Colon Cancer - Medical Student - W - extra slides - October 2024 PDF

 Neoplasms/Cancer disorders COLORECTAL CANCERS Hassan Ashktorab Professor of Medicine Director of Microarray and NGS Lab Molecular Cell Unit 2 Oct 17, 2024, 11:30-12:20 PM Howard University, Washington DC , [email protected] Offic...

 Neoplasms/Cancer disorders COLORECTAL CANCERS Hassan Ashktorab Professor of Medicine Director of Microarray and NGS Lab Molecular Cell Unit 2 Oct 17, 2024, 11:30-12:20 PM Howard University, Washington DC , [email protected] Office location: Cancer Center Rm# 324 Office hours: email; Zoom, office teamwork Tuesdays 11:00-12:00  Signs and Symptoms of colorectal Cancer ◼ Change in bowel habits ⚫ Constipation ⚫ Decreased stool caliber ⚫ Difficulty passing stools ◼ Blood in stool ⚫ Gross ⚫ Occult ⚫ Mixed with stool ⚫ Iron deficiency anemia Neoplasm: A new and abnormal growth of tissue in some part of the body, especially as a characteristic of cancer.  Sporadic Colon Cancer ◼ Most common cause of colon cancer ⚫ Combination of genetics and environment ◼ Cancers develop from colon polyps ⚫ Benign lesions ⚫ Asymptomatic ⚫ Large polyps may contain cancer  Leading Cancer Types for the Estimated New Cancer Deaths, by Sex, US, 2024. CA A Cancer J Clinicians, Volume: 74, Issue: 1, Pages: 12-49, First published: 17 January 2024, DOI: (10.3322/caac.21820) Cancer related death in African Americans in US, estimated 2022 CA A Cancer J Clinicians, Volume: 72, Issue: 3, Pages: 202-229, First published: 10 February 2022, DOI: (10.3322/caac.21718) Trend in incidence and mortality of CRC by Race (2002-2020) Incidence, United State Mortality, United State Source: Death data provided by the National Vital Statistics System public use data file. Death rates calculated by the National Cancer Institute using SEER*Stat. Death rates (deaths per 100,000 population per year) are age-adjusted to the 2000 US standard population. statecancerprofiles.cancer.gov/historicaltrend/index.php?0&9900&999&7599&001&020&07&0&0&0&1&1&1&5&9900!001!020!28!0!1!1&9900!001!020!38!0!1!1&9900!001!020!48!0!1!1&9900!001!020!05!0!1!1#results  Burden of Colorectal Cancer (CRC) World-wide about 1,400,000 people diagnosed with colorectal cancer in 2012 2.4 million cases of CRC diagnosed every year by 2035**. Both women and men All races Third leading cause of cancer death in US American Cancer Society estimates in 2023 153,020 new cases 52,000 deaths including 19,550 cases and 3750 deaths in individuals younger than 50 years About 27,400 patients will have had their cancer metastasized.* *National Cancer Institute; Surveillance, Epidemiology, and End results Program Fact Sheet: Colon and Rectum. http://seer.cancer.gov/statfacts/html/colorect.html. Accessed September 2015. **https://www.wcrf.org/int/cancer-facts-figures/data-specific-cancers/colorectal-cancer-statistics; Siegel et al, March 2023 https://seer.cancer.gov/archive/csr/1975_2013/bro wse_csr.php?sectionSEL=6&pageSEL=sect_06_zfi g.05  Who Is at Risk? Cancers of the Colon and Rectum: Average Annual Age-Specific SEER Incidence and U.S. Mortality Rates By Gender, 2001-2005 Age recommended to start screening Ashktorab et al Gastroenterology. 2017 Oct; 153(4): 910–923; Laiyemo et al 2017.  Increasing of CRC in Young Adults Is it time to revisit CRC screening guidelines for better personalized approaches? Colorectal Cancer Rates in young AA adults (20-44 years) for Years 2000-2012 50 Incidence increased by 30% among 40-year old persons from 1992 to 2015, and the absolute difference in incidence rates over the same period is only 8.2 cases per 100,000.* Recent increase in young-onset CRC have largely been due to increases in rectal cancer.** Stoffel and Murphy. Gastroenterology. 2019 Aug 5*; Muphy et al 2019;156,p958-966**; Sahakian et al, Dig. Dis Sci 2015, 60:722* Ashktorab et al 2016, Dig Dis Sci. 2016 Oct;61(10):3026-30.  Colorectal Cancer Sporadic (average risk 65%–85%) Family history (10%–30%) Rare syndromes (90% Risk of extracolonic tumors (upper GI, desmoid, osteoma, thyroid, brain, other) CHRPE may be present Untreated polyposis leads to 100% risk of cancer CHRPE=congenital hypertrophy of the retinal pigment epithelium APC  Genetics of FAP Autosomal dominant inheritance Caused by mutations in APC tumor suppressor gene on chromosome 5q Up to 30% of patients have de novo germline mutations Most families have unique mutations Most mutations are protein truncating Genotype/phenotype relationships emerging Indications for APC Gene Testing Molecular diagnosis of FAP in patients who present with: – polyposis (>100 adenomas) – attenuated FAP Predictive testing for FAP in blood relatives of persons with FAP or known APC mutations Kemp Bohan PM et al.,Fam Cancer. 2020 Jun issue Giardiello FM et al. N Engl J Med, 336:823, 1997 APC mutation in AA Ashktorab et al, Oncotarget. 2019 Apr 5;10(27):2607-2624. doi: 10.18632/oncotarget.26721.  VR Familial Adenomatous Polyposis ◼ Rare germline mutation of the APC gene ⚫1 in 8,000 to 14,000 live births. Clinical manifestation ▪ Adenomas develop ⚫ 50% - 15 y/o ⚫ 95% - 35 y/o ▪ Cancer occurs by 50 yo  Some FAP Manifestations Correlate With Specific APC Gene Regions AFAP 436 Classic FAP 1596 AFAP MUTATION CLUSTER REGION 1061 1309 5bp mutation Hot Spots (aa) 2843 500 1000 1500 2000 Ex 1 3 5 9/9a 10 11 12 13 14 15 ARMADILLO REPEATS B-CATENIN BINDING DOMAIN FUNCTONAL DOMAINS MICROTUBULE BINDING DOMAIN B-CATENIN DEGRADATION DOMAIN EB1 BINDING DOMAIN Grady and Markowitz  APC Mutations Mutation Type No. Mutations (%) Small deletions 356 (41%) Missense/nonsense 235 (27%) Small insertions 131 (15%) Gross deletions 54 (6%) Splicing 49 (5%) Small indels 17 (2%) Regulatory 3 ( 100) Activated Wnt signaling triggers colon cancer Hereditary Non-polyposis Colorectal Cancer ◼ 70% - 80% lifetime risk ◼ 3% – 5% of colorectal cancer ◼ Average age is 44 ◼ Primarily right sided ⚫ 60% to 80% ◼ Improved survival ◼ Polyps may be present, multiple primaries common. Can overlap with AFAP ◼ High lifetime risk of CRC and other cancers beginning age 20  Hereditary Non-polyposis Colorectal Cancer ◼ Increased risk of other cancers ⚫ Endometrial (39%) ⚫ Ovarian (9%) ⚫ Less frequently – Small Bowel – Stomach – Renal pelvis/ureteral – Breast – Brain – Pancreas  HNPCC Genetic Defect ◼ Mutation in one of several DNA mismatch repair genes ⚫ Correct nuclear base pair errors ◼ Microsatellite instability (MSI) ⚫ 90% of cases ⚫ Replication error  DNA Mismatch Repair Genes ◼ Mutations frequently associated with HNPCC Gene Chromosome hMSH2 2p21-22 hMLH1 3p21 hMSH6 2p19 hPMS2 7p22 hPMS1 2q31-33  MMR in LS Fig. Distributions of the types of germline variants across each MMR gene. The analysis is based on data deposited in the InSiGHT database [Plazzer JP et al., 2013] and is restricted to variants with coding changes. The total numbers of variants per gene included in the analysis are 1104 for MLH1, 883 for MSH2, 414 for MSH6, and 197 for PMS2 A frameshift mutation (also called a framing error or a reading frame shift) is a genetic mutation caused by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is not divisible by three Diagnosis of HNPCC  Revised Bethesda guidelines 1. Colorectal cancer diagnosed in a patient who is G in intron 10 colon cancer on maternal side  APC Gene AFAP 436 FAP with CHRPE 1596 AFAP (aa) 2843 500 1000 1500 2000 Ex 1 1 3 5 9/9a 10 11 12 13 14 15 ARMADILLO REPEATS Exon 11 G c.1409-5 A>G CCCTTTTTAA TTAG GGGGACTAC A -Splice acceptor site Fruitfly and SpliceSiteFinder prediction programmes predicted use of alternative splice site. Score – 80.6 Previously reported in large European study – Pathogenicity undetermined Friedl & Aretz, 2005  Molecular analysis DNA c.1409-5A>G cDNA G Splice acceptor site CCCTTTTTAA A TTAG GGGGACTAC Ex 11 Intron 10 Alternative splice site CCCTTTTTAAGTTAG GGGGACTAC N N M RNA 254bp 4bp insertion – (p.G470Vfsx15) 250bp AATGAACTAGTTAGGGGGACTACAGGC,,,,TGA Term Ex10 Ex11  Case 2 Breast Ca II:1 II:2 II:3 II:4 II:5 II:6 ? Colon Ca Jejunal Melanoma Ca ? Colon Ca MYH gene - Negative III.2 APC Ex 15 PTT - Negative Age 55 - Carcinoma of sigmoid colon APC Ex 1-14 Screen Age 62 - Multiple polyps throughout colon c.423 G>T (p.R141S) Exon 4 APC gene  Case 2 Breast Ca II:1 II:2 II:3 II:4 II:5 II:6 AFAP AFAP III:2 III:3 III:4 III:5 AFAP AFAP c.423 G>T Splicing mutation PRESENT  APC Gene AFAP AFAP (aa) 500 1000 1500 2000 1 345 9/9a 10 11 12 13 14 15 c.423G>T p.R141S Conserved amino acid sequence Predicted to disrupt splice-site – (Fruitfly and SpliceSiteFinder and prediction programmes) Reported by Aretz et al., 2004. Human Mutation 24(5): 370-80  Molecular analysis Intron 3 c.423G>T Exon 4 DNA AAGAGAG GTCAATTGCTTCTTGCT T Ex3 Ex4 Ex5 109bp RNA II.2 II.2 II.4 III.3 III.3 N Ex3 Ex4 Ex5 301 Ex3 Ex5 192 Exon skipping confirmed by sequence analysis of the cDNA product across junction.  Summary ⚫ Case 1 – Atypical FAP ⚫ c.1409-5 A>G mutation – ⚫ Splice-site prediction programmes ⚫ RNA studies ⚫ Selection of an alternative splice site. ⚫ Case 2 – AFAP ⚫ c.423 G>T (p.R141S) missense mutation – ⚫ Amino acid conservation ⚫ Segregation with disease ⚫ Splice site prediction programmes ⚫ RNA studies ⚫ Exon skipping possibly due to possible effect on exonic splicing enhancer motifs (ESEs). (Aretz et al., 2004).  To conclude… ⚫ Splicing mutations can cause FAP and warrant further investigation ⚫ CMGS (Clinical Molecular Genetics Society) Best Practice Guidelines on the interpretation and reporting of unclassified variants  Contribution of Gene Mutations to HNPCC Families Sporadic Familial Unknown 30% MSH2 30% HNPCC Rare CRC syndromes FAP MSH6 (rare) PMS1 (very rare) MLH1 30% PMS2 (rare) Liu B et al. Nat Med 2:169, 1996  Diagnosis of HNPCC based on previous Amesterdam criteria ◼ Amsterdam Criteria I 1. Three or more relatives with CRC; one is a 1st - degree relative of the other two 2. CRC in at least 2 generations 3. One or more CRC cases diagnosed before the age of 50 ◼ Amsterdam Criteria II 1. Three or more relatives with CRC or an HNPCC associated cancer (endometrial, ovarian, etc)  VR Colon cancer Black to Non-Hispanic White incidence ratio 1.22 Black to No-Hispanic White mortality ratio 1.35 Ashktorab et al 2017, Gastroenterology  RNA Methylation METTL3 and METTL14 alters in CRC In lung cancer cells, for example, METTL3 binds methylated mRNA and interacts with the translation initiation factor EIF3H, thereby facilitating the translation of mRNA Fig. 1. The methylation modification of m6A is affected by methylase, demethylase and m6A recognition protein. The methylation modification of m6A is mediated by a multi protein complex. It is known that the components of this complex include METTL3, METTL14 and WTAP, while the demethylase FTO and ALKBH5 are responsible for erasing the methylation modification groups. HNRNPC in the nucleus is responsible for recognizing the m6A modified group and mediating the alternative splicing of mRNA precursors. Another m6A recognition protein, HNRNPA2B1, promotes pri-miRNA processing into pre-miRNA. In the cytoplasm, different m6A recognition proteins mediate different functions. YTHDF1 and YTHDF3 recognize m6A modified mRNA, and promote protein translation through interaction with initiation factors and ribosomes. Elf3 recognition protein will also be directly bound to the m6A site at the mRNA 5′UTR end to participate in translation initiation. However, the recognition of another recognition protein, YTHDF2 and m6A, will lead to the degradation of mRNA. Yujia Z, et al, Biomedicine & Pharmacotherapy, 2020, V 131,110731,  The Tabula Sapiens: A multiple-organ, single-cell transcriptomic atlas of humans SCIENCE; 13 May 2022; Vol 376, Issue 6594, DOI: 10.1126/science.abl4896  Consensus Molecular Subtypes of colorectal cancer V Fig.: Geneset enrichment analysis subtypes in CRC cell lines and primary cultures (n = 29 and n = 33 respectively). The analysis shows Consensus molecular subtype (CMS) specific activation of pathways and processes in cell cultures, similar to those in patient tumors. Janneke F. Cell Death & Differentiation, volume 25, pages616–633 (2018)  Four consensus molecular subtypes (CMS) V CMS1 is enriched for MSI tumors that display immune activation. CMS2 reflects the classical subtype encompassing typical WNT/MYC-driven tumors with epithelial characteristics, CMS3 is enriched for KRAS-mutated tumors with activation of metabolic pathways. CMS4 has mesenchymal features, shows a high stromal content and activation of TGF-β and VEGFR pathways. Besides the biological differences, clear clinical distinctions are evident with poor prognosis for CMS4 and a relatively good prognosis for CMS1. Janneke F., et al. Cell Death & Differentiation, vol25,616–633 (2018); Guinney J,, et al. Nat Med. 2015;21:1350–56.  The Cancer Genome Atlas (TCGA) is a joint project of the National Cancer Institute (NCI) and the National Human Genome Research Institute (NHGRI). TCGA began in 2006 as a pilot project focused on three cancer types: lung, ovarian, and glioblastoma. Due to the success of the initial efforts, TCGA was reauthorized for a full production phase in 2009. In the following decade, TCGA collected more than 11,000 cases across 33 tumor types and generated a vast, comprehensive dataset describing the molecular changes that occur in cancer (Figure). Tissue sample collection and data generation were completed in 2013 and 2016, respectively. Network maker papers, which are integrative cross-platform analyses of TCGA data on individual cancer types have been published for 32 of the tumor types to date. (633 CRC cases) https://www.cancer.gov/about-nci/organization/ccg/research/structural- genomics/tcga/studied-cancers Cell 2018 173, 283-285DOI: (10.1016/j.cell.2018.03.042) The molecular features of colorectal tumors differ with their anatomic location. V Gastroenterology 2020 159241-256.e13DOI: (10.1053/j.gastro.2020.03.054) Supplementary Figure 1 Copyright © 2020 AGA Institute Terms and Conditions  VR Mismatch Repair Failure Leads to Microsatellite Instability (MSI) Normal Microsatellite instability Addition of nucleotide repeats DNA Mismatch Repair VR