Chapter 14 Biol 1610 Transcription-Translation PDF

 1) Define the central dogma of biology using a simple diagram. What is a gene? What do genes code for? What are the two steps in protein synthesis? – DNA (genes) codes for RNA – Transcription mRNAs code for proteins (1 gene → 1 protein)...

 1) Define the central dogma of biology using a simple diagram. What is a gene? What do genes code for? What are the two steps in protein synthesis? – DNA (genes) codes for RNA – Transcription mRNAs code for proteins (1 gene → 1 protein) Translation DNA RNA Protein Draw a dipeptide. Replication Show how the 2 aa’s are connected. 2) Where does transcription take place and what enzyme catalyzes it? Translation? – Transcription occurs in the nucleus (catalyzed by RNA polymerase) – Translation occurs in the cytoplasm. It is mediated by ribosomes 3) How are genes regulated in eukaryotes? – need TF’s (Transcription Factors) to bind to promoter and recruit RNA polymerase to initiate transcription. – 3 steps in each process: Initiate: TFs recruits RNA polymerase which does transcription Elongate: make RNA copy of gene Terminate: end process  Anatomy of a gene Transcription STOP site: this part of the START of gene: factors bind here, gene makes mRNA that RNA polymerase and recruit RNA folds into a kink, making unzips DNA and polymerase RNA polymerase fall off, begins making and end transcription RNA copy here ATCCGCATATATACCACTCCGCCTTTAATCCACTGCATAC TAGGCGTATATATGGTGAGGCGGAAATTAGGTGACGTATG promoter gene -3-2-1 +1 +2 +3 +4 +5 +6 upstream downstream start Transcription: the process of making an RNA copy of a DNA gene RNA polymerase: , only enzyme needed to make mRNA. It unzips the DNA and builds the RNA copy of the template strand Coding strand, (DNA) has same nucleotide sequence as the mRNA being built, but is not copied Template strand, (DNA) this is the strand RNA transcript: (RNA) being transcribed to make RNA. leaves nucleus after processing, and then gets translated by a The other strand of DNA does not get copied. ribosome Transcription (click for animation)  Long term The Flow info storage of Genetic Informatio n Temporary info DNA→ RNA →protein Functional One to One machine to do work of Three to One cell Same language → transcription Different language → translation  There are 2 steps in going from gene to protein Step 1: Transcription (DNA mRNA) Takes place in the nucleus, Mediated by RNA polymerase II 1:1 process (each DNA nucleotide codes for an RNA nucleotide) – DNA opens up, gene gets copied, RNA leaves and DNA closes Step 2: Translation (mRNA Protein) Takes place in the cytoplasm, Mediated by ribosome (which brings in correct tRNA’s and aa’s, as the mRNA is read.) 3:1 process (3 nucleotides code for 1 amino acid) Not all genes – The ordercode for proteins! of nucleotides in the mRNA determines the order of amino Some acids genes in code for proteins (these make mRNA when transcribed), the protein – As aa’s are added sequentially, in the correct order, the specific Some genes code for other types of RNA (tRNA, rRNA, etc)  3(+) types of RNA needed in cells All of these RNAs are formed by Transcription the process of mRNA: the copy of the DNA gene (messenger RNA) ACCUGAACCGUUAAAG – The message rRNA: (ribosomal RNA) makes up the 49 proteins, 3 rRNA ribosome (riobosomes are a complex of rRNA and 33 proteins 1 rRNA proteins (about 80 proteins and 4 different rRNAs) – Ribosomes decode mRNA, and read it to make proteins tRNA: translates from mRNA to protein (transfer t-RNA RNA) Also other RNAs in cells : snRNA, miRNA – Reads mRNA and brings in amino acids in the m-RNA CODON  Each gene requires its own unique set of transcription factors. TFs bind the promotor (and enhancers), This changes the shape and attracts RNA pol II which initiates transcription Other transcription factors RNA polymerase II Eukaryotic Transcription DNA factor Initiation TATA box complex 1. A transcription factor recognizes and 2. Other transcription factors are 3. Ultimately, RNA polymerase II associates with the binds to the TATA box sequence, which recruited, and the initiation complex transcription factors and the DNA, forming the is part of the core promoter. begins to build. initiation complex, and transcription begins. Requiring the correct SET of TFs enables regulation 8of gene expression. Only those cells with the right sets of Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. TFs will have a particular gene on. Initiation of transcription 1 A eukaryotic promoter Promoter Nontemplate strand DNA 5 T A T A A AA 3 3 A T AT T T T 5 TATA box Template strand Start point 2 Several transcription Transcription factors bind to DNA factors 5 3 3 5 3 Transcription initiation complex forms RNA polymerase II Transcription factors 5 3 3 3 5 5 RNA transcript Transcription initiation complex INTIATION of TRANSCRIPTION: Transcription factors (TFs) bind to the promoter of a gene. This recruits the enzyme, RNA Polymerase. 1 A eukaryotic promoter Promoter Nontemplate strand DNA 5 T A T A A AA 3 3 A T AT T T T 5 TATA box Start point Template strand 2 Several transcription Transcription factors bind to DNA factors 5 3 3 5 3 Transcription initiation complex forms RNA polymerase II Transcription factors 5 3 3 3 5 5 RNA transcript Transcription initiation complex ELONGATION of TRANSCRIPTION: RNA Polymerase then reads the template strand of the DNA, and builds an RNA copy of the gene. (the DNA unzips, then closes again and is not changed).  Promoter Transcription unit Summary of the 3 steps of 5 3 Transcription 3 5 Upstream regulatory DNA Start point sequences on the RNA polymerase DNA, determine when 1 Initiation a gene is on or off (by binding of TFs) Nontemplate strand of DNA 5 3 When the correct 3 5 Template strand of DNA proteins bind the RNA promotor, then RNA Unwound transcript DNA pol II binds, and 2 Elongation transcription starts. Rewound DNA Transcription ends 5 3 due to specific DNA 3 3 5 5 sequences which cause RNA pol to RNA drop off. transcript 3 Termination The nascent mRNA 5 3 can now be processed 3 5. 5 3 Completed RNA transcript Add 5’ cap Add poly A tail Direction of transcription (“downstream”) Remove introns Step 1: Transcription If a cell wants to make a certain protein, it first finds the correct gene in the genome, opens the DNA and makes an RNA copy, called mRNA (messenger RNA) of that gene. Copying the DNA to make an RNA copy is called transcription. Read 3’ to 5’ Only one strand of the DNA is Build 5’ to 3’ copied (the TEMPLATE STRAND) Which strand gets copied? The other strand is the coding strand or NON-TEMPLATE strand. (since it has the same 3’ “code” as the mRNA) 5’ 5’ The RNA copy is complementary to the DNA gene Transcription: the process of making an RNA copy of a gene RNA polymerase: , only enzyme needed to make mRNA. It unzips the DNA and builds the RNA copy of the template strand Coding strand, (DNA) has same nucleotide sequence as the mRNA being built, but is not copied Template strand, (DNA) this is the RNA transcript: (RNA) strand being transcribed to make RNA. leaves nucleus after processing, and then gets The other strand of DNA does not get copied. translated by a ribosome Transcription (click for animation) Eukaryotic mRNA processing: Ribozyme: an RNA catalyst (like 3 steps an enzyme, but made of RNA not protein) 1) Add 5’ methyl G cap Nuclear 2) Add 3’ Poly A tail envelope 3) Splice mRNA (to remove Introns. Exons get spliced together. Occurs only in some mRNAs) TRANSCRIPTION DNA Spliceosome is a protein/snRNA complex that performs splicing Like a ribosome, which is an rRNA/protein complex Pre-mRNA RNA PROCESSING that perfroms translation mRNA DNA 5’ cap TRANSCRIPTION Poly A tail Introns removed mRNA Ribosome TRANSLATION Ribosome TRANSLATION Polypeptide Polypeptide (a) Bacterial cell (b) Eukaryotic cell  Why modify mRNA: 3 mRNA processing steps(in eukaryotes) Allows mRNA to leave nucleus Protects mRNA from hydrolytic enzymes 1) add 5’ cap (modified G nucleotide) Helps initiate translation 2) add polyA tail (50-250 A’s) (ribosomes attach to the 5 methyl G cap) 3) remove introns and splice exons 5 Exon Intron Exon Intron Exon 3 Pre-mRNA 5 Cap Poly-A tail Codon 130 31104 105 numbers 146 Introns cut out and exons spliced together mRNA 5 Cap Poly-A tail 1146 5 UTR 3 UTR Coding segment 5’ methyl G cap: directs mRNA out of nucleus and helps ribosome attach 3’ Poly A tail: regulates how long the mRNA lasts Alternative Splicing: allows variations of a protein type to be made  RNA transcript (pre-mRNA) 5 Exon 1 Intron Exon 2 Protein spiceosomes Other snRNA proteins are complexes of protein and snRNPs special snRNAs that cut and Spliceosome: splice mRNA Spliceosome complex of snRNA and protein, ribozymes are complexed with more “enzymes” 5 proteins. Functions to made of RNA instead of splice mRNA protein Vocab check: nucleosome ribosome ‘lasso’ gets Spliceosome degraded and replisome components recycled spliceosome Cut-out ribozyme mRNA intron enzyme 5 Exon 1 Exon 2  The mRNA copy is made using base pairing rules as we learned for DNA (except U is used, instead of T). – A pairs with U (instead of T as it would in DNA) – C pairs with G Write the mRNA transcript that will be made from the following DNA (the upper strand is the template DNA) DNA: 3’ TACCCGTATTACCGGATC 5’ Template strand ATGGGCATAATGGCCTAG Coding strand mRNA: 5’ AUGGGCAUAAUGGCCUAG 3’ How will this code be read to make a protein? Step 1- transcription; makes mRNA (in the nucleus) Step 2-translation (ribosome reads RNA info and uses it to build a protein, (in the cytoplasm)  Growing Exit tunnel Three binding sites for tRNA TRANSLATION: process tRNA polypeptide The P site holds themolecules tRNA that carries of reading mRNA to build protein the growing Polypeptide chain The A site holds the tRNA that carries Large the next Amino acid to be added toEthe subunit A site: chain P A Next Amino acid to Add The E site is the Exit site, where Small discharged tRNAs leave the ribosome P site: subunit growing Polypeptide 5 mRNA 3 RIBOSOME E site: ribosome (a) Computer model of functioning Exiting tRNA Growing polypeptide P site (Peptidyl-tRNA Exit tunnel Amino end Next amino binding site) acid to be added to A site (Aminoacyl- polypeptide E site tRNA binding site) chain (Exit site) E tRNA E P A Large mRNA 3 subunit mRNA binding site Small 5 Codons subunit (b) Schematic model showing binding sites (c) Schematic model with mRNA and tRNA 3 types of RNA needed for translation mRNA: contains the info to make a protein (messenger RNA) – Got this message from the DNA gene ACCUGAACCGUUAAAG rRNA: (ribosomal RNA) ribosomes are made of a complex of rRNA and protein (about 80 proteins and 4 rRNAs) 49 proteins, – Ribosomes decode mRNA, and read it to make proteins 3 rRNA 33 – ribosomes have 2 subunits (large and small) proteins 1 rRNA tRNA: (transfer RNA) is the intermediary. It binds the mRNA to bring in the appropriate amino acid at the right time Amino acid Genes code for each of these t-RNA types of RNA. Transcription always forms RNA. (But there are ANTICODON m-RNA different kinds of RNA. Only mRNA codes for protein) CODON tRNA tRNA is transcribed by RNA pol III Transfer RNA: each tRNA Amino acid carries a specific amino acid. It binding site matches its anticodon with codons on mRNA Each tRNA will carry only one specific amino acid So the code is not ambiguous. But more than one tRNA can carry the same aa, so the code is redundant. (also called degenerate) anticodon Explain: How does the mRNA determine the order of aa’s to be added in the growing protein chain? Figure 8.5 tRNA’s are the “translators”- they match the correct codon to the correct aa 2D “Cloverleaf” Model 3D Ribbon-like Model Acceptor end Multiple Acceptor end 3‫׳‬ Amino acid 5‫׳‬ ways to binding site represent tRNA’s Anticodon loop Anticodon loop 3D Space-filled Model Icon Acceptor end Acceptor end anticodon Anticodon loop Anticodon end c: Created by John Beaver using ProteinWorkshop, a product of the RCSB PDB, and built using the Molecular Biology Toolkit developed by John Moreland and Apostol Gramada (mbt.sdsc.edu). The MBT is financed by grant GM63208  Aminoacyl-tRNA transferase enzyme loads each tRNA with the correct amino acid Amino Carboxyl group group NH + NH + NH + Trp C O 3 Trp 3 3 Trp C C O– Accepting O ATP AM AM O site PO P O Amino acid site OH OH Pi Pi tRNA tRNA site Aminoacyl-tRNA synthetase Anticodon specific to tryptophan Each tRNA carries a specific amino acid: the genetic code Very important these enzymes are not mutated or will add wrong amino acid when building the protein. These enzymes are highly conserved.  Growing Exit tunnel Three binding sites for tRNA TRANSLATION: process tRNA polypeptide The P site holds themolecules tRNA that carries of reading mRNA to build protein the growing Polypeptide chain The A site holds the tRNA that carries Large the next Amino acid to be added toEthe subunit A site: chain P A Next Amino acid to Add The E site is the Exit site, where Small discharged tRNAs leave the ribosome P site: subunit growing Polypeptide 5 mRNA 3 E site: ribosome (a) Computer model of functioning Exiting tRNA Growing polypeptide P site (Peptidyl-tRNA Exit tunnel Amino end Next amino binding site) acid to be added to A site (Aminoacyl- polypeptide E site tRNA binding site) chain (Exit site) E tRNA E P A Large mRNA 3 subunit mRNA binding site Small 5 Codons subunit (b) Schematic model showing binding sites (c) Schematic model with mRNA and tRNA The genetic code decoder ring 3:1 5’ UTR Open Reading Frame 3’ UTR mRNA XXXXXAUGXXXXXXXXXUAGXXXXX mRNA gets The start codon read in Start codon Stop codon groups of 3 establishes the (1 of 3 possible) nucleotides reading frame (methionine) (codon) Met Wha Tev Err “THE RED CAR HIT THE DOG” vs “T HER EDC ARH ITT HED OG” Genetic code key Table tells which aa will be brought in next by tRNA, Based on the codon sequence in the mRNA mRNA gets read in groups of 3 Nucleotides = CODON -There is redundancy in the genetic code, but no ambiguity. -All proteins start with AUG (met) -mRNA must be made in the correct “reading frame”. “THE RED CAR HIT THE DOG” vs “T HER EDC ARH ITT HED OG”  The genetic code is nearly universal! Currently growing malaria antibodies in tobacco plants (a) Tobacco plant expressing (b) Pig expressing a jellyfish a firefly gene gene The genetic code is nearly universal, shared by the simplest bacteria to the most complex animals Genes can be transcribed and translated after being transplanted from one species to another (this is why genetic engineering is possible. All organisms use the same genetic code!)  Quiz 26 1) What is the amino acid sequence for the following RNA sequence: AACGUAUGCCGUGCUUACCCCAUUGAUUGGAA 2a) How many codons? 2b) How many amino acids? 2c) What is the DNA code from which this mRNA was made? 2d) What type of mutation would occur if the red C was changed to an A?  Quiz 26 answers What is the amino acid sequence for the following RNA sequence: AACGUAUGCCGUGCUUACCCCAUUGAUUGGAA Met Pro Cys Leu Pro His STOP TTGCATACGGCACGAATGGGGTAACTAACCTT template strand AACGTATGCCGTGCTTACCCCATTGATTGGAA coding strand 2a) How many codons? 7 2b) How many amino acids 6 amino acids 2c) What is the DNA code from which this mRNA was made? See above 2d) ) What type of mutation would occur if the red C was changed to Mutations of one or a few nucleotides can affect protein structure and function Mutations are permanent changes in the genetic material of a cell or virus – Mutations in a gene are the source of new ALLELES – Diploid organisms get 2 alleles for every gene. Different alleles = VARIATION Point mutations are chemical changes in just one base pair of a gene (SNPs: single nucleotide polymorphisms) – two general categories AAA TTT CCC GGG TTT AAA GGG CCC Nucleotide-pair substitutions AAA TCT CCC GGG nucleotide-pair insertions or deletions TTT AGA GGG CCC AAA TTTC CCG GG TTT AAAG GGC CC MUTATIONS are rare but important. They are the source of new alleles. They make evolution possible. Mutations occur randomly. Then natural  Mutation summary Changes in DNA sequence = mutations Changes in genetic sequence might affect the order of amino acids in a protein. – Protein function is dependent on the precise order of amino acids (primary protein structure determines final shape and therefore function) – Possible outcomes of mutation: 1 - no change in protein (neutral or silent mutation – changed nucleotide sequence but still has same aa sequence, so normal function) 2 - non-functional protein (different aa sequence resulting in loss of function- nonsense or truncated)- nonsense mutation 3 - different protein (different aa sequence resulting in protein with a new function- missense mutations)- missense mutation Point Mutation summary substitution mutation – simple substitution of one nucleotide base for another – May be harmful If Change an aa to a different type (missense) If Add an early stop code, or remove the stop code (nonsense- meaning nonfunctional protein results, also called truncation if end early) – May not be harmful If Exchange aa for another of same type (missense) If New codon codes for the same aa, so no change –This is called a neutral (silent) mutation Frameshift mutation: changes the reading frame – Always very detrimental (nonsense) – Changes many aa’s and therefore protein has very different shape, or lose the start so get no protein at all. How are proteins delivered to their correct destination in the cell? Some proteins do their job in the cytosol – These proteins are made on free ribosomes Other proteins need to be delivered into a specific organelle – These proteins have a signal sequence causing them to get built into the ER, – From there, they are delivered via vesicles to their correct final destination – This is called ENDOMEMBRANE DELIVERY SYSTEM  Cytosolic vs. proteins processed in the ER Polypeptide synthesis always begins in the cytosol, but not all ends there Polypeptides destined for the ER or for secretion are marked by a signal peptide A cytosolic signal-recognition particle (SRP) binds to the signal peptide and delivers the ribosome to the ER 1 Ribosome 5 mRNA 4 Signal ER peptide Signal membrane 3 peptide SRP Protein removed 6 SRP 2 receptor CYTOSOL protein ER LUMEN Translocation complex Cytosolic proteins do not have a signal peptide Secreted (or organelle) proteins have a signal peptide Ex: Would a glycolytic enzyme have a signal peptide? Would a GPCR? Protein targeting (delivery to correct destination) In eukaryotes, translation may occur on free ribosomes in the cytoplasm or on bound ribosomes attached to the rough endoplasmic reticulum (RER) – All protein begin translation on free ribosomes – Ribosomes making proteins with an ER signal sequence pause, and get delivered to the ER 4 step process: if a nascent protein has a signal sequence, then… 1- the signal sequence binds to the signal recognition particle (SRP) 2- signal sequence - SRP complex binds RER receptor proteins and docks the ribosome at the ER 3-translation resumes, into the ER thru an ER pore 4- protein is now in the endomembrane system pathway 34