🎧 New: AI-Generated Podcasts Turn your study notes into engaging audio conversations. Learn more

Biologia Molecolare Tutto-pagine-9.pdf

Loading...
Loading...
Loading...
Loading...
Loading...
Loading...
Loading...

Full Transcript

ESERCITAZIONE CLONAGGIO IN UN VETTORE DI ESPRESSIONE Proggettare nel modo + adeguato. con a disposizi...

ESERCITAZIONE CLONAGGIO IN UN VETTORE DI ESPRESSIONE Proggettare nel modo + adeguato. con a disposizione il vettore all' ultima pagina Clonare il frammento che corrisponde alla regione codificante della sequenza ADRA2A. Fare esprimere solo la sequenza con la proteina e il TAG di Hys. 1) Disegnare la strategia mediante PCR per clonare il frammento di cDNA contenente l’intera regione codificante questa proteina. Definire i primers da utilizzare con estremità che inseriscano nuovi siti di restrizione e la temperatura d’annealing per la reazione di PCR. Inserirlo nel vettore pTriEx-1.1 utilizzando siti di restrizione appropriati che permettano di ottenere una proteina in frame con la tag di istidine (His.tag). Rivediamo DISEGNARE PRIMER ÉTÉ cDNA NCOI FÈ "" fine trascrizione poi lavorare. appaiano→ si ritrovano fine PCR =Da iniziano a RESTRIZIONE, che inizialmente si a non. ENZIMI DI Posso aggiungere un 5 siti × Si formano delle Sticky ENDS mettere un sito di restrizione filamento inferiore. posso Anche nel Restriction map of adrenergic, alpha-2A-, receptor (ADRA2A).xdna - 3889 nt [using RELibrary -- VERA SEQUENZA di Questo recettore × i neuroni 3889 nt DATABASE PUBBLICO -- ! Restriction map of adrenergic, alpha-2A-, receptor (ADRA2A).xdna! Showing restriction enzymes cutting maximum 3 times [using RELibrary as a Restriction Enzyme Library]! ###! ! >BsgI! |! ' 5 cagcagcagctccagctcggtgcagaagcccagcagccggcgtgccgccgcccggccactccagcgccttcttccccgccttgcgctcctgccccaactc 31 < 100! TRE Q Q Q L Q L G A E A Q Q P A C R R P A T P A P S S P P C A P A P T R! CORNICI di LETTURA S S S S S S V Q K P S S R R A A A R P L Q R L L P R L A L L P Q L ! A A A P A R C R S P A A G V P P P G H S S A F F P A L R S C P N S ! 3 gtcgtcgtcgaggtcgagccacgtcttcgggtcgtcggccgcacggcggcgggccggtgaggtcgcggaagaaggggcggaacgcgaggacggggttgag! ' ' 5 10 20 30 40 50 60 70 80 90 ! ! EciI PfoI! | | | |! gcgctgtcgtcggaccccggcccatccagcagcgctcggcgcccaccaggcggacgcccaggagaacccctgcctccgtcgcggctcctggagagctgat < 200! A V V G P R P I Q Q R S A P T R R T P R R T P A S V A A P G E L I ! A L S S D P G P S S S A R R P P G G R P G E P L P P S R L L E S * S! R C R R T P A H P A A L G A H Q A D A Q E N P C L R R G S W R A D ! cgcgacagcagcctggggccgggtaggtcgtcgcgagccgcgggtggtccgcctgcgggtcctcttggggacggaggcagcgccgaggacctctcgacta! 110 120 130 140 150 160 170 180 190 ! ! DraIII! >BspMI ApaBI! >AarI Bsu36I >RleAI PfoI BstAPI! || | | | ||! cgttcacctgccccggcccgcctgaggacgggggtgccttcatgcggcccccacactcctcaccccgccgccgccgccgtcccggagctccgcacagtgt < 300! V H L P R P A * G R G C L H A A P T L L T P P P P P S R S S A Q C ! F T C P G P P E D G G A F M R P P H S S P R R R R R P G A P H S V ! R S P A P A R L R T G V P S C G P H T P H P A A A A V P E L R T V C! gcaagtggacggggccgggcggactcctgcccccacggaagtacgccgggggtgtgaggagtggggcggcggcggcggcagggcctcgaggcgtgtcaca! 210 220 230 240 250 260 270 280 290 ! ! ! ! gccccagccccagcagggcgcacaactttggaagtctcgcggcgctccgagaggcggcagagtccgcgccccagccccgggccgggccgggccagaaccg < 400! A P A P A G R T T L E V S R R S E R R Q S P R P S P G P G R A R T A! P Q P Q Q G A Q L W K S R G A P R G G R V R A P A P G R A G P E P ! P S P S R A H N F G S L A A L R E A A E S A P Q P R A G P G Q N R ! cggggtcggggtcgtcccgcgtgttgaaaccttcagagcgccgcgaggctctccgccgtctcaggcgcggggtcggggcccggcccggcccggtcttggc! 310 320 330 340 350 360 370 380 390 ! ! AlwNI PpuMI! | |! cagcgtctgggggaagccagagagtcggtaatcgcttcggggatgtaaggcgacagacataggacccccgagctcgcatcagcacccttcggctgcctcc < 500! A S G G S Q R V G N R F G D V R R Q T * D P R A R I S T L R L P P ! Q R L G E A R E S V I A S G M * G D R H R T P E L A S A P F G C L P! S V W G K P E S R * S L R G C K A T D I G P P S S H Q H P S A A S ! gtcgcagacccccttcggtctctcagccattagcgaagcccctacattccgctgtctgtatcctgggggctcgagcgtagtcgtgggaagccgacggagg! 410 420 430 440 450 460 470 480 490 ! ! SmlI!

Use Quizgecko on...
Browser
Browser