Haplotypes & Consanguinity PDF

Haplotypes & Consanguinity MD210 – GGE – Genetics Flipped lesson 5 1 Essential Learning Outcomes By the end of this lesson you should be able to: • Understand the concept of haplotypes and why they tend to be inherited together through many generations • Have a basic understanding of how polymorp...

Haplotypes & Consanguinity MD210 – GGE – Genetics Flipped lesson 5 1 Essential Learning Outcomes By the end of this lesson you should be able to: • Understand the concept of haplotypes and why they tend to be inherited together through many generations • Have a basic understanding of how polymorphic repeat sequences known as microsatellites can be used as genetic markers to track haplotypes • Understand how linkage analysis can be used to associate haplotypes with traits (map genes to characters) 2 Gene mapping • Gene - a biological determinant of a Mendelian character (trait) • A functional unit of DNA is now understood to be that determinant • But which gene(s) determines which character? • How can we map genes to characters? 3 Haplotype (Haploid Genotype) • A set of polymorphisms that are grouped tightly together on a single chromosome and tend to be inherited together through many generations (not separated by crossing over) • A haplotype can refer to a combination of alleles or to a set of single nucleotide polymorphisms (SNPs)/genetic markers • Also known as a DNA/genetic signature Crossing over in Meiosis I • A chunk of a chromosome (crossing over) Green and purple alleles are grouped tightly together – a haplotype 4 Haplotype (HT) vs Haplogroup (HG) Haplotype • A set of polymorphisms (alleles or genetic markers) that are grouped tightly together on a single chromosome and tend to be inherited together through many generations Haplogroup • A group of similar haplotypes that share a common ancestor with a single-nucleotide polymorphism mutation • (e.g. mtDNA haplogroups “The Seven Daughters of Eve” share common SNPs in mtDNA) 5 Thomas Hunt Morgan, Genetic Recombination and Gene Mapping • Proved chromosome theory of heredity with fruit fly Drosophila • Sex-linked inheritance of recessive white eye colour in mutant males • Genes were “linked” - carried on specific chromosomes and inherited together (white eye colour linked to X chr) • Noticed that some “linked” genes were not inherited together and theorised that crossing-over was the reason for this 6 Thomas Hunt Morgan, Genetic Recombination and Gene Mapping • Morgan’s student Sturtevant predicted that genes more closely grouped on chromosomes were separated less frequently by crossing over • Proposed first chromosomal linkage map • Closely linked genes e.g. vermillion eyes and miniature wings were more likely to belong to the same haplotype (chunk) 7 So what about mapping human genes? • How do we show linkage of a haplotype to a character? • We can examine the haplotypes of related individuals with the same traits • If they have a haplotype in common, we can assume that the gene responsible for the shared trait is in that area • But we don’t know which part of the genome to focus on and comparing all the genes is very difficult • Can we use our knowledge of the genome to identify a polymorphic marker for the common haplotype? 8 Human Nuclear Genome – what we know • Lots of Noncoding Sequences (98%) • Including tandem (head to tail) repeats • Interspersed repeats (throughout genome – i.e. not head to tail, may be on different Chrs) Source: Prof Larry Moran’s Sandwalk blog: https://sandwalk.blogspot.com/2018/03/whats-in-your-genome-pie-chart.html 9 Tandem Repeat Non-Coding DNA • Tandem Repeat – series of nucleotides directly repeated • ATGCCGTCAGATATGCCGTCAGAT(ATGCCGTCAGAT)n • Length of Repeat Unit Varies • Can be used as genetic markers for identification of haplotypes 10 Types of Tandem Repeats 1. Satellite DNA • • • • Very large arrays of non-coding tandemly repeating DNA Array of 100 kb- several Mb Length of repeat unit >100 bp Sequences vary between individuals 100 kb – 10 MB n 170 bp e.g. α (alphoid) DNA found in centromeric heterochromatin 11 Types of Tandem Repeats 2. Minisatellite DNA • Minisatellite DNA (medium size) • Array from 100 bp to 20 kb • Length of repeat unit 10-100 bp • High mutation rate, high diversity in population - VNTR 5-50 repeats 20 bp 12 Types of Tandem Repeats 3. Microsatellite DNA • Microsatellite DNA • a.k.a. Simple Sequence Repeats (SSR) or Short Tandem Repeats (STR) • Arrays usually of less than 100 bp • Length of repeat unit typically 2-4 bp • Used in genetic linkage analysis to locate a gene or a mutation responsible for a given trait or disease <100 bp 4 bp 13 Microsatellite DNA • • • • • Dispersed throughout chromosome Accounts for about 2% of genome (60 Mb) Microsatellites usually in intergenic sequences or introns Sometimes in coding sequences (exons) Microsatellites in exons tend to be mutation hot spots • Unstable • During replication DNA polymerase tends to make errors in copying repeated units • e.g. may skip over a repeat unit or copy it twice • Because replication of repeat units is very error prone Microsatellite DNA sequences are highly polymorphic (many different forms) 14 Microsatellite Polymorphism ------ CACACACACACA 15 Other Type of Microsatellite Polymorphism - SNPs Note the SNP in Man 1 will not be apparent if the PCR products are analysed only by size, only becomes apparent if you sequence 16 Using Microsatellite DNA as a Marker for Tracking • Suppose Human genome databases shows a microsatellite (trinucleotide repeat CTT) in intron 2 of gene X on Ch 1 • Can use genome database to design complementary oligonucleotide primers upstream (5’) and downstream (3’) of this microsatellite sequence • Also know as “flanking” sequences 17 Microsatellite Sequences as Markers n • Design primers • Determine appropriate conditions (annealing) for amplification • Extract DNA from patient • Amplify the interval between the primers • Get PCR Products • Measure Size of the PCR Product 18 Microsatellite Sequences as Markers PCR product = 20 + 20 (primers) + (3x8) = 64 bp PCR product = 20 + 20 (primers) + (3x7) = 61 bp PCR product = 20 + 20 (primers) + (3x9) = 67 bp 19 Microsatellite Polymorphism 20 Tracking Chromosomes or Chunks of Chromosome • Using microsatellites and SNPs you can construct a “barcode” for each Chr or chunk of Chr (Haplotype). 21 Linkage Analysis • Linkage is a relationship between loci. It is a specifically genetic phenomenon. • Linkage analysis looks at physical chunks of the genome (haplotypes) of related individuals and associates them with given traits. • Trait causing mutations are inherited jointly (linked) with the genetic markers (i.e. microsatellites and SNPs) located in their immediate vicinity on the same chromosomal strand • Principle: if we find a common genetic marker (e.g. microsatellite or SNP), we assume that the gene that causes the disease is somewhere in the same area. • To identify trait-related haplotype (chunk): • • • • Perform genomic analysis of polymorphic DNA markers associated with the trait for all family members Can use the dbSNP database to find appropriate markers See which markers are carried only by members with the trait High probability (odds) that trait causing gene is linked to this marker (same location on chromosome) 22 Potter/Weasley pedigree James II Albus Lily Rose Hugo 23 Microsatellite Sequences as Markers • Let’s say red hair is a recessive trait • Harry = Bb (Brown) • Ginny = bb (Red) • Brown hair allele (B) marker = microsatellite with 7 repeats • Red hair allele (b) marker = microsatellite with 9 repeats PCR product = 20 + 20 (primers) + (3x7) = 61 bp PCR product = 20 + 20 (primers) + (3x9) = 67 bp 24 Potter Kids - Hair Colour • James II and Albus have brown hair: must have inherited Harry’s brown hair haplotype – heterozygous (Bb) • 2 different PCR products • Lily’s alleles for red hair must have come from Harry’s mum and either Ginny’s mum or dad James II 58 64 67 70 Albus 58 • Lily should be homozygous for the genetic marker associated with the red hair allele 61 61 64 67 70 61 64 67 70 Lily • Single PCR product 58 25 What pattern would Hermione show? James II Albus Lily Rose Hugo 26 Things to Remember 1. A haplotype (haploid genotype) is a set of polymorphisms (alleles or genomic markers) that are grouped tightly together on a single chromosome and tend to be inherited together through many generations (not separated by crossing over) 2. Microsatellites (a.k.a. Simple Sequence Repeats (SSR) or Short Tandem Repeats (STR)) are polymorphic genetic markers, composed of arrays with a variable number of tandem repeats of 2-6 bp. Microsatellites are used in genetic linkage analysis to locate a gene or a mutation responsible for a given trait or disease 3. Because replication of repeat units is very error prone Microsatellite DNA sequences are highly polymorphic (many different forms) 4. Linkage analysis looks at physical chunks of the genome (haplotypes) of related individuals and associates them with given traits. 5. Linkage analysis takes advantage of the fact that trait causing mutations are inherited jointly (linked) with the genetic markers (i.e. microsatellites and SNPs) located in their immediate vicinity on the same chromosomal strand 27