ANSC20010 Genetics and Biotechnology Section 5 Spring Trimester 2023-24 PDF

ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 ANSC20010 Section 5: Evolution and Population Genetics Campbell Biology 11th Edition chapters 22 and 23 (24 and 25 also) African swallowtail butterflies (Papilio dardanus). Females from the same population with different color...

ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 ANSC20010 Section 5: Evolution and Population Genetics Campbell Biology 11th Edition chapters 22 and 23 (24 and 25 also) African swallowtail butterflies (Papilio dardanus). Females from the same population with different coloration patterns representing genetic variations in the population. 1 “Nothing in Biology Makes Sense Except in the Light of Evolution” Theodosius Dobzhansky, (1973) The American Biology Teacher, 35 (3): 125–129. 2 “Nothing in Evolution Makes Sense Except in the Light of Population Genetics” Michael Lynch, (2007) Proc Natl Acad Sci U S A, 104 Suppl 1: 8597-604. 3 1 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Population and Evolutionary Genetics Population and Evolutionary Genetics: the study of the genetic composition of populations and how this changes over time (i.e., evolves). Evolution – the change in the inherited characteristics (traits) of groups of organisms (populations) over the course of generations (time). These changes reflect changes in the genetic composition (i.e., allele and genotype frequencies) of a population over time. Changes in allele (and genotype) frequencies represent evolution on the smallest scale (microevolution). Note: individual organisms do not evolve, populations of organisms evolve over time. 4 Populations and species: definitions Population: a localised group of individuals belonging to the same species that exhibit reproductive continuity from generation to generation. Species: a group of populations whose members can interbreed and produce fertile offspring (but cannot produce viable offspring with members of another species). ‘Geep’ (male goat × female sheep) ‘Zorse’ (male zebra × female horse) ‘Liger’ (male lion × female tiger) 5 Creationism versus Evolution James Ussher (1581-1656) and Charles Darwin (1809-1882) 6 2 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Charles Darwin – author of On The Origin of Species by Means of Natural Selection (and Alfred Russel Wallace) Charles Darwin (1854) Alfred Russel Wallace (1895) 7 Darwin and Wallace: explorations that led to the Theory of Evolution http://wallacefund.info/wallace-darwin-voyages-evolution 8 Darwin and ‘The Origin of Species’ Central Idea 1: Descent with Modification Organisms are adapted to their environments, BUT despite this organisms share biological characteristics. ‘Unity of life’ results from all species being descended from a distant common ancestor. Species diversity has been modified from ancestral forms and shaped over geological time. Closely related species share biological characteristics and distantly related species are biologically less similar. 9 3 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Darwin and ‘The Origin of Species’ Central Idea 2: Natural Selection Natural selection – the mechanism that drives evolution. Individual organisms within a population exhibit differences in their inherited traits. Differences in inherited traits determine the ability of individual organisms to survive and reproduce in different environments. Those with advantageous traits survive and reproduce more successfully (fitter individuals). Fitter individuals will transmit advantageous traits to offspring. Gradually, over time, the number of individuals with advantageous traits increases in the population and the population becomes more adapted to the environment. 10 A single species consisting of a single large population 11 Time point 1: Mountain range forms. Large populationssplits into two smaller populations. 12 4 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Time point 2: Populations become isolated. Environments on either side of mountain range differ. 13 Time point 3 onwards: The two smaller populations gradually diverge from each other as they adapt to new environments. Biological differences accumulate. Eventually become different species. 14 Darwin and ‘The Origin of Species’ Central Idea 1: Descent with Modification Past Ancestral Species Time Present Species 1 Species 2 15 5 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Darwin’s view of life on Earth The Darwinian view of life on earth―the ‘Tree of Life’ Base of the tree is the earliest form of life; tips of branches are extant species. The branches represent lines of ancestry and descent between the major groups. Individual branch forks represent ancestral species common to all organismal groups that descend from the branch. 16 Tree of Life based on molecular information Doolittle W.F. (2000) Uprooting the tree of life. Sci. Am. 282, 90-5. 17 Various ‘tree of life’ web projects and visualisations 1) Tree of Life Web Project http://tolweb.org/tree/phylogeny.html 2) OneZoom Tree of Life Explorer www.onezoom.org/index.htm 3) Open Tree of Life https://tree.opentreeoflife.org 18 6 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Evidence from anatomical features: the mammalian forelimb similar skeletal elements but different functions 19 Evidence from the existence of “intermediate” species Evolution predicts that as new species evolve from old species, there must have been “intermediate” forms. Evidence from the fossil record supports this.  Skeletal features indicate that birds evolved from ancient reptiles (~140 MYA) – intermediate forms existed.  The palaeontological record of human evolution in Africa and Eurasia has been intensively studied during the last 100 years. A chronological sequence of hominid ancestral forms stretches back approximately 5 million years. 20 Archaeopteryx litographica (an ancient reptile with early avian characteristics) 21 7 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 An excellent fossil record has facilitated detailed study of horse evolution 22 A timeline of some hominid species Myr Homo erectus 0.0 Australopithecus (Paranthropus) robustus 0.5 1.0 Homo sapiens Homo neanderthalensis sapiens Homo habilis Australopithecus (Paranthropus) boisei 1.5 Homo sapiens Australopithecus africanus 2.0 2.5 Australopithecus afarensis 3.0 3.5 4.0 Ardipithecus ramidus 4.5 23 Reconstruction of evolutionary history using molecular data Very strong evidence comes from genetic data.  Comparisons using DNA sequences from different organisms reflect evolutionary relationships.  Can be used to reconstruct evolutionary history: phylogenies. AGTTACCGATCTATAACCAG --C----------------- ----G--A---C-----T--TG-G--A--C--TC-G-GA Time 24 8 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 ‘The Origin of Species’ Central Idea 2: Natural selection the mechanism by which species evolve How does natural selection take place? 1. The frequency of favourable traits will increase in the population over time (i.e., the population evolves). 2. Difference in an individual organism’s ability to survive and reproduce is the basis for natural selection. 3. Natural selection accounts for how populations gradually accumulate adaptive differences to their environment. 4. Darwin used examples from animal and plant breeding to support his arguments: human-mediated artificial selection is comparable to natural selection. 25 Artificial selection in the dog (Canis familiaris) [domesticated wolf – Canis lupus] 26 Artificial selection in the rock pigeon (Columba livia) – novelty traits 27 9 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Directed artificial selection in broiler chickens (Gallus gallus domesticus) Zuidhof et al. (2014) Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 2005. Poult. Sci. 93, 2970-82. Hill W.G. & Kirkpatrick M. (2010) What animal breeding has taught us about evolution. Annu Rev Ecol Evol Syst 41, 1-19. 28 The Galápagos Islands – Darwin’s natural laboratory of evolution: natural selection and genetic drift 29 Evolution of Darwin’s finches and their beaks revealed by genome sequencing (February 2015) Lamichhaney et al. (2015) Evolution of Darwin's finches and their beaks revealed by genome sequencing. Nature 518, 371-5. 30 10 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Galapagos Finch Evolution — HHMI BioInteractive Video https://youtu.be/mcM23M-CCog 31 Percentage of total number of moths Natural selection in action: the peppered moth (Biston betularia) in Britain during the Industrial Revolution 100 80 60 Common Black 40 20 0 1840 1860 1880 1900 Year 32 Evolutionary processes act upon genetic variation 1) Phenotype is determined by genotype (combination of alleles at a locus) and environmental factors. 2) Phenotypic differences between individuals are due to genetic differences and environmental factors. 3) Only the genetic component (genotype) of phenotype is transmitted to offspring and has evolutionary consequences. 4) Alleles and genotypes are the basis for hereditary differences between individuals. 5) Evolutionary processes (e.g., natural selection) act upon alleles and genotypes. 33 11 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Evolutionary processes act upon genetic variation 6) The frequencies of alleles and genotypes within a population can fluctuate from generation to generation.  this is evolution at the smallest scale (microevolution). 7) Fluctuations in allele and genotype frequencies occur by a five main evolutionary processes: 1. Mutation. 2. Natural selection. 3. Genetic drift. 4. Gene flow. 5. Selective mating (non-random mating). 34 The birth of Population Genetics Sewall Wright Ronald A. Fisher J.B.S. Haldane Population genetics was an important turning point for evolutionary biology. Mendelism and Darwinism were integrated giving rise to the NeoDarwinian synthesis. 35 What is population genetics? Examination of heritable (genetic) variation within populations. Study of how patterns of genetic variation (genetic structure) differ between populations. Investigation of how genetic structure within and between populations changes over time. Provides testable hypotheses for the mechanisms of evolution and speciation. Population genetics is the scientific foundation of modern scientific animal and plant breeding. 36 12 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Genetic structure of a population is defined by its allele and genotype frequencies Gene pool: all alleles at all gene loci in all individuals of the population. Allele frequency: the proportion of a particular allele at a given locus in the gene pool. Genotype frequency: the proportion of a particular genotype (combination of alleles) at a given locus in the gene pool. N.B. for diploid species: each locus is represented twice in each individual organism (two alleles at each gene locus). 37 Calculating allele and genotype frequencies (1) Example: wildflower population consisting of 500 individual plants. Gene locus: Flower colour gene with two alleles – pink flower allele (A) and white flower allele (a). Pink flower allele dominant to white flower allele. 38 Calculating allele and genotype frequencies (2) Population of 500 plants (each flower indicates a plant) 15 5 13 1 6 16 7 2 17 11 8 3 9 18 14 19 10 20 4 12 N.B., assume we have a molecular method for detecting heterozygotes 39 13 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Calculating allele and genotype frequencies (3) Genotype frequencies determine allele frequencies Phenotypes: Genotypes: AA Aa aa Number of plants: 320 160 20 320/500 = 0.64 160/500 = 0.32 20/500 = 0.04 Genotype frequencies: X2 640 A Allele frequencies: X2 160 A 160 a 800/1000 = 0.8 A 40 a 200/1000 = 0.2 a 40 Calculating allele and genotype frequencies (4) 2nd generation: with random mating (fertilisation of gametes) A Pollen A AA p2 = 0.64 a Ova a aA qp = 0.16 Aa pq = 0.16 aa q2 = 0.04 Allele frequencies: p + q = 1 Genotype frequencies: p2 + 2pq + q2 = 1 N.B. with random mating, the genotype frequencies are determined by the allele frequencies 41 The genetic structure of a non-evolving population: The Hardy-Weinberg theorem Genetic structure: frequency of alleles and genotypes. The genetic structure of a population can change over time – population is evolving. The genetic structure of a non-evolving population: described by the Hardy-Weinberg Principle (also known as Theorem, Equilibrium). Proposed in 1908 by Godfrey H. Hardy and Wilhelm Weinberg. Godfrey H. Hardy Wilhelm Weinberg 42 14 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 The Hardy-Weinberg theorem Hardy-Weinberg theorem: the frequencies of alleles and genotypes in a population remain constant over the generations unless acted upon by evolutionary forces. A population with allele and genotype frequencies that conform to the Hardy-Weinberg Theorem are said to be in HardyWeinberg Equilibrium (HWE). If a population is in HWE, we can use allele frequencies to predict genotype frequencies from one generation to the next. 43 The Hardy-Weinberg theorem General principle applies to three or more alleles and other dominance relationships. Theorem in general terms (simplest case): one gene with two alleles (A and a). (1) Allele frequencies: p (freq of A allele) + q (freq of a allele) = 1 (NB: if p + q = 1, then p = 1 - q and q = 1 – p) (2) Genotype frequencies: Frequency of AA genotype: p2 (probability - use multiplication rule) Frequency of aa genotype: q2 Frequency of Aa genotype: add Aa (p × q) and aA (q × p) = 2pq p2 + 2pq + q2 = 1 44 The Hardy-Weinberg theorem and predicting incidence of inherited disease and carrier status: cystic fibrosis (CF) Cystic fibrosis has an autosomal recessive pattern of inheritance Cystic fibrosis is caused by a mutation in the cystic fibrosis transmembrane conductance regulator gene (CFTR) on human chromosome 7 (HSA7). 45 15 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 The Hardy-Weinberg theorem and predicting incidence of inherited disease and carrier status: cystic fibrosis (CF) One in 1,600 people of Irish ethnicity are affected by this autosomal recessive genetic disorder. Single gene with two alleles: 1) normal CFTR allele, 2) mutated CFTR allele. Assume that the Irish population is in HWE at this genetic locus. Let p = frequency of the normal CF allele. Let q = frequency of the mutated CF allele. 1. Estimate the frequency of the mutated CFTR allele. 2. Estimate the frequency of normal homozygous individuals. 3. Estimate the frequency of heterozygous carriers in the Irish population. 46 The Hardy-Weinberg theorem: microevolution For a gene locus with two alleles, the summation over all genotypes is: p2 + 2pq + q2 = 1 (the Hardy-Weinberg Theorem) In a population of organisms IF……frequency of AA homozygotes ≠ p2 AND/OR IF……frequency of Aa heterozygotes ≠ 2pq AND/OR IF……frequency of aa homozygotes ≠ q2 Then population is not in Hardy-Weinberg Equilibrium (HWE) at this locus. Consequently, the genetic structure of the population is changing over time (i.e., microevolution is occurring). 48 Deviations from Hardy-Weinberg Equilibrium (HWE) indicate that microevolution is occurring Hardy-Weinberg Equilibrium indicates that a population is not evolving at a particular genetic locus; any locus that deviates from HWE is considered to be evolving in a population. Definition of evolution from a population genetics perspective: Evolution is a generation-to-generation change in a population’s allele or genotype frequencies over time (i.e., a change in the genetic structure). Changes in the allele and genotype frequencies over time represents evolution on the smallest scale: microevolution. 49 16 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Five causes of microevolution at a genetic locus 1. Genetic drift 2. Gene flow Non-adaptive 3. Mutation 4. Non-random mating 5. Natural selection Adaptive All of these processes cause allele and genotype frequencies to change over time. Each process can cause deviations from HWE at a genetic locus. 50 1) Genetic drift: random fluctuation of allele frequencies over time N.B. Not all alleles in one generation will be transmitted to the next generation:  Differences in the number of offspring produced by individual organisms in the parental generation.  Gametes that unite to form individual organisms in the next generation are essentially selected at random. The gametes that unite to form individual organisms in the next generation will carry a sample of the alleles present in the parental gene pool. Genetic drift has most significant effects in small populations (large populations are buffered against genetic drift). Small island populations – prone to genetic drift. 51 The Galápagos Islands – Darwin’s natural laboratory of evolution: natural selection and genetic drift 52 17 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Artificial selection in the dog (domestic wolf): [and genetic drift] 53 Natural and artificial selection (and genetic drift) in global cattle populations (Bos taurus, Bos indicus and Bos taurus/indicus hybrids) 54 Biogeographical and breed genetic diversity in European livestock (natural and artificial selection [and genetic drift]) 55 18 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 1) Genetic drift: random fluctuation of allele frequencies over time 56 1) Genetic drift: random fluctuation of allele frequencies over time https://bit.ly/3fek5kB 57 Genetic drift simulated in a population of 5,000 organisms for six genetic loci (two alleles each) 58 19 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Extreme examples of genetic drift: The Bottleneck Effect Alleles in original population Surviving population Bottleneck event 59 The Bottleneck Effect: the Northern Elephant Seal Northern Elephant Seal (Mirounga angustirostrus) - West coast of North America. Northern Elephant Seal almost became extinct during 19th century – 20 individuals left. Population has since recovered to ~ 150,000. A study examined variation at 24 genes: no variation, fixed for one allele at each gene. Southern Elephant Seal: plenty of genetic variation, was never bottlenecked. 60 The Bottleneck Effect: Genetic variation in the Cheetah Cheetah (Acinoyx jubatus) originally had wide range across Africa and Asia. 1st bottleneck 10-12,000 years ago (climate change reduced habitat). 2nd bottleneck (last 150 years): hunted almost to extinction. Studies have shown that cheetahs lack of diversity at the major histocompatibility complex (MHC) genetic locus (immune genes). Susceptible to disease outbreaks. 61 20 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Extreme examples of Genetic Drift: The Founder Effect Extreme genetic drift is likely to occur when a few individual organisms colonise a new habitat (e.g., an island, lake, mountain etc.). The genetic makeup of the colonists will be unlikely to represent the gene pool of the larger population they left. Genetic drift in a new colony is called a Founder Effect. 62 The Founder Effect in Human populations Retinitis Pigmentosa (RP) on the island of Tristan da Cunha. A homozygous recessive degeneration of eyesight due to mutations in the rhodopsin gene (RHO) on HSA3. In 1814 Tristan da Cunha was populated by 15 individuals of British origin (one person affected with RP). Tristan da Cunha in the 1960s : 4/240 affected (q2 = 0.017; q = 0.13). In Britain: 1/4,000 people affected (q2 = 0.0025; q = 0.016). The frequency of the RP allele (q) is higher in the colony than in the population where founders originated (i.e., RP allele has higher frequency in Tristan da Cunha than in Britain). 63 Retinitis Pigmentosa: mutation in the rhodopsin gene Normal vision Vision of person suffering with RP 64 21 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Founder effect, subsequent genetic drift and inbreeding in a British wild cattle population Visscher et al. (2001) A viable herd of genetically uniform cattle. Nature 409, 303. 65 2) Gene flow: the exchange of alleles between populations Hardy-Weinberg Equilibrium (HWE) requires a gene pool to be a closed system (unusual). Population can gain or lose alleles by gene flow. Gene flow: the genetic exchange of alleles between populations (as a result of migration of individuals or gametes). 66 2) Gene flow between populations: Wildflower plant example Population 1 Pollen grains scattered a a aa a a a aa a aa Fixed for the white flower (a) allele Frequency of a allele = q = 1.0 Frequency of A allele = p = 0.0 67 22 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 2) Gene flow between populations: Wildflower plant example Population 2 Fixed for the pink allele (A) : p = 1.0; q = 0.0 a AA AA a a AA AA a a AA a AA AA AA Pollen blown in during a storm from population 1 AA AA 68 2) Gene flow between populations: Wildflower plant example Next generation of population 2 after gene flow: Frequency of pink allele (A) = p = 0.7 Frequency of white allele (a) = q = 0.3 AA Aa Aa Aa AA Aa AA Aa Aa AA 69 The effects of gene flow on population genetic structure Gene flow can reduce differences in the genetic structure of separate populations that have accumulated due to drift or selection. Gene flow can eventually amalgamate neighbouring populations into one large population with a common genetic structure. 70 23 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Paleogenomics and prehistorical gene flow from archaic humans into the ancestors of modern human populations Vindija Cave, Croatia 71 Paleogenomics and prehistorical gene flow from archaic humans into the ancestors of modern human populations www.23andme.com 72 Gene flow from wild aurochs (Bos primigenius) into British and Irish Bos taurus cattle populations Kerry cattle Highland cattle Park S.D., et al. (2015) Genome sequencing of the extinct Eurasian wild aurochs, Bos primigenius, illuminates the phylogeography and evolution of cattle. Genome Biol. 16, 234. 73 24 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Gene flow from wild aurochs (Bos primigenius) into British and Irish Bos taurus cattle populations http://blogs.biomedcentral.com/on-biology/2015/10/27/gruelling-hunt-aurochs-genome 74 3) Mutation Mutation refers to changes in an organism’s DNA. Mutation is the ultimate source of all genetic variation. Mutations are spontaneous, random and rare. Rate of one mutation per 105 - 106 gametes is typical. Only mutations in germ-line cells (i.e. the cells that give rise to gametes) are transmitted to future generations and have an evolutionary consequence. Somatic mutations are not transmitted to future generations. Mutations generate new alleles and allelic variation is the raw material for the processes of microevolution. 75 3) Mutation: small-scale genetic mutations - a point mutation T 76 25 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 3) Mutation: alters the genetic structure of a population by creating new alleles For example: mutation that causes the white-flowered plant (aa) to produce gametes bearing pink allele (A) will decrease the frequency of the a allele and increase the frequency of the A allele. Mutation is the original source of genetic variation: raw material for evolution. 77 3) Mutation: alters the genetic structure of a population by creating new alleles Generation 1: Fixed for the white allele (a allele) No pink allele (A allele) q = 1.0 p = 0.0 aa aa aa aa aa aa aa aa aa aa 78 3) Mutation: alters the genetic structure of a population by creating new alleles Generation 2: White allele (a allele) frequency Pink allele (A allele) frequency q = 0.95 p = 0.05 aa aa aa aa aa Aa aa aa aa aa 79 26 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 4) Natural selection: wildflower plant population Flower colour controlled by a single gene with two alleles:  pink allele (dominant, A allele) (AA, Aa = pink flower phenotype)  white allele (recessive, a allele) (aa = white flowers) Pink flowers are more visible to pollen-collecting bees: pink flowers more advantageous in this environment (better adapted). Pink flowered plants (‘fitter’) than white flowered plants. Pink flowered plant frequency will increase (phenotypic level). Genetic level: frequency of the A allele will increase and the frequency of the a allele will decrease. HWE is perturbed and the population is evolving: microevolution via natural selection and adaptation to environment. 80 4) Natural selection: wildflower plant population Generation 1: Fixed for the white allele (a allele) No pink allele (A allele) q = 1.0 p = 0.0 aa aa aa aa aa aa aa aa aa aa 81 4) Natural selection: wildflower plant population Generation 2 : Frequency of the white allele (a allele): Frequency of the pink allele (A allele): q = 0.95 p = 0.05 (mutation) aa aa aa aa aa aa aa aa Aa aa 82 27 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 4) Natural selection: wildflower plant population Generation 3 : Frequency of the white allele (a allele): Frequency of the pink allele (A allele): aa Aa q = 0.85 p = 0.15 aa aa aa aa aa Aa aa Aa 83 4) Natural selection: wildflower plant population Generation 4 : Frequency of the white allele (a allele): Frequency of the pink allele (A allele): q = 0.70 p = 0.30 Aa Aa aa Aa aa aa aa AA Aa aa 84 4) Natural selection: the effect of positive and negative selection on allele frequencies A allele advantageous over a allele (A allele is fitter than a allele). A allele frequency will increase relative to a allele. A allele will become fixed (p = 1.0). 85 28 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 4) Natural selection: positive selection in human populations - the Duffy blood group Duffy gene – encodes protein on surface of red blood cells. Two alleles of the Duffy gene – Fy0 and Fya Fy0 allele - confers resistance to malarial parasite (Plasmodium vivax). Fya allele – susceptibility to malaria. Plasmodium vivax Anopholes albimanus (Mosquito) 86 Fy0 Duffy gene allele has a very high frequency (~1.0) in African populations where malaria disease persists https://malariaatlas.org/research-project/blood-disorders 87 Plasmodium falciparum parasite rate in small children (2-10 years-old) globally (2017) https://malariaatlas.org/explorer 88 29 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 Diploidy and balancing selection preserve genetic variation What prevents natural selection from eradicating genetic variation in a population? Tendency of natural selection to eliminate variation is countered by two major mechanisms: diploidy and balancing selection. Diploidy: having two copies of the haploid genome. Diploidy: ‘hides’ genetic variation from natural selection in the form of alternate alleles present in heterozygotes. Alleles that that are less favourable (or even harmful) can persist in a population through propagation via heterozygous genotypes. 89 Diploidy preserves variation For example: gene for which there are two alleles: A and a A (dominant, more favourable) a (recessive, less favourable) Phenotypes: × Genotypes: Aa Aa F1 generation Phenotypes: Genotypes: AA Aa aa 90 Balancing selection preserves variation Selection can preserve variation : balancing selection. Heterozygote advantage: the heterozygous genotype is fitter than either homozygote. For example: balancing selection in human populations distribution of sickle-cell anaemia allele and malaria in Africa. 91 30 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 An example of a missense mutation: the sickle cell anaemia mutation in humans β-globin gene DNA Normal β-globin gene DNA sequence Mutated β-globin gene DNA sequence TGA GGA CTC CTC TGA GGA CAC CTC ACT CCT GAG GAG ACT CCT GTG GAG Transcription and translation Protein thr pro glu glu thr chain Normal Sickle-shaped red blood cells red blood cells pro val glu 92 Distribution of sickle-cell anaemia allele (HbS) and global malaria endemicity Piel et al. (2010) Global distribution of the sickle cell gene and geographical confirmation of the malaria hypothesis. Nat. Comm. 1, 104. 93 5) Non-random mating For HWE to be maintained: must have random mating. However, in natural populations mating between related organisms (inbreeding) can occur. In agricultural populations intentional matings between individuals that share similar phenotypes occur (selective breeding). Most extreme example: self-fertilisation (selfing). Inbreeding causes genotype frequencies to deviate from HWE. The number of heterozygotes is reduced over time due to inbreeding (number of homozygotes increases). 94 31 ANSC20010 Genetics and Biotechnology: Section 5 Spring Trimester, 2023-24 5) Non-random mating: self fertilisation in 24 plants Generation 1: Aa Aa aa aa Aa AA Aa p (frequency of pink allele - A) = q (frequency of white allele - a) = AA Aa Aa AA aa Aa aa Aa Aa 0.5 0.5 AA AA Aa aa aa AA Aa Aa p2 = 0.502 = 0.25 = 6 AA individuals q2 = 0.502 = 0.25 = 6 aa individuals 2pq = 2 × 0.50 × 0.50 = 0.50 = 12 Aa individuals 95 5) Non-random mating: self fertilisation in 24 plants Generation 2: aa 0.5 0.5 Aa aa aa AA AA Aa p (frequency of A) = q (frequency of a) = Aa aa aa AA Aa AA AA AA aa AA Aa AA Aa AA aa aa aa p2 = 0.502 = 0.25 = 6 AA (expected) 9 observed q2 9 observed = 0.502 = 0.25 = 6 aa (expected) Not in HWE 2pq = 2 × 0.50 × 0.50 = 0.50 = 12 Aa (expected) 6 observed 96 Summary: the five conditions required for HWE 1) Very large population size: in small population, genetic drift can alter the frequencies of alleles 2) Isolation: gene flow, the transfer of alleles between populations (individuals or gametes), can change gene pools. 3) No mutations: mutations can alter the gene pool. 4) No natural selection: differential survival/reproductive success alters gene pool (ensures that particular alleles transmitted to next generation). 5) Random mating: if individuals select mates with certain heritable traits (non-random mixing of gametes). 97 32