Agricultural Biotechnology Lecture Notes PDF

UNIVERSITY OF SOUTHERN MINDANAO Agri 06 AGRICULTURAL BIOTECHNOLOGY Plant Breeding and Genetics Division College of Agriculture  Lecture 3 TECHNIQUES IN MODERN BIOTECHNOLOGY  Useful techniques in modern biotechnology 1. Plant tissue culture...

UNIVERSITY OF SOUTHERN MINDANAO Agri 06 AGRICULTURAL BIOTECHNOLOGY Plant Breeding and Genetics Division College of Agriculture  Lecture 3 TECHNIQUES IN MODERN BIOTECHNOLOGY  Useful techniques in modern biotechnology 1. Plant tissue culture 7. Microarray technology 2. Somatic hybridization 8. DNA sequencing 3. Polymerase chain 9. Genetic engineering reaction 4. Gel electrophoresis 10. Animal cloning 5. Molecular markers 11. Bioinformatics 6. DNA Fingerprinting  1. Plant Tissue Culture Plant tissue culture is the sterile, in vitro cultivation of plant parts such as organs, embryos, and seeds, as well as single cells on either solidified or liquid nutrient medium. An explant is a cell, tissue or organ of a plant that is used to start tissue culture Totipotency - the capacity of a single cell to regenerate the phenotype of the complete and differentiated organism from which it is derived. The first true plant tissue culture  DEDIFFERENTIATION When grown on an special nutrient medium (Murashige and Skoog - MS medium) in the presence of a specific ratio of growth hormones, the non-dividing cells revert to an undifferentiated, meristematic state whereby they form callus tissue called dedifferentiation. PMagdalita, PhD  REDIFFERENTIATION Callus tissue has the ability to form a whole plant or plant organs in a process called redifferentiation. The ability of a plant cell to give rise to a whole plant through the process of dedifferentiation and redifferentiation is called totipotency, which is a unique ability of plants. PMagdalita, PhD  Plant tissue culture offers many practical benefits a. Mass propagation of desirable plants through in vitro cultivation b. Somatic embryogenesis (called artificial seeds) to yield thousands of identical plants like what was done in oil palm, also being done in coconut to rapidly produce new varieties of coconuts. PMagdalita, PhD  Plant tissue culture offers many practical benefits c. In vitro -selection for specific traits of interest like disease and herbicide resistance, e.g. Phytophthora root rot resistance in avocado, heart rot resistance in pineapple d. Virus elimination – since meristematic regions divide faster than virus multiplication, these regions were isolated. Shoot tips in vitro grafted to a seedling stock develop virus-free plants, e.g. Shoot tip grafting in pommelo to produce citrus tristeza virus-free plants. PMagdalita, PhD Plant tissue culture is a broad term used to define six types of in vitro cultures a. Callus culture – culture of differentiated tissue from an explant that dedifferentiates (A) (B) (C) Embryogenic calli (A) develop into leaf shoots (B) and later into plants with complete shoot and roots (C )in the presence of BAP and NAA. PMagdalita, PhD  Plant tissue culture is a broad term used to define six types of in vitro cultures b. Cell culture – culture of cells or cell aggregates in liquid medium c. Protoplast culture – culture of plant cells devoid of cell walls d. Embryo culture – culture of isolated embryos from plants whose embryos need to be saved like important plant species and genotypes like the “makapuno” coconut PMagdalita, PhD  Plant tissue culture is a broad term used to define six types of in vitro cultures Embryo rescue of ‘makapuno’ coconut embryos showing abortive embryos (A), emerging embryos (B), germinated embryos w/ roots & shoots (C ), and plantlets (D). PMagdalita, PhD  Plant tissue culture is a broad term used to define six types of in vitro cultures e) Seed culture – culture of seeds to generate plants ‘Smooth Cayenne’ x ‘Queen’ F1 seeds Germinated orchid seeds PMagdalita, PhD  Plant tissue culture is a broad term used to define six types of in vitro cultures f. Organ culture - culture of isolated plant organs such as anthers, roots, stems, buds, and shoots A B C Stem culture (A) with actively growing nodal shoots (B) and regenerated into whole plants (C). PMagdalita, PhD  2. Somatic hybridization Technique which allows the manipulation of cellular genomes by protoplast fusion.  Why the need for somatic hybridization? Crossing barriers among plant species and in organelle genetics and breeding Species barriers encountered in sexual hybridization Transfer of genes from wild species into the genome of crop plants Tool for the modification and improvement of polygenic traits The technique of somatic hybridization a b c d  The technique of somatic hybridization a. Protoplast fusion is the fusing together of non- reproductive somatic cells - A protoplast is a “naked” cell The procedure of protoplast fusion Methods of Fusion a. Polyethylene glycol (PEG) b. Electrofusion  The technique of somatic hybridization a. Selection of Hybrids Much time and effort is required Based on visual identification Differentially stained protoplasts b. Identification Of Hybrids By observing morphology By using PCR c. Regeneration of Hybrid Plants Fulfilment of all the conditions and requirements for organogenesis Somatic hybridization in the Brassicaceae family Somatic hybridization in the Fabaceae family Flowering hybrid of Medicago sp. Somatic hybridization in the Poaceae family  Somatic hybridization in the citrus family Allotetraploid hybrids for seedless triploid Citrus breeding  3. Polymerase Chain Reaction (PCR) Developed in 1983 by Kary Mullis A very quick, easy, automated method used to make copies of a specific segment of DNA A DNA polymerase is used to amplify (i.e., replicate) a piece of DNA by in vitro enzymatic replication. As PCR progresses, the DNA generated is itself used as template for replication Carried out using a thermal cycler or PCR machine  PCR has many applications DNA cloning for sequencing DNA-based phylogeny Functional analysis of genes Diagnosis of hereditary diseases DNA fingerprinting Detection and diagnosis of infectious diseases  The PCR mix has several components a. Template DNA - DNA that will be amplified or copied b. Taq DNA Polymerase - DNA polymerase extends the primers to synthesize a copy of the template DNA - Thermostable polymerase allow automation and repeated rounds of DNA without denaturation c. 2 primers that flank the fragment of DNA to be amplified - Anneal to template to allow DNA replication  The PCR mix has several components d. Deoxynucleotide triphosphates (dNTPs) - dNTPs are incorporated into synthesized DNA e. Buffer (containing Mg++) - buffered pH, & Mg2+ to allow enzyme activity of DNA polymerase  PCR 30x 100 Melting Melting oC oC Temperature 94 94 Extension Annealing 72 oC Primers 50 50 oC 0 T i m e 3’ 5’ 3’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 3’ 5’ 3’  DNA Between The Primers Doubles With Each Thermal Cycle Number 1 2 4 8 16 32 64 0 1 2 3 4 5 6 Cycles More cycles of PCR produces more copies of DNA Size Number of cycles Marker 0 10 15 20 25 30  The theoretical yield Of PCR Theoretical yield = 2n x y Where: y = the starting number of copies and n = the number of thermal cycles If you start with 100 copies, how many copies are made in 30 cycles? 2n x y = 230 x 100 = 1,073,741,824 x 100 = 107,374,182,400  4. Gel electrophoresis A technique used for the separation of macromolecules (DNA, RNA, or protein) using an electric current applied to a gel matrix. The migration of charged molecules in solution in response to an electric field It is performed in a gel composed of agarose, polyacrylamide or starch. Gel electrophoresis of macromolecules There are factors affecting the rate of migration of macromolecules in gel electrophoresis a. Size of the molecules b. Strength of the field c. Net charge d. Ionic strength e. Viscosity f. Temperature of the medium in which the molecules are moving Longer molecules migrate slower while shorter molecules migrate faster  5. Molecular markers DNA polymorphisms are the different DNA sequences among individuals. DNA polymorphism serves as a molecular marker for its own location in the chromosome. Molecular markers allow us to track the inheritance of different regions of the genome.  Since DNA is the same in every cell, the molecular markers can be identified by a DNA test regardless of the developmental stage, age, or environmental challenges experienced by the organism. Can be useful tools to facilitate breeding programs (in Marker Assisted Selection - MAS) or to aid in characterization of collections of germplasm (or varieties)  There are different kinds of molecular markers systems: a. Restriction fragment length polymorphism (RFLP) b. Random amplified polymorphic DNA (RAPD) c. Amplified fragment length polymorphism (AFLP) d. Microsatellite markers e. Single nucleotide polymorphism (SNP)  5a. Restriction fragment length polymorphism (RFLP) First molecular marker to be widely used Time-consuming and expensive; simpler marker systems have subsequently been developed Markers are detected by treating DNA with restriction enzymes (RE) resulting in restriction enzyme-digested DNAs and the differential hybridization of cloned DNA to the digested DNA fragments Specific to a single clone/restriction enzyme combination Restriction enzymes cut DNA at specific sequences DNA digestion  Restriction enzymes The first RE isolated was from E. coli K laboratory strains in 1968 by Maselson & Yuan. In 1970, Hamilton Smith & co-workers isolated a restriction enzyme from the bacterium Haemophilus influenzae strain Rd HindII recognizes a six-base-pair double-stranded DNA sequence of 5’-G-T- pyrimidine-purine-A-C-3’ and cleaves DNA on both strands in the center of the sequence This is the recognition site for HindII.  Restriction enzymes - Occur naturally in bacteria - Hundreds are purified and available commercially - Named for bacterial genus, species, strain, and type - Recognize specific base sequences in DNA - Cut DNA at those recognition sites Example: EcoRI Genus: Escherichia Species: coli Strain: R  How are restriction enzymes named? RE have names that reflect their origin - the first letter of the name comes from the genus - second and third letters from the species of bacteria from which they were isolated. the numbers following the nuclease name indicate the order in which the enzyme was isolated from the bacterial strain, and this number is written as a Roman numeral.  How are restriction enzymes named? The first RE to be isolated from the bacterium Providencia stuartii was named PstI The second to be isolated from Bacillus stearothermophilus strain ET was named BstEII.  Restriction Enzyme Recognition Site Enzymes recognize specific 4-8 bp sequences Eco RI 5’…GAATTC…3’ 3’…CTTAAG…5’ Recognition sites have symmetry Some enzymes cut in a staggered fashion Some enzymes cut in a direct fashion Pvu II 5’…CAGCTG…3’ 3’…GTCGAC…5’ Restriction Enzyme Digestion T T C C T G C A G A G A A G G A C G T C T C C T G C A G A G T T C C T C A A G G A C G T  The DNA of an organism producing a RE is not itself attacked by the RE According to Smith, HindII was unable to cleave Haemophilus influenzae genomic DNA, but it cleaved the bacteriophage T7 genome (39,937 bp in length) in over 40 sites, to give a highly specific fragmentation pattern. Haemophilus influenzae, like all other organisms that produce restriction enzymes, also produces enzymes (Hind II methylase) that modify its own DNA, so that it will not be cleaved by the RE. Using restriction fragment patterns to distinguish DNA from different alleles  5b. Random Amplified Polymorphic DNA PCR-based technique which uses arbitrary primers which bind to the nonspecific sites on the DNA and amplify the DNA It utilizes short PCR primers consisting of random sequences usually in the size range of 8 to 15 nucleotides in length  5c. Amplified Fragment Length Polymorphism (AFLP) Digestion of total cellular DNA with one or more restriction enzymes and ligation of restriction half- site specific adaptors to all restriction fragments. Selective amplification of some of these fragments with two PCR primers that have corresponding adaptor and restriction site specific sequences. Electrophoretic separation and amplicons on a gel matrix, followed by visualisation of the band pattern Outline of the AFLP procedure Outline of the AFLP procedure  5d. Microsatellites Microsatellites are short tandem repeats of DNA (1-10 bp) The location in the genome of interest must first be identified in order to be used as markers Polymorphisms in the repeat region can be detected by performing a PCR with primers designed from the DNA flanking region  Outline of the Microsatellite procedure DNA extraction PCR with primers specific for microsatellite flanking region Separation of fragments - By agarose gel electrophoresis using ethidium bromide staining and UV light - Acrylamide gels using silver staining or radioisotopes - Through automated sequencers, using primers pre- labelled with flourescence  5e. Single Nucleotide Polymorphism (SNP) A substitution of a single nucleotide that occurs at a specific position in the genome, where each variation is present at a level of more than 1% in the population Nucleotide polymorphism in an allele  Comparison of marker systems based on rice (Korzun, 2003) Feature RFLPs RAPDs AFLPs Microsats SNPs Amount of DNA required (μg) 10 0.02 0.5-1.0 0.05 0.05 Quality of DNA required high high moderate moderate high PCR-based no yes yes yes yes Number of polymorphic loci analyzed 1.0-3.0 1.5-50 20-100 1.0-3.0 1.0 per analysis Ease of use not easy easy easy easy easy Amenable to automation low moderate moderate high high Reproducibility high unreliable high high high Development cost low low moderate high high Cost per analysis high low moderate low low  Differences between marker systems Technical requirements The amount of time, money and labour needed The number of genetic markers that can be detected throughout the genome The amount of genetic variation found at each marker in a given population  6. DNA Fingerprinting A method used to identify a person from a sample of DNA by looking at unique patterns in their DNA Background On average, about 99.9 per cent of the DNA between two humans is the same Around three million base pairs that are different between two people Minisatellites are short sequences (10-60 base pairs long) of repetitive DNA that are the most highly variable sequence element in the human genome The variable number tandem repeat (VNTRs) is used for DNA fingerprinting analysis in forensic science.  Steps in DNA Fingerprinting 2. Restriction 1. Extraction enzymes 4. Transfer of 3. Gel electrophoresis DNA to nylon 5. Incubation with labelled probes. Probes - 6. X-ray fragments of minisatellite DNA  Variable number tandem repeat (VNTRs) Schematic diagram of a VNTR in 4 alleles Variable number tandem repeat (VNTRs) VNTR (D1S80) allele lengths in 6 individuals  DNA Profiling Modern-day DNA profiling is also called STR analysis and relies on microsatellites rather than the minisatellites used in DNA fingerprinting. Microsatellites, or short tandem repeats (STRs), are the shorter relatives of minisatellites usually two to five base pairs long.  Steps in DNA Profiling 1. Extraction 2. PCR with labelled primers 3. Electrophoresis 4. Visualization  Applications of DNA Fingerprinting 1. Forensic or criminal - DNA fingerprints can be use to link suspects to biological evidence-blood or semen stains, hair, or items of clothing-found at the scene of a crime. 2. Establish paternity in custody and child support litigation. 3. Personal identification - Because every organ or tissue of an individual contains the same DNA fingerprint, DNA fingerprints collected can be use later, in case they are needed to identify casualties or persons missing in action.  DNA fingerprints from a murder case Whose blood is on the defendant’s clothing? A given person's VNTRs come from the genetic information donated by his or her parents; he or she could have VNTRs inherited from his or her mother or father, or a combination, but never a VNTR either of his or her parents do not have.  7. Microarray technology Microarrays are arrangements of small spots of DNA fixed to glass slides or nylon membranes The technology allows monitoring of the whole genome at once The underlying principle of chips is base- pairing or hybridization between short probes and complementary DNA sequences Microarrays are constructed using cDNAs (cDNA arrays), genomic sequences or oligonucleotides synthesised in silico (‘DNA chips’) DNA microarray assay for gene expression DNA microarray assay for gene expression  Applications of Microarray Microarray Type Purpose Expression profiling To determine the changes in gene expression that occur in response to stressed vs normal states; compare gene expression level of cells over time SNP analysis To detect mutations or polymorphisms in a gene sequence that are responsible for genetic variation Comparative To identify genetic duplications or deletions or to genomic identify copy number changes in a particular gene hybridization (CGH) Resequencing arrays To sequence portions of the genome  8. DNA sequencing Method for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA Knowledge of DNA sequences of genes and other parts of the genome of organisms has become indispensable for basic research studying biological processes, as well as in applied fields such as diagnostic or forensic research. DNA sequencing methods 1. Maxam-Gilbert 2. Sanger (dideoxy sequencing or chain termination) Maxam-Gilbert sequencing 1. Obtain single stranded DNA 2. Add a 32P to 5’ end 3. Cleave at specific nucleotides 4. Differentially sized DNA strands 5. Electrophoresis through high resolution acrylamide gels 6. Deduce DNA sequence Sanger sequencing DNA sequencing: advantages and disadvantages Advantages: Results are highly reproducible Maximum amount of information content Disadvantages: Costs are still high Technically demanding  Applications of DNA sequencing Evolutionary studies Calculations of genetic variation Comparative genomics Creating PCR assays (making primers to convert any marker to a PCR-based marker)  9. Genetic Engineering The transfer of genetic information (DNA) from one organism to another The best known application of molecular genetics Genomes contain an enormous amount of DNA - Rice - 4.3 x 108 bp - Yeast - 1.4 x 107 bp - Fruit fly – 1.2 x 108 bp Each gene contained within a genome represents only a tiny fraction of the genome itself. Genetic engineering uses the techniques of gene cloning and transformation to alter the structure and characteristics of genes directly.  Steps in gene cloning 1.Generation of foreign DNA fragments, 2.Insertion of foreign DNA into a vector, 3.Transformation of the recombinant DNA into a host cell in which it can replicate, and 4.A method of screening or selecting clones to identify those that contain the particular recombinant. Steps 1-2 are involved in the formation of DNA libraries. A DNA library is a collection of DNA fragments.  Types of DNA libraries A. Genomic library Contains representative copies of all the genetic material of an individual organism – these are organism specific Contain all of the genetic material, whether that material is expressed in a particular tissue type or developmental stage or not Contains all DNA sequences: expressed genes, non-expressed genes, exons and introns, promoter and terminator regions, and intervening DNA sequences  Types of DNA libraries B. cDNA library Constructed by the conversion of mRNA from a particular tissue sample into DNA fragments that can be cloned into an appropriate vector. Contain only the coding sequence of genes expressed in a tissue sample together with small regions of the 5’ and 3’ untranslated portions of the gene. cDNA libraries isolated from different tissues of the same organism may be different in their composition.  Types of DNA libraries B. cDNA library The genes expressed in one tissue type or developmental stage may well be different from those expressed in another tissue type or developmental stage. The composition of a cDNA library reflects the relative abundance of mRNA in the original tissue sample. Highly expressed genes will be represented in the library multiple times, whereas genes expressed at a low level will be represented in the library less frequently.  Vectors A vector is an autonomously replicating DNA sequence that can be used to carry foreign DNA fragments. Foreign DNA fragments need to be carried in a vector to ensure propagation and replication within a host cell. The vast majority of molecular cloning experiments utilize the bacterium E. coli as host cell for the propagation of cloned DNA fragments. A vector that is used predominantly for reproducing the DNA fragment is often referred to as a cloning vector. A vector must possess the following characteristics to make it useful for molecular cloning: a)the ability to self-replicate b)a selectable characteristic so that transformed cells may be recognized from untransfromed cells.  Plasmids Plasmids – are naturally occurring extra-chromosomal DNA fragments that are stably inherited from one generation to another in the extra-chromosomal state. They are widely distributed throughout prokaryotes and range in size from ~1500 bp – over 300 kbp. Most plasmids exist as closed circular double-stranded DNA that often confer a particular phenotype onto the bacterial cell in which they are replicated – that is the plasmid will often carry a gene that encodes resistance to either antibiotics or heavy metals, or that produces DNA restriction and modification enzymes, that the bacterium would not normally possess.  Vector Plasmids pBR322 – p means plasmid, BR – named by Bolivar & Rodriguez who developed the plasmid (Bolivar et al. 1977), 322 – the number of the plasmid within their stock collection. It was the first widely used plasmid vector. It is a small plasmid (4363 bp) that was constructed using components from naturally occurring plasmids and other DNA fragments  Components of pBR 322 Vector Plasmids a)Origin of replication – pBR 322 carries the ColE1 replication origin and rop gene to ensure reasonably high plasmid copy number (15-20 copies per cell), which can be increased 200-fold by chloramphenicol amplification. b)Antibiotic resistance genes – pBR 322 carries two genes that can be used as selectable markers. The ampicillin resistance gene (termed bla or, more commonly, AMPR) was cloned into the plasmid from the Tn3 transposon, and the tetracycline resistance gene (termed tet or TETR) was cloned from the plasmid pSC101. c)cloning sites – the plasmid carries a number of unique restriction enzyme recognition sites. For example, sites for PstI, PvuI and SacI are found within AMPR, and the sites for BamHI and HindIII are located within TETR.  The antibiotic resistance gene in pBR322 allow for the direct selection of recombinants in a process called insertional inactivation. For example, if we want to clone a DNA fragment into the BamHI site of pBR 322, then the insert DNA will interrupt the gene responsible for tetracycline resistance, but the gene for ampicillin resistance will not be altered.  Transformed cells are first grown on bacterial plates containing ampicillin to kill all the cells that do not contain a plasmid. Those cells that grow in the presence of the ampicillin, but die under tetracycline selection, contain plasmids that have foreign DNA inserts – or in other words, the insertion of a foreign DNA into an antibiotic resistance gene inactivates the gene product and leads to antibiotic sensitivity (Fig. 3.4). Steps in gene cloning Steps in gene cloning  BACTERIAL TRANSFORMATION The host cells that take up The protein product the recombinant DNA are encoded by the cloned called transformed cells or gene or the insert is recombinant bacteria or a produced by the host cell. GM bacteria. Overview of Agrobactrium -mediated transformation in plants Gene gun method of plant transformation Gene Gun Method  Engineering of ‘Golden rice’ Two genes (one bacterial gene, two daffodil genes Enabling the endosperm to express a carotenoid biosynthetic pathway and produce β- carotene (provitamin A) (Ye et al., 2000). Datta el al., 2003 Co-transformation of multiple genes for carotenoid biosynthesis to produce ‘Golden rice’. Polished grains from transgenic indica rice cultivar IR64 showing the white endosperm of wild-type plants (left) and yellow endosperm of transgenic plants (right). Reproduced from Datta et al. (2003) 10. Animal cloning History of Animal Cloning 1952: the transfer of nucleus from frogblastocyst into enucleated oocyte 1975: protocol to transfer the nucleus of a fully differentiated Xenopus cell into enucleated cell and produced tadpoles 1989: cloned mammals by taking nuclei from the blastocyst of sheep embryo 1996: nuclei were taken from cultured embryonic sheep cells 1997: Wilmut et. Al. got the nuclei from cultured breast epithelial cells or a fully differentiated cell, producing the most famous sheep in the world, Dolly  Cloning of an adult mammal Carried out through somatic cell nuclear transfer  Dolly : The life and death of the cloned sheep 1. Fused cells (nuclei from mammary gland) were cultured in oviducts of sheep. 2. After 6 days, 29 of 277 developed into morula 3. About 1-3 embryos were transferred to 13 surrogate female parents and only one became pregnant. 4. After 148 days pregnancy, on July 5, 1996 Dolly was born at 6.6 kg and was named after the singer Dolly Parton. Dolly and her lamb Bonnie  Cloning of humans? 2001: 6-cell cloned embryos by Advanced Cell Technology 2002: reports of cloned embryos by Dr. P. Zavos 2003: reports of birth of cloned humans by Clonaid 2/20/2023 110 11. Bioinformatics The use of: Statistics Computer Programs and Programming Mathematics - to store, organize, and index the exponentially increasing sequence information DNA: The Information Storage Molecule DNA transcription translation The Human Genome Project  The Present Challenge  Handling a huge volume of data - if compiled in books, the data would run into 200 volumes of 1000 pages each - reading alone would require 26 years working around the clock  Bioinformatics Tools  Databases – With DNA, RNA, or protein sequences – With protein profiles – With protein structures  Computer Programs – To study DNA, RNA, or protein sequences – To generate structures/models from sequences  Major Databases a. GenBank - an annotated collection of all publicly available DNA sequences developed by the US NIH (National Institute of Health) / NCBI (National Center for Biotechnology Information) a. The EMBL Nucleotide Sequence Database - composed of DNA and RNA sequences, genome sequencing projects, and patent applications; Europe’s primary nucleotide sequence database a. DNA Data Bank of Japan (DDBJ) - collects nucleotide sequences from Japanese researchers, as well as researchers from other countries; works in collaboration with EMBL and NCBI/GenBank  Major Databases a. Entrez - the integrated text-based search and retrieval system that serves as the gateway to six major searchable databases of nucleotides, proteins, 3-D structures, genomes, taxonomy, and literature a. The Genome Database - contains all of the genomic mapping data from the human genome project a. Online Mendelian Inheritance in Man (OMIM) Database - catalog of human genes and genetic disorders a. BLAST - searches all available sequence databases for sequence similarity with both nucleotide and protein sequences  What is BLAST? Basic Local Alignment Search Tool Developed by Altschul, Gish, Miller, Myers, and Lipman in 1990 Used to search for related sequences available in the database Used for comparing two or more sequences for similarities Go to http://ncbi.nlm.nih.gov/BLAST/ The BLAST Search Engine Paste your DNA sequences here Results of a BLAST Search Graphical representation of alignments Scores for each result (includes name, annotation, and BLAST scores Alignment of the query sequence against the results sequence Results of a BLAST Search Score BLAST scores Results of a BLAST Search A matching sequence Applications of Bioinformatics in Biotechnology Research a. Agriculture b. Human Health c. Industry d. Environment and Wildlife Conservation e. Forensics  Bioinformatics in Agriculture a. Golden rice Organisms identified as source of genes using Gene for beta- BLAST search carotene production Transform available in other rice with the species but not genes the rice plant Daffodils Clone genes from daffodils and Erwinia uredovora  Bioinformatics in Agriculture b. Blue-colored roses Organism identified as Gene for blue source of genes using pigmentation BLAST search available in other Transform species but not rose with the the rose plant gene Clone genes from petunia  Bioinformatics in Human Health  Genome databases may be used to map a gene mutation leading to a genetic disorder  Genome databases are useful in identifying and studying a human pathogen  Protein and Genome databases may be used to create vaccines and drugs  Bioinformatics in Human Health Mapping a genetic disorder Determine gene function to: Human Complete DNA from 1. Map the location genome of diseases 5 races sequence 2. Make cures for human diseases 3. Gene therapy  Bioinformatics in Human Health Molecular detection of human pathogens 1. Microscopy, to check what the pathogen looks like Sequence key genes 2. Cell culture, to get BLAST Isolate an data on culture to identify unknown morphology = the pathogen identity of microbe pathogen from patient 3. Blood Bioinformatics can help Chemistry doctors make a correct 4. Isolation of diagnosis – and thus DNA from find the proper cure pathogen immediately  Molecular Detection of Bacteria and Viruses Should identify a protein, or a region of a protein that is unique to a bacterial species or a virus Target region of Target protein the viral in the cytosol, membrane, or coat appendages proteins or tail  Molecular Detection of Bacteria PCR primers 5’GAACGGCGATATGTTGACCC 3’CTTGCCGCTATACAACTGGGCGGTGGGTGGCGCTGCTGGC 5’GAACGGCGATATGTTGACCCGCCACCCACCGCGACGACCG AAATCAATACATCGCGCTAACAGGCGTTGGAAAGCAAGTCTC TTTAGTTATGTAGCGCGATTGTCCGCAACCTTTCHTTCAGAG TTCTTACCTTGCTTATATGCAGCTGGCGAAAAACTACAACCC AAGAATGGAACGAAGAGACGTGCACCGCTTTTTGATGTTGGG TGCCAATACCCTGTTCACCCTTGAGTTTGGATTAAATGA’5 ACGGTTATGGGACAAGTGGGAACTCAAACCTAATTTACT’3 TTGAGTTTGGATTAAATGA’5 BACTERIUM Design PCR primers targeting the unique gene sequences  Bioinformatics in the Industry Bioinformatics may be used to search for genes whose products can improve organisms used in industry such as - Microorganisms in food processing industry - Microbial enzyme production used in pharmaceutical, detergent, leather, textile industry, etc  Bioinformatics in Forensics Bioinformatics is used in forensics to: - Analyze the thousands of bands in DNA fingerprinting - Analyze short DNA sequences of individuals - Conduct statistical analysis of results - Search databases for suspects Bioinformatics in Forensics DNA Fingerprinting Get DNA from tissue sample (blood, skin, hair, sperm, swab) Isolate DNA Target regions of high polymorphism (variation) DNA FINGERPRINT  Bioinformatics in Forensics DNA from Suspect Use software identified Suspects Fingerprint to analyze with many banding OR Child/ bands Mother/ patterns Parentage (>100) Father clarified  Bioinformatics Can help keep – or make – humans healthier Can help design a drug with the desired properties and assess its therapeutic effects, theoretically Can help biotechnology produce better crops and food products Can help clean up the environment Can help save endangered species and establish definitive systems of classifications for the known organisms Can help the law Is JUST A CLICK AWAY FOR RESEARCH