BMS100 Central Dogma PDF

Central Dogma Dr. Rhea Hurnik BMS100 Learning outcomes • Describe the structure of DNA, including the role of the following bond types to overall stability: phosphodiester bond, hydrophobic interaction/ base stacking, hydrogen bonds, base stacking, and electrostatic interactions. • Describe the...

Central Dogma Dr. Rhea Hurnik BMS100 Learning outcomes • Describe the structure of DNA, including the role of the following bond types to overall stability: phosphodiester bond, hydrophobic interaction/ base stacking, hydrogen bonds, base stacking, and electrostatic interactions. • Describe the function and levels of DNA condensation. • Differentiate between structural elements of RNA and DNA and outline the roles of the following RNA molecules: hnRNA, snRNA, mRNA, tRNA, rRNA, miRNA, siRNA, lncRNA • Outline the steps of transcription: initiation, elongation, processing, and termination and the role of RNA Polymerase and DNA topoisomerase. • Understand the genetic code and determine which amino acid would be added for a given codon. • Describe the function of the following molecules to translation: small and large ribosomes, tRNA, aminoacyl-tRNA synthetase, petidyl synthetase • Outline the steps of translation: initiation, elongation, and termination • Describe how proteins are targeted to a cellular location during translation. Plan Pre-learning 1) DNA, Chromosomes, & genes 2) RNA In-class: Transcription Translation Post-learning Regulation of protein synthesis Central Dogma • DNA does not direct protein synthesis itself, but uses RNA as an intermediate: Outline – In class Transcription Introduction RNA Polymerase Steps of transcription Initiation, elongation, processing, termination Translation Introduction Preparing the tRNA Ribosomes Steps of translation Initiation, Elongation, termination Transcription introduction • Transcription refers to the process of synthesizing an RNA molecule from DNA template (ie a gene) that will dictate the synthesis of a protein. § Occurs in the cell nucleus Transcriptional unit • The transcription unit outlines the 3 general region found in all genes: § Promotor region – contains consensus sequence § Coding region • Transcribed into mRNA § Terminator region • Specifies end of transcription 5’ 3’ Promoter RNA-coding region TATA Transcription start site Terminator 3’ 5’ Template strand • The strand of DNA that is transcribed into RNA is referred to as the template strand. § It can also be referred to as the anti-sense strand • The template strand’s complimentary partner is referred as the non-template strand. § It can also be referred to as the sense strand RNA polymerase • RNA polymerase is the main key enzyme for transcription: § It moves along the DNA, unwinding the DNA helix just ahead of the active site for polymerization § Catalyzes a new phosphodiester bond on the newly-forming strand of RNA RNA polymerase cont. • RNA polymerase § Works in the 5’ à 3’ direction Template (aka non-sense strand) 3’ 5’ 5’ 5’ 3’ Non-template (aka sense strand) 3’ RNA polymerase - Thinking question • RNA polymerase § Make mistakes at a rate of 1 for every 104 nucleotides • Preview: DNA polymerase makes mistakes at a rate of 1 in every 107 nucleotides. § When do we use DNA polymerase? • What is the significance of this? Steps of transcription • Transcription can be divided into 4 stages: § Initiation § Elongation § Processing § Termination Step 1 - Initiation • In order to begin transcription, RNA polymerase must recognize where to start. § Transcription initiation factors help with this process: • In prokaryotes there is just one: sigma factor • In Eukaryotes there are many different types, we will consider the role of general transcription factor TFII § Needed for RNA Polymerase II which transcribes all protein-coding genes in eukaryotes Step 1a – Initiation • A) TFII recognizes and binds a consensus sequence in the promoter region § In Eukaryotes one example is called the TATA box • Located ~25 nucleotides upstream from the transcription start site. • TFIID is the specific TFII that binds the TATA box Step 1bàd - Initiation • B) Other transcription factors join § Names of additional transcription factors are FYI • C) RNA Polymerase II joins • D) Transcription initiation complex is complete & transcription can begin Step 1 – Initiation: regulation • The TATA box (or other consensus sequences) aren’t the only binding site on DNA that influences initiation of transcription § Repressor proteins bind upstream sequences called silencers (aka negative regulatory elements) • Inhibit gene transcription Step 1 – Initiation: regulation cont. • Transcriptional activator proteins bind upstream sequences of DNA called enhancers (aka positive regulatory elements) § Increase the rate of transcription by attracting the RNA polymerase II enzyme. • Q: What might happen if there was a mutation in an enhancer sequence of DNA? Step 2 - Elongation • Once RNA Polymerase begins transcribing DNA, most of the general transcription factors (TFII) are released § These transcription factors are then available to initiate another round of transcription with new RNA Polymerase molecule Step 2 - Elongation • RNA polymerase moves downstream along the DNA, transcribing the coding region. § Various elongation factors are needed to help reduce the likelihood that RNA polymerase dissociating from DNA before it reaches the end of a gene. Step 2 - Elongation • In addition to elongation factors, eukaryotes also require: • Chromatin remodeling complexes help the RNA polymerase navigate the chromatin structure • Histone chaperones partially disassemble & reassemble nucleosomes as an RNA Polymerase passes through Step 2 - Elongation • As RNA polymerase move along the DNA double helix it generates supercoils. § In Eukaryotes DNA topoisomerase removes this super-helical tension DNA topoisomerase • The enzyme DNA topoisomerase relieves the super-helical tension by breaking the phosphodiester bond. • This allows the two sections of the DNA helix to rotate freely & relieve tension. • The phosphodiester bond will reform as DNA topoisomerase leaves. Step 3 - Processing • In eukaryotes, during elongation, the pre-mRNA transcript is processed in 3 main ways: • 1) Splicing • 2) Capping the 5’ end • 3) Polyadenylation of 3’ end • Once these modifications are complete the transcript is called mRNA Step 3 – Processing within elongation • 1. 7-methyl guanosine cap § A modified guanine nucleotide is added to the 5’ end of the transcribed premRNA • This occurs early, once ~25 nucleotides of RNA have been transcribed § This 5’ cap facilitates export of the mRNA into the nucleus and is involved in translation • More to come! Step 3 – Processing within elongation • 2. Splicing § Both intron and exon sequences are transcribed into RNA • Introns are then removed in a processes called RNA splicing. § Splicing is performed by spliceosomes • Spliceosomes require a special form of RNA (snRNA) and proteins complexed into snRNPs § snRNA = small nuclear RNA § snRNP = small nuclear ribonucleoprotein • snRNP is referred to a spliceosome once it has complexed with the pre-mRNA Why does splicing occur? • 95% of human genes are spliced in more than one way § Splicing allows the same gene to produce a variety of different proteins § For example: Step 4 – Processing & termination • The 3’ end of the mRNA molecule is specified by signals encoded in DNA. § These signals are transcribed into RNA and then bind to proteins that facilitate cleavage of mRNA from RNA polymerase • FYI – CPSF & CstF Step 4 – Processing & termination cont. • 3. Poly A tail: § Once cleaved, ~200 A nucleotides are added to the mRNA § FYI - This catalyzed by an enzyme called Poly-A Polymerase (PAP) • Poly A tails protects the mRNA from degradation and facilitates export from the nucleus • Poly A binding proteins then bind the poly-A tail Prokaryotes • Up to this point we have been discussing eukaryotic transcription. § The steps of transcription in prokaryotes are the same, however the mRNA transcript produced in prokaryotes is a little different: • No processing is required for the prokaryotic mRNA transcript § No 5’ cap, splicing, or poly-A tail • No export from nucleus § Thus translation can begin right away • mRNA transcript is polycistronic § Codes for more than one protein Knowledge Check • During transcription, which of the following proteins bind the TATA box within the promotor region § A) DNA topoisomerase § B) RNA Polymerase § C) TFII D § D) Poly A polymerase Knowledge Check • Which of the following are CORRECT regarding RNA processing § A) A Poly A tail is added by PAP (poly A polymerase) to the 5’ end of the pre-mRNA transcript § B) During spicing the exons are removed by a spliceosome. § C) Splicing is catalyzed by snRNA and proteins complexed into snRNPs § D) A modified G nucleotide forms the 3’ cap, which protects the 3’ end from degradation and facilitate export out of the nucleus. § E) All of the above are true Outline – In class Transcription Introduction RNA Polymerase Steps of transcription Initiation, elongation, processing, termination Translation Introduction Preparing the tRNA Ribosomes Steps of translation Initiation, Elongation, termination Translation - introduction • Following processing and termination of transcription, mature mRNA is exported from the nucleus through nuclear pore complexes. • Once in the cytosol, mature mRNA is translated into protein Translation – introduction cont. • The mRNA sequence is decoded in sets of 3 nucleotides called codons. § There are 64 possible combinations of of 3 nucleotides but only 20 amino acids • Some amino acids are specified by more than one codon, demonstrating the redundancy of the genetic code Translation – Reading Frame • Reading Frames: § Since mRNA is interpreted in 3-nucleotide codons, the correct polypeptide sequence depends on the correct reading frame. • Special punctuation is needed to determine the correct reading frame. § Preview – in Eukaryotes it is the first AUG sequence. In Prokaryotes it is the Shine Dalgarno sequence Thinking Question: • Reading Frames: § Here are three possible polypeptides based on different reading frames Q: What might happen if a nucleotide was accidentally inserted into the middle of a gene? Translation – What is needed • A number of molecules are needed for translation: § mRNA transcript § tRNA • Needs to be bound to the correct amino acids (“charged tRNA”) § Ribosomes • A large and small subunit Translation – Preparing the tRNA • The cell makes a variety of tRNAs, each corresponding to one of the 20 amino acids § The enzyme aminoacyl-tRNA synthetase catalyzes the attachment of correct amino acid to tRNA Translation – What is needed • Protein synthesis is performed in the ribosome § Helps maintain correct reading frame and ensure accuracy of codon – anti-codon interaction • The ribosome complex is composed of various ribosomal proteins and ribosomal RNA (rRNA) § 2 subunits: • Small subunit • Large subunit *Note the 4 binding sites on the ribosome Translation – What is needed • Translation can be divided into 3 steps: § 1. Initiation § 2. Elongation • • • • A) tRNA binding B) Peptide bond formation C) Large subunit translocation D) Small subunit translocation § 3. Termination Translation – Steps • Translation can be divided into 3 steps: § 1. Initiation § 2. Elongation • • • • A) tRNA binding B) Peptide bond formation C) Large subunit translocation D) Small subunit translocation § 3. Termination Step 1 - Initiation • AUG is the first codon translated on the mRNA § Initiator tRNA carries the amino acid methionine • *Thus, all newly made proteins begin with methionine as the first amino acid at their N-terminus § Forms an initiator tRNA-methionine complex (Met-tRNAi) • Met-tRNAi is loaded into the small ribosomal subunit with initiation factors (eIFs) Step 1 – Initiation cont. • Small ribosome binds to the 5’ end of the mRNA § The 5’ 7-methyl guanosine cap helps with recognition of the 5’ end Step 1 – Initiation: scanning mechanism • Small ribosome moves along the mRNA (from 5’ to 3’) scanning for the first AUG § Requires ATP hydrolysis • Initiation factors dissociate & the large ribosome subunit assembles to complete the ribosome complex Step 1 – Initiation: Prokaryotes • Prokaryotic mRNA is polycistronic § An additional recognition sequence is needed for ribosome binding • Shine-Dalgnaro sequence (aka ribosome-binding site) Step 2 – Elongation • A) tRNA binding § Newly charged tRNA binds to the A site of the ribosome complex • B) Peptide bond formation § Carboxyl end of the polypeptide chain is released from the tRNA at the P site & joins the amino acid linked to the tRNA at the A site § This new peptide bond is catalyzed by peptidyl transferase enzyme contained within the large ribosomal subunit. Step 2 – Elongation • C) Translocation of large subunit: § Large ribosomal subunit moves relative to the mRNA held by the small subunit § Two tRNAs are shifted to the E and P sites • D) Translocation of small subunit § Small subunit shifts by 3 nucleotides § tRNA in E site is ejected • Cycle is repeated for new incoming amino acyl-tRNA Step 2 – Elongation • Elongation proceeds efficiently and accurately with the help of elongation factors (EFs) § These elongation factors enter and leave the ribosome during each cycle & are coupled with GTP hydrolysis Step 3 – Termination • A STOP codon marks the end of translation § UAA, UAG, UGA • Not recognized by a tRNA & do not specify an amino acid • Release factors bind to ribosomes with a stop codon in the A site Step 3 – Termination • Peptidyl transferase catalyzes the addition of a water molecular rather than amino acid § This frees the carboxyl end and releases the polypeptide • Ribosome releases the mRNA & dissociates into the large and small subunits § Subunits are recycled to begin new round of protein synthesis Knowledge Check • The first amino acid added to any polypeptide is: § A) Leucine § B) Methionine § C) Phenylalanine § D) Lysine Knowledge Check • Which of the following describes the correct order of translation initiation in eukaryotes: § A) Small ribosomal subunit binds to the 5’ cap and scans the mRNA until it reaches AUG, then Met-tRNAi binds to the P site § B) Met-tRNAi binds to the P site of the small ribosomal subunit, small ribosomal subunit binds to the 5’ cap and then scans mRNA until it reaches AUG § C) Small ribosomal subunit binds to the 5’ cap & scans the mRNA until it reaches AUG, the large ribosomal subunit binds, and then Met-tRNAi binds to the P site. § D) Small ribosomal subunit binds to the Shine Dalgnaro sequence, Met-tRNAi bind to the small ribosomal subunit, an then the small ribosomal subunit scans the mRNA until it reaches AUG Polysomes • Synthesis of proteins occurs on polyribosomes (or polysomes) § Multiple initiations take place on each mRNA molecule being translation § As soon as the preceding ribosome has translated enough of the nucleotide sequence to move out of the way, a new ribosome complex is formed. § Helps speed up rate of protein synthesis Post-translational • Once full translated, what happens next? § Protein is folded into specific 3-D shape • Proper folding is important since structure of a protein dictates its function! § More to come next class § May be modified in the ER: • Eg. Glycosylated – addition of mono- or oligosaccharide § Sent to its proper cellular location Clinical Application • Many antibiotics function by inhibiting bacterial protein synthesis § Interfering with the correct functioning of prokaryotic ribosomes § For example: In class Activity • Predict the polypeptide sequence of the following two eukaryotic mRNA: • A) 5’- AUGGGUCAGUCGCUCCUGAUU – 3’ • B) 5’- GGCAAUGUUGGCGCCAUAAUUU – 3’ References • Abali, Emine E; Cline, Susan D; Franklin, David S; Viselli, Susan M. Lippincott Illustrated Reviews: Biochemistry (Lippincott Illustrated Reviews Series) (p. 105). Wolters Kluwer Health • Boron, W. and Boulpaep, E. Medical Physiology (3rd ed). Elsevier • Alberts et al. Molecular Biology of the Cell. Garland Science. • Betts et al. Anatomy and Physiology (2ed). OpenStax • Images: § Kcneuman, CC BY-SA 4.0 <https://creativecommons.org/licenses/bysa/4.0>, via Wikimedia Commons. Retrieved from: https://upload.wikimedia.org/wikipedia/commons/7/7e/Topological_ram ifications_of_DNA_replication_and_transcription.jpg