regulation. tein is made up of one or more polypeptide There are 20 different amino acids. Only four bases code for these 20 amino acids, with each “word” in the genetic code con- sisting of three adjacent bases. For example, the base sequence ATG specifies the amino acid methionine (Met), TCC specifies serine Nucleotide sequence ATGTCCACTGCGGTCCTGGAA (Ser), ACT specifies threonine (Thr), and in DNA molecule TACAGGTGACGCCAGGACCT T GCG specifies alanine (Ala). There are 64 possible three-base combinations but only 20 amino acids because some combinations code for the same amino acid. For example, TRANSCRIPTION TCT, TCC, TCA, TCG, AGT, and AGC all code for serine (Ser), and CTT, CTC, CTA, CTG, TTA, and TTG all code for leucine (Leu). An Two-step decoding An RNA intermediate example of the relationship between the process synthesizes plays the role of base sequence in a DNA duplex and the a polypeptide. ”messenger“ amino acid sequence of the corresponding protein is shown in Figure 1.11. This particular DNA duplex is the human sequence that codes for the first seven amino acids in the TRANSLATION polypeptide chain of PAH. The scheme outlined in Figure 1.11 in- dicates that DNA codes for protein not di- Amino acid sequence rectly but indirectly through the processes in polypeptide chain Met Ser Thr Ala Val Leu Glu ATGTCCACTGCGGTCCTGGAA of transcription and translation. The indirect route of information transfer, DNA triplets encoding each amino acid DNA  RNA  Protein Figure 1.11 DNA sequence coding for the first seven amino acids in a polypeptide chain. The is known as the central dogma of molecu- DNA sequence specifies the amino acid lar genetics. The term dogma means “set of sequence through a molecule of RNA that serves beliefs”; it dates from the time the idea was as an intermediary “messenger.” Although the put forward first as a theory. Since then the decoding process is indirect, the net result is that “dogma” has been confirmed experimen- each amino acid in the polypeptide chain is specified by a group of three adjacent bases in tally, but the term persists. The central the DNA. In this example, the polypeptide chain dogma is shown in Figure 1.12. The main is that of phenylalanine hydroxylase (PAH). concept in the central dogma is that DNA 16 Chapter 1 Introduction to Molecular Genetics and Genomics does not code for protein directly but rather DNA acts through an intermediary molecule of ribonucleic acid (RNA). The structure of RNA is similar to, but not identical with, that of DNA. There is a difference in the TRANSCRIPTION sugar (RNA contains the sugar ribose instead of deoxyribose), RNA is usually single-stranded (not a duplex), and RNA contains the base uracil (U) instead of rRNA mRNA tRNA (ribosomal) (messenger) (transfer) thymine (T), which is present in DNA. Actually, three types of RNA take part in the synthesis of proteins: A molecule of messenger RNA (mRNA), Ribosome which carries the genetic information from DNA and is used as a template for polypep- tide synthesis. In most mRNA molecules, there is a high proportion of nucleotides that TRANSLATION actually code for amino acids. For example, the mRNA for PAH is 2400 nucleotides in length and codes for a polypeptide of 452 Protein amino acids; in this case, more than 50 percent of the length of the mRNA codes for amino acids. Figure 1.12 The “central dogma” of molecular Several types of ribosomal RNA (rRNA), genetics: DNA codes for RNA, and RNA codes for which are major constituents of the cellular protein. The DNA  RNA step is transcription, and the RNA  protein step is translation. particles called ribosomes on which polypeptide synthesis takes place. A set of transfer RNA (tRNA) molecules, each of which carries a particular amino acid mRNA for an unneeded protein. Another as well as a three-base recognition region possible reason may be historical. RNA that base-pairs with a group of three adjacent structure is unique in having both an infor- bases in the mRNA. As each tRNA partici- pates in translation, its amino acid becomes mational content present in its sequence of the terminal subunit added to the length of bases and a complex, folded three-dimen- the growing polypeptide chain. The tRNA sional structure that endows some RNA that carries methionine is denoted tRNAMet, molecules with catalytic activities. Many that which carries serine is denoted tRNASer, scientists believe that in the earliest forms and so forth. of life, RNA served both for genetic infor- mation and catalysis. As evolution pro- The central dogma is the fundamental ceeded, the informational role was principle of molecular genetics because it transferred to DNA and the catalytic role to summarizes how the genetic information in protein. However, RNA became locked into DNA becomes expressed in the amino acid its central location as a go-between in the sequence in a polypeptide chain: processes of information transfer and pro- The sequence of nucleotides in a gene specifies tein synthesis. This hypothesis implies that the sequence of nucleotides in a molecule of the participation of RNA in protein synthe- messenger RNA; in turn, the sequence of sis is a relic of the earliest stages of evolu- nucleotides in the messenger RNA specifies tion—a “molecular fossil.” The hypothesis the sequence of amino acids in the polypeptide is supported by a variety of observations. chain. For example, (1) DNA replication requires Given a process as conceptually simple an RNA molecule in order to get started as DNA coding for protein, what might ac- (Chapter 6), (2) an RNA molecule is essen- count for the additional complexity of RNA tial in the synthesis of the tips of the chro- intermediaries? One possible reason is that mosomes (Chapter 8), and (3) some RNA an RNA intermediate gives another level molecules act to catalyze key reactions in for control, for example, by degrading the protein synthesis (Chapter 11). 1.5 Gene Expression: The Central Dogma 17  the Watson–Crick pairing sense) to that in Transcription the DNA template, except that U (which The manner in which genetic information is pairs with A) is present in the RNA in place transferred from DNA to RNA is shown in of T. The rules of base pairing between DNA Figure 1.13. The DNA opens up, and one of the and RNA are summarized in Figure 1.14. Each strands is used as a template for the synthe- RNA strand has a polarity—a 5' end and a 3' sis of a complementary strand of RNA. end—and, as in the synthesis of DNA, nu- (How the template strand is chosen is dis- cleotides are added only to the 3' end of a cussed in Chapter 11.) The process of mak- growing RNA strand. Hence the 5' end of ing an RNA strand from a DNA template is the RNA transcript is synthesized first, and transcription, and the RNA molecule that transcription proceeds along the template is made is the transcript. The base se- DNA strand in the 3'-to-5' direction. Each quence in the RNA is complementary (in gene includes nucleotide sequences that ini- tiate and terminate transcription. The RNA transcript made from any gene begins at the 3’ 5’ initiation site in the template strand, which is located “upstream” from the amino T A acid–coding region, and ends at the termi- CG nation site, which is located “downstream” A T from the amino acid–coding region. For any gene, the length of the RNA transcript is CG very much smaller than the length of the CG DNA in the chromosome. For example, the GC transcript of the PAH gene for phenyl- T A alanine hydroxylase is about 90,000 nu- cleotides in length, but the DNA in CG chromosome 12 is about 130,000,000 nu- T A cleotide pairs. In this case, the length of the C G PAH transcript is less than 0.1 percent of the T A length of the DNA in the chromosome. A different gene in chromosome 12 would be T A Direction of transcribed from a different region of the DNA strand growth of being transcribed A T RNA strand DNA molecule in chromosome 12, and per- A T haps from the opposite strand, but the tran- C 3’ G scribed region would again be small in comparison with the total length of the CG G C DNA in the chromosome. GC A T A C Translation RNA transcript CG T The synthesis of a polypeptide under the di- * UA rection of an mRNA molecule is known as CG C translation. Although the sequence of *UA T bases in the mRNA codes for the sequence TA G of amino acids in a polypeptide, the mole- A cules that actually do the “translating” are A U T 5’ * the tRNA molecules. The mRNA molecule 3’ is translated in nonoverlapping groups of 5’ three bases called codons. For each codon U in RNA pairs in the mRNA that specifies an amino acid, with A in DNA there is one tRNA molecule containing a complementary group of three adjacent Figure 1.13 Transcription is the production of an RNA strand that is bases that can pair with those in that codon. complementary in base sequence to a DNA strand. In this example, the DNA strand at the bottom is being transcribed into a strand of RNA. Note The correct amino a