Chapter 13 & 14 PDF - Chromosomes and Genomes

CHAPTER 13 Chromosomes Chromothripsis is a rare event that spontaneously shatters a chromosome—sometimes several. Discover...

CHAPTER 13 Chromosomes Chromothripsis is a rare event that spontaneously shatters a chromosome—sometimes several. Discovered in 2011 in cancer cells, chromothripsis may also account for some cases of severe birth defects. The BIG Picture Learning Outcomes A human genome has 20,000-plus protein-encoding genes dispersed among 24 chromosome types. Chromosome-level #$.# Portrait of a Chromosome illnesses reflect disruption of individual genes or their regulation. !. List the major parts of a chromosome. Because chromosomes determine which sets of genes are ". List the types of chromosomes based on centromere position. transmitted together to the next generation, detecting and analyzing chromosomes can provide clinically useful information. #$.! Detecting Chromosomes #. Describe ways that chromosomes are obtained, prepared, detected, and depicted in detail. Shattered! #$.$ Atypical Chromosome Number In 1965, a case report in a medical journal described a 9-year-old $. Explain how atypical chromosome girl who was the only person in the world known to have an immune numbers arise. %. Distinguish polyploidy from aneuploidy. condition that causes warts from human papillomavirus infection &. Describe specific aneuploid conditions. and susceptibility to bacterial infections. When a few other cases #$." Atypical Chromosome Structure were identified, the condition was attributed to a mutation in an '. Distinguish between the immune system gene, CXCR4. The mutation, in one copy of the consequences of having balanced versus unbalanced chromosomes. gene, prevented the mobilization of a class of white blood cells (. Describe deletions, duplications, and in the bone marrow from entering the bloodstream to fight the the two major types of translocation. pathogens. ). Distinguish the two types of inversions. The disease is now called WHIM syndrome. A few years ago, the first !*. Describe the consequence of having patient, in her late fifties, brought her two grown daughters to the an isochromosome. !!. Describe the consequence of having National Institutes of Health Clinical Center. They had inherited her a ring chromosome. WHIM, but the mother had fully recovered. The disease had vanished: #$.% Uniparental Disomy—A Double Dose no infections, no warts. What had happened? from One Parent !". Explain how a person could inherit At some unknown point in time, in the woman’s bone marrow, both copies of a DNA sequence from a hematopoietic (blood) stem cell had undergone an extremely one parent. !#. Describe how inheriting both copies rare event, previously known only to occur in cancer cells, called of DNA from one parent can affect a chromothripsis. Double-stranded DNA breaks had shattered one of her person’s health. chromosomes, as if the chromosome had!exploded. Chromothripsis is Greek for “shattered colored!bodies.” !"# When the researchers sequenced the genome of some of Sister chromatids the woman’s white blood cells, they found that one copy of Telomeres her chromosome 2 was shorter than the other copy—it was p short Heterochromatin missing 164 genes, including the copy of the CXCR4 gene arm (dark) Centromere that had caused her disease. The chromosome had broken and sent pieces into other chromosomes, but DNA repair had q long Euchromatin healed them. The white blood cells that had descended from arm (light) the altered stem cell had begun to leave the bone marrow Telomeres and function, and her infections ceased. However, half of her oocytes still had the mutation, which explains how her Figure #$.#&Portrait of a chromosome."Tightly wound, daughters inherited WHIM. highly repetitive heterochromatin forms the centromere (the largest constriction) and the telomeres (the tips) of A few cases are now known of children with severe birth chromosomes. Elsewhere, lighter-staining euchromatin includes many protein-encoding genes. The centromere defects whose mothers show evidence of past chromothripsis divides this chromosome into a short arm (p) and a long in all of their cells. DNA repair knit together the chromosome arm (q). This chromosome is in the replicated form. pieces in the mothers, who are healthy because all of their DNA is present, just rearranged. However, during meiosis, the patchwork chromosomes can mispair as pieces from transmitted, via cell division (mitosis or meiosis), to the next cell generation. The different chromosome types have long homologous chromosomes attract from odd places, resulting been described and distinguished by size and shape, using in offspring that have extra or missing genetic material, which stains and dyes to contrast dark heterochromatin with the can cause severe birth defects. It is as if the mothers’ genomes lighter euchromatin (figure 13.1). Heterochromatin consists are like large jigsaw puzzles, cut up and pasted back together, mostly of highly repetitive DNA sequences, whereas euchro- but the offspring inherit too few or too many puzzle pieces. matin has many protein-encoding sequences. A chromosome must include structures that enable it to replicate and remain intact. Everything else is informational: protein-encoding genes and their controls. The essential parts !".!&Portrait of a Chromosome of a chromosome are ! telomeres; Mutations range from single-base changes to entire extra sets ! origin of replication sites, where replication forks begin of chromosomes. A mutation is considered a chromosomal to form; and aberration if it is large enough to be seen with a light micro- ! the centromere. scope using stains and/or fluorescent probes to highlight miss- ing, extra, or moved DNA sequences. A chromosome includes Recall from figure 2.15 that telomeres"are chromosome tips. hundreds to thousands of genes. In humans, each telomere repeats the sequence TTAGGG. In general, too little genetic material has more severe In most cell types, telomeres shorten with each mitotic effects on health than too much. Extensive chromosome abnor- cell"division. malities that are present in all cells of an embryo or fetus dis- The centromere is the largest constriction of a chromo- rupt or halt prenatal development. As a result, only 0.65 percent some. It is where spindle fibers attach when the cell divides. of all newborns have chromosomal abnormalities that produce A chromosome without a centromere is no longer a chromo- symptoms. An additional 0.20 percent of newborns have chro- some. It vanishes from the cell as soon as division begins mosomal rearrangements in which chromosome parts have because there is no way to attach to the spindle. flipped or swapped, but the rearrangements do not produce Centromeres, like chromosomes, consist mostly of DNA symptoms unless they disrupt the structures or functions of and protein. Many of the hundreds of thousands of DNA bases genes that affect health. that form the centromere are copies of a specific 171-base Cytogenetics is the classical area of genetics that links DNA sequence. The size and number of repeats are similar chromosome variations to specific traits, including illnesses. in many species, although the sequence differs. The similar- This chapter explores several ways that chromosomes can be ity among species suggests that these repeats have a structural atypical (used synonymously with abnormal) and affect health. role in maintaining chromosomes rather than an informational Actual cases introduce some of them. one from their sequence. Certain centromere-associated pro- teins are synthesized only when mitosis is imminent, forming a structure called a kinetochore that contacts the spindle fibers, Required Parts: Telomeres and Centromeres enabling the cell to divide. A chromosome consists primarily of DNA and proteins with Centromeres replicate toward the end of S phase of the a small amount of RNA. Chromosomes are duplicated and cell cycle. A protein that may control the process is centromere !"! Part 3!DNA and Chromosomes  Telomere Centromere Subtelomere ACACACTTTCGCGAATAAT…TTAAGGTTAGGGTTAGGGTAAGGG …TTAGGGTTAGGG … (Short repeats) (6-base repeats similar to telomeres) (Telomere) Figure #$.!&Subtelomeres."The repetitive sequence of a telomere gradually diversifies toward the centromere. The centromere is depicted as a buttonlike structure to more easily distinguish it, but it is composed of DNA like the rest of the chromosome. protein A, or CENP-A. Molecules of CENP-A stay with centro- meres as chromosomes replicate, covering about half a million DNA base pairs. When the replicated (sister) chromatids sepa- rate at anaphase, each member of the pair retains some CENP-A. The protein therefore passes to the next cell generation, but it is not DNA. This is an epigenetic change. Centromeres lie within vast stretches of heterochromatin. The arms of the chromosome extend outward from the centro- mere. Gradually, with increasing distance from the centromere, the DNA includes more protein-encoding sequences. Gene density varies greatly among chromosomes. Chromosome 21 includes a gene “desert,” harboring a million-base stretch with no protein-encoding genes at all. Chromosome 22, in con- trast, is a gene “jungle.” Yet these two tiniest chromosomes are remarkably similar in size, which is why they are out of place in karyotypes. Chromosome 22 contains 545 genes to chromo- some 21’s 225! That is, chromosome 21 is actually the smallest, if size is measured by gene content. The chromosome parts that lie between protein- rich areas and the telomeres are termed subtelomeres (figure 13.2). These areas extend from 8,000 to 300,000 bases inward toward the centromere from the telomeres. Subtelo- meres include some protein-encoding genes and therefore Figure #$.$&A karyotype displays chromosome pairs in bridge the gene-rich regions and the telomere repeats. The size order."Note the extra chromosome 21 that causes trisomy 21 transition is gradual. Areas of 50 to 250 bases, right next to the Down syndrome. (Chromosomes are color-enhanced; A-G telomeres, consist of 6-base repeats, many of them very simi- denote generalized groups.)"Biophoto Associates/Science Source lar to the TTAGGG of the telomeres. Then, moving inward from the 6-base zone are many shorter repeats. Their func- A karyotype displays chromosomes in pairs by size and tion isn’t known. Finally, the sequence diversifies and protein- by physical landmarks that appear during mitotic metaphase, encoding genes appear. when DNA coils tightly, enabling it to be visualized. Figure 13.3 At least 500 protein-encoding genes lie in the subtelo- shows a karyotype with one extra chromosome, which is called mere regions of all the chromosomes combined. About half a trisomy. are members of multigene families (groups of genes of very The 24 human chromosome types are numbered from similar sequence next to each other) that include pseudogenes. largest to smallest—1 to 22. The other two chromosomes are These multigene families may be signs of recent evolution: the X and the Y. Early attempts to size-order chromosomes Apes and chimps have only one or two genes for many of the resulted in generalized groupings because many of the chromo- large gene families in humans. somes are of similar size. Use of dyes and stains made it easier to distinguish chromosomes by creating patterns of bands. Karyotypes Chart Chromosomes Centromere position is one physical feature of chro- An old but still useful tool is the chromosome chart, or mosomes. A chromosome is metacentric if the centromere karyotype. By showing which genes are transmitted together divides it into two arms of approximately equal length. It is as part of the same chromosome, a karyotype can reveal submetacentric if the centromere establishes one long arm certain conditions that DNA sequencing can miss. Clinical and one short arm, and acrocentric if it pinches off only a Connection 13.1 in section 13.4 returns to this point. small amount of material toward one end (figure 13.4). Some Chapter 13+Chromosomes !"$ Replicated !".#&Detecting Chromosomes centromere p Chromosomes can be imaged from any type of human cell that short arm has a nucleus (red blood cells do not). The most common appli- cation of human chromosome testing is in prenatal diagnosis. q Chromosomes are also checked in relatives of people known to long arm have atypical chromosomes, to explain infertility, or to diag- Telocentric Acrocentric Submetacentric Metacentric nose or track changes as a cancer progresses. (a) (b) (c) (d) Figure #$."&Centromere position distinguishes Older Techniques chromosomes."(a) A telocentric chromosome has the The technologies that identify atypical chromosomes in fetuses centromere near one end, although telomere DNA sequences are at the tip. Humans do not have telocentric chromosomes. have evolved since the first fetal karyotype was constructed in (b) An acrocentric chromosome has the centromere near 1966. Just in the past few years, deducing chromosome counts an end. (c) A submetacentric chromosome’s centromere from short pieces of placental DNA floating in the maternal creates a long arm (q) and a short arm (p). (d) A metacentric bloodstream has mostly replaced the older approaches of amnio- chromosome’s centromere establishes more equal-size arms. centesis and chorionic villus sampling (CVS), which construct karyotypes from cells from structures that support the fetus. In amniocentesis, a needle passed through the abdomi- species have telocentric chromosomes that have only one arm, nal wall removes a small sample of amniotic fluid from the but humans do not. The long arm of a chromosome is desig- uterus of a pregnant woman (figure 13.5a). Fetal cells in nated q, and the short arm p (for “petite”). the fluid are cultured for 7 to 10 days, and then 20 cells are Five human chromosomes (13, 14, 15, 21, and 22) have karyotyped. Additional tests on biochemicals in the fluid and bloblike ends, called satellites, that extend from a thin, stalk- single-gene tests can reveal some inborn errors of metabo- like bridge. The stalk regions do not stain, but they carry many lism. Ultrasound is used to place the needle and to visualize copies of genes encoding ribosomal RNA and ribosomal pro- the fetus (figure 13.5c). Amniocentesis can be safely per- teins. These areas coalesce to form the nucleolus, a structure in formed after 14 weeks. For many years amniocentesis was the nucleus where ribosomal building blocks are produced and limited to women over age 35, when the risk of the procedure assembled (see figure 2.2). equals the risk of miscarriage, which rises with maternal age Karyotypes are useful at several levels. When a baby is (figure 13.6). As safety improved, amniocentesis was offered born with distinctive facial characteristics of a chromosomal to younger women. Then other tests were developed. syndrome, a karyotype can confirm the clinical diagnosis. The cells sampled between weeks 10 and 12 in CVS Within families, karyotypes are used to identify relatives come from the chorionic villi, which are fingerlike structures with a chromosome aberration that can affect health. In one that develop into the placenta (figure 13.5b). Because chorionic family, several adults died from a rare form of kidney cancer. villi cells and fetal cells descend from the fertilized ovum, it Karyotypes revealed that the affected individuals all had an is assumed that they will have the same chromosomal content. exchange of genetic material between chromosomes 3 and 8. However, rarely, a mutation can occur in either type of cell, When karyotypes showed that two healthy young family mem- leading to a false negative or false positive. If CVS indicates bers had the unusual chromosomes, further testing indicated an abnormal chromosome in a villus cell that is not also in the the cancer. They were successfully treated. fetus, the couple may elect termination of a chromosomally nor- Karyotypes of individuals from different populations mal fetus. In the opposite situation, a chorionic villus cell might can reveal the effects of environmental toxins, if abnor- have normal chromosomes when the fetus does not, providing a malities appear only in a group exposed to a contaminant. false sense of security that all is well. CVS cannot detect inborn Because chemicals and radiation that can cause cancer and errors in biochemicals because amniotic fluid is not sampled. birth defects often break chromosomes into fragments or As the techniques for collecting chromosomes evolved, so rings, detecting this genetic damage can alert researchers did the methods for distinguishing them. Early karyotypes used to the possibility that certain cancers may appear in the generalized stains, which could not distinguish chromosomes population. of similar size, which were considered in groups. Develop- ment of more discriminating binding chemicals led to the abil- ity to tell chromosomes apart by banding patterns. A technique called fluorescence in situ hybridization (FISH) adds precision Key Concepts Questions 13.1 by applying pieces of DNA, called probes, which are attached a. What are the basic parts of a chromosome? to molecules that produce a flash of color when they bind their complements on the chromosomes in a tissue sample. Use of *b. What does a karyotype show? an algorithm applies a unique false color to each chromosome, “painting” a karyotype from several fluorescent dyes. Many !"" Part 3!DNA and Chromosomes  1:50 Fetal cells suspended Frequency in the fluid around the fetus are sampled. 1:100 1:500 Fetus 15–16 weeks 1:1000 20 25 30 35 40 45 (a) Amniocentesis Maternal age (years) Trisomy 21 in liveborn infants Figure #$.'&The maternal age effect."The risk of conceiving an offspring with trisomy 21 rises dramatically with maternal age."Source: Color Atlas of Genetics by Eberhard Passage, p. 401. Thieme Medical Publishers, Inc. Cells of the chorion are sampled. (b) Chorionic villus sampling (c) Ultrasound image Figure #$.(&FISHing for genes and chromosomes. FISH shows three fluorescent dots that correspond to three Figure #$.%&Checking fetal chromosomes, directly and copies of chromosome 21. Each dot represents a specific DNA indirectly. (a) Amniocentesis shows chromosomes from fetal sequence with!which the fluorescently labeled probe forms cells in amniotic fluid."(b) Chorionic villus sampling examines complementary base pairs."James King-Holmes/Science Source chromosomes from cells of structures that develop into the placenta. (c) Ultrasound images the fetus and may reveal an anomaly that is associated with a specific chromosome techniques. It is also called noninvasive prenatal diagnosis or abnormality."(C): Dr. Najeeb Layyous/Science Source testing. (Ultrasound is also noninvasive.) Analysis of cell-free fetal DNA is based on proportions. For example, blood from a woman whose fetus has trisomy 21 laboratories use FISH probes for the most common chromo- Down syndrome has about 50 percent more DNA pieces from somal abnormalities: an extra chromosome 13, 18, or 21, and sex chromosome 21 than it does from the other chromosomes. chromosome anomalies. Figure 13.7 shows the extra flash of a That extra DNA represents the third copy of the chromosome. cell from a person with trisomy 21. Amniocentesis may be offered to confirm a finding using cell- free DNA, from which a karyotype is constructed showing the Cell-Free Fetal DNA Testing extra chromosome. One advantage of the cell-free analysis is Small pieces of DNA are normally present in the blood- that women of all ages use it, saving older women from the stream. In a pregnant woman, about 20 percent of those pieces more invasive older techniques, while also detecting chromo- come from the placenta, and therefore represent the fetus somal conditions in the fetuses of younger women that might (figure 13.8). The DNA pieces are called “cell-free” because have been missed with the older techniques. Cell-free testing is they are not enclosed in cells. Tests of cell-free fetal DNA are so sensitive that it has even picked up cancer cells, which also done at 10 weeks or later, and are rapidly replacing the older shed DNA, in women who do not yet have cancer symptoms. Chapter 13+Chromosomes !"%  Maternal cell-free DNA Table #$.# Chromosomal Shorthand Abbreviation Meaning #$,XY Normal male Fetal cell-free DNA #$,XX Normal female #%,X A female with one X White #&,XXY A male with an extra X blood cell #&,XYY A male with an extra Y Nucleated #$,XY,del (&q) A male missing part of the long arm red blood cell of chromosome & #&,XX,+'( A female with trisomy '( Down syndrome #$,XY,t(&;))(p'(.(; q*#.() A male with a translocation between the short arm of chromosome & Figure #$.)&Testing cell-free fetal DNA."The fact that at band '(.( and the long arm of pieces of cell-free fetal DNA in the maternal circulation are much chromosome ) at band *#.( shorter than pieces of maternal DNA provides a way to collect the fetal material and sequence the genome by overlapping pieces. #+,XXYY A male with an extra X and an extra Y chromosome To detect single-gene conditions, cell-free fetal DNA must be compared to haplotypes from blood samples from the A chromosomally normal male is designated 46,XY and a parents for the same chromosomal regions. This is done to dis- female 46,XX. Bands and subbands identify specific genes. For tinguish mutations that are in the fetus from those in the preg- example, the gene that encodes the beta-globin subunit of hemo- nant woman. For example, a fetus with identical mutant CFTR globin is located at 11p15.5—the short arm of chromosome 11 at alleles yet no wild type alleles may have indeed inherited cys- subband 15.5. Graphical representations called ideograms depict tic fibrosis from two carrier parents, but the sample might only the arms, bands, and subbands of chromosomes (figure 13.9). have captured mutant alleles from the pregnant woman. A haplotype would show surrounding DNA sequences, enabling the distinction between the fetal and maternal genomes. Some laboratories analyze cell-free fetal DNA only for the more common chromosomal abnormalities, but entire genomes can be reconstructed from the DNA pieces. These Short arm p more complete analyses are used to distinguish de novo (new) mutations from inherited mutations in parent-child trios, such as the family described in Clinical Connection 1.1. An indirect type of test indicates an elevated risk of hav- Centromere ing an abnormal chromosome number. It measures biochemi- cals whose levels in the blood are within a certain range in a pregnant woman carrying a fetus with the normal number of chromosomes, but lie outside that range in fetuses whose cells have an extra copy of a certain chromosome. Long arm q Chromosomal Shorthand Band Sub-band The information in a karyotype is abbreviated by listing the chromosome number, sex chromosome makeup, and atypical autosomes (discussed in subsequent sections of this chapter) (table 13.1). Symbols and shorthand describe the type of aber- ration, such as “del” for deletion and “t” for translocation, in which chromosomes exchange parts or a piece of one chromo- some is moved to another. After the shorthand, numbers corre- Figure #$.*&Ideogram."This ideogram depicts spond to bands and subbands that are assigned to the markings chromosome 7. It is approximately 160 million base pairs on chromosomes that arise from staining and FISH. long."Source: U.S. National Library of Medicine !"' Part 3!DNA and Chromosomes  Key Concepts Questions 13.2 Polyploidy The most extreme upset in chromosome number is an entire a. What are some cell types from which chromosomes extra set. A cell with extra sets of chromosomes is polyploid. are examined? An individual whose cells have three copies of each chromo- *b. Name the two older techniques of prenatal diagnosis some is a triploid (designated 3N, for three sets of chromo- that sample and culture chromosomes from cells taken somes). Two-thirds of all triploids result from fertilization of an from the supportive structures of the fetus. oocyte by two sperm. The other cases arise from formation of a c. Explain how distinguishing chromosome types has diploid gamete, such as when a normal haploid sperm fertilizes become more specific. a diploid oocyte. Triploids account for 17 percent of spontane- *d. Identify the source of fetal DNA in cell-free fetal DNA ous abortions (figure 13.10). Very rarely, an infant survives a testing. few days, with defects in nearly all organs. However, certain e. What are the symbols for the chromosomes of a human cells may be polyploid. The liver, for example, has some normal male and female? tetraploid (4N) and even octaploid (8N) cells. Polyploids, although uncommon in humans, are common among flowering plants, including roses, cotton, barley, and wheat, and in some insects. Fish farmers raise triploid salmon, !"."&Atypical Chromosome which cannot breed because their gametes contain different Number numbers of chromosomes. A human karyotype is atypical (abnormal) if the number of Aneuploidy chromosomes in a somatic cell is not 46, or if individual chro- Cells missing a single chromosome or having an extra chro- mosomes have extra, missing, or rearranged genetic material. mosome are aneuploid, which means “not good set.” Rarely, More discriminating technologies can detect very small num- aneuploids can have more than one missing or extra chromo- bers of extra or missing nucleotides. As a result, more people some, indicating abnormal meiosis in a parent. A normal chro- are being diagnosed with chromosomal abnormalities than in mosome number is euploid, which means “good set.” the days when stains made all chromosomes look alike. Atypical chromosomes account for at least 50 percent of spontaneous abortions, yet only 0.65 percent of newborns have them. Therefore, most embryos and fetuses with atypical chro- mosomes stop developing before birth. Table 13.2 summarizes the types of chromosome variants in the order in which they 1 2 3 4 5 are discussed. Table #$.! Chromosome Abnormalities 6 7 8 9 Type of Abnormality Definition Polyploidy Extra chromosome sets Aneuploidy An extra or missing chromosome 10 11 12 X ,Monosomy One chromosome absent ,Trisomy One chromosome extra 13 14 15 Deletion Part of a chromosome missing Duplication Part of a chromosome present twice 16 17 18 Translocation Two chromosomes join long arms or exchange parts 19 20 Inversion Segment of chromosome reversed Isochromosome A chromosome with identical arms 21 22 Y Ring chromosome A chromosome that forms a ring due to deletions in telomeres, which Figure #$.#+&Polyploids in humans are nearly always cause ends to adhere lethal."Individuals with three copies of each chromosome (triploids) in every cell account for 17 percent of all Chromothripsis One or more chromosomes shatters spontaneous abortions and 3 percent of stillbirths and newborn deaths."CNRI/Science Source Chapter 13+Chromosomes !"(  Most autosomal aneuploids (with a missing or extra non- discoverers. Today, cytogenetic terminology is used because it sex chromosome) are spontaneously aborted. Those that survive is more precise. For example, Down syndrome can result from have specific syndromes, with symptoms depending on which a trisomy or a translocation. The distinction is important in chromosomes are missing or extra. Intellectual disability is com- genetic counseling. Translocation Down syndrome, although mon in aneuploidy because development of the brain is so com- accounting for only 4 percent of cases, has a much higher plex and of such long duration that nearly any chromosome-scale recurrence risk within a family than does trisomy 21 Down disruption affects genes whose protein products affect the brain. syndrome, a point we return to later in the chapter. Sex chromosome aneuploidy usually produces milder symptoms. The meiotic error that causes aneuploidy is called Most children born with a chromosome number other nondisjunction. Recall that in normal meiosis, homologs than 46 have an extra chromosome (a trisomy) rather than a separate and each of the resulting gametes receives only one missing one (a monosomy), because monosomies are typically member of each chromosome pair. In nondisjunction, a chro- so severe that an affected embryo ceases developing (except mosome pair does not separate at anaphase of either the first some cases of a female with only one X chromosome). Trisomies or second meiotic division. This unequal division produces a and monosomies are named for the chromosomes involved, sperm or oocyte that has two copies of a particular chromo- and in the past the associated syndromes were named for the some, or none, rather than one copy (figure 13.11). When such Primary spermatocyte First division nondisjunction Meiosis I Secondary spermatocyte Second division Meiosis II nondisjunction Sperm Fertilization of euploid oocyte Zygotes Monosomic Monosomic Trisomic Trisomic Euploid Euploid Monosomic Trisomic (a) Nondisjunction at meiosis I (b) Nondisjunction at meiosis II Figure #$.##&Extra and missing chromosomes—aneuploidy."Unequal division of chromosome pairs can occur at either the first or second meiotic division. (a) A single pair of chromosomes is unevenly partitioned into the two cells arising from meiosis I in a male. The result: Two sperm cells have two copies of the chromosome, and two sperm cells have no copies. When a sperm cell with two copies of the chromosome fertilizes a normal oocyte, the zygote is trisomic; when a sperm cell lacking the chromosome fertilizes a normal oocyte, the zygote is monosomic. (b) This nondisjunction occurs at meiosis II. Because the two products of the first division are unaffected, two of the mature sperm are normal and two are aneuploid. Oocytes can undergo nondisjunction as well, leading to zygotes with extra or missing chromosomes when normal sperm cells fertilize them. (Both chromosome pairs of the spermatocytes are depicted in the same color to distinguish them from the introduction of a maternal genome with the oocyte.) !") Part 3!DNA and Chromosomes a gamete meets its partner at fertilization, the resulting zygote Comparing and Contrasting has either 45 or 47 chromosomes, instead of the normal 46. Table #$.$ Trisomies 13, 18, and 21 Different trisomies tend to be caused by nondisjunction in the male or female, at meiosis I or II. Percentage of Conceptions A cell can have a missing or extra chromosome in 49 Type of Incidence at That Survive ! Year After ways—an extra or missing copy of each of the 22 autosomes, Trisomy Birth Birth plus the sex chromosome combinations of Y, X, XXX, XXY, and XYY. (Some individuals have four or even five sex chromo- (* (Patau) (/(',%--–(/'(,&--