DNA Structure, Function, and Replication Lecture Slides

DNA Structure, Function and Replication Dr. Praveen Babu Life Science for Engineers BIO 213  Life Depends on DNA Deoxyribonucleic acid (DNA) stores the information to make proteins; this makes life possible Each molecule is a polymer made from 4 nucleotides...

DNA Structure, Function and Replication Dr. Praveen Babu Life Science for Engineers BIO 213  Life Depends on DNA Deoxyribonucleic acid (DNA) stores the information to make proteins; this makes life possible Each molecule is a polymer made from 4 nucleotides (i.e., sugar, phosphate, and a nitrogenous base) Up until the 1950s, many believed proteins and not DNA comprised the chemical component of heredity Hershey & Chase showed it to be DNA Watson & Crick used Chargaff’s base pair rules (i.e., DNA has equal amounts of A’s & T’s and G’s & C’s) and Rosalind Franklin & Maurice Wilkins’ X-ray diffraction data to elucidate the structure of DNA  Life Depends on DNA DNA double helix is composed of two complementary antiparallel polynucleotide strands Sugar phosphate backbones (or phosphodiester backbones) are held together by H-bonding or “base pairing” between the bases  Life Depends on DNA DNA double helix is composed of two complementary antiparallel polynucleotide strands Sugar phosphate backbones (or phosphodiester backbones) are held Complementary together because one by H-bonding strand or “base determines the pairing” sequence between the bases of the other  Life Depends on DNA Complementary because one strand determines the sequence of the other DNA is read 5’ to 3’  Life Depends on DNA There’s a tremendous amount of DNA in a cell 6.4 billion bp in a human cell 4.6 million bp in an E. coli cell An organism’s genome is all of the genetic material in its cells; its entire genetic complement In eukaryotes, most of the DNA is in the nucleus in discrete stretches know as chromosomes Functional units of sequence on these chromosomes constitute genes  Genetic Information 1940s: found one gene controls production of proteins 1950s: Watson & Crick described this flow of information from nucleic acids (DNA & RNA) to proteins as the “Central Dogma of Molecular Biology” But, how is a linear sequence of nucleotides converted into a linear sequence of amino acids? DNA is in the eukaryotic nucleus Proteins are synthesized in the cytoplasm of a eukaryotic cell Information transfer must be indirect…via RNA Tracing the Flow of Genetic Information Transfer of information occurs in 2 steps: Transcription (DNA  RNA) and Translation (RNA  Protein) Tracing the Flow of Genetic Information Transfer of information occurs in 2 steps: Transcription (DNA  RNA) and Translation (RNA  Protein) Tracing the Flow of Genetic Information In transcription, genetic information is copied into messenger RNA (mRNA) in the nucleus mRNA is then processed and exported to the cytoplasm The information within the mRNA is then translated from “nucleotide” to “amino acid” in the cytoplasm during translation Both processes are highly regulated; Transfer ofend result is occurs information a phenotype in 2 steps: Transcription (DNA  RNA) and Translation (RNA  Protein) Tracing the Flow of Genetic Information DNA and RNA are different molecules with different purposes; KNOW the difference between DNA and RNA! DNA’s most important use is information storage in the nucleus; the many RNAs “mobilize” this information  (Tc’n): DNA to RNA In Tc’n, RNA polymerase synthesizes a copy of one gene from a DNA template as a heterogeneous nuclear RNA (hnRNA) molecule Nucleotides are always made 5’ to 3’ so RNA is made 5’ to 3’ off of the 3’ to 5’ DNA template strand The process occurs in 3 stages:  (Tc’n): DNA to RNA Tc’n has 3 stages: initiation, elongation, & termination 1. Initiation: RNApol binds DNA at the gene’s promoter; the DNA helix unwinds; RNA synthesis begins Initiation RNA polymerase enzyme DNA Promoter DNA template strand  (Tc’n): DNA to RNA Tc’n has 3 stages: initiation, elongation, & termination 2. Elongation: DNA threaded through RNApol at Tc’n bubble; RNA strand growing 5’3’; A in DNA paired with U in RNA; 30-50 nucleotides per second! Elongation RNA polymerase DNA RNA  (Tc’n): DNA to RNA Tc’n has 3 stages: initiation, elongation, & termination 3. Termination: RNApol reaches “bumps” in terminator region and “falls off” Termination RNA polymerase DNA Terminator RNA  (Tc’n): DNA to RNA Tc’n has 3 stages: initiation, elongation, & termination 1. Initiation: RNApol binds DNA at the gene’s promoter; the DNA helix unwinds; RNA synthesis begins 2. Elongation: DNA threaded through RNApol at Tc’n bubble; RNA strand growing 5’3’; A in DNA paired with U in RNA; 30-50 nucleotides per second! 3. Termination: RNApol reaches “bumps” in terminator region and “falls off” In bacterial cells, many genes are Tc’d at once making a polycistronic RNA which codes for multiple proteins Genes and proteins are almost always colinear in bacteria  RNA Processing In eukaryotic cells, there is still one more step after this for protein-coding messenger RNAs: RNA Processing Newly synthesized RNA called heterogeneous nuclear RNA must be modified before it is fully functional Eukaryotic genes have a complex internal organization Posses noncoding nucleotide sequences called introns that are Tc’d, but not translated into protein Intervene between coding sequences called exons Many believed introns were composed of http://ecrbrowser.dcode.org/ “junk DNA” We know now introns are valuable (e.g., Evolutionary Conserved Regions or ECRs)  RNA Processing Newly synthesized heterogeneous nuclear RNA must be modified before it is fully functional Caps are added for initiation of translation & stability A poly adenine tail (~30-100 A’s long) is also added Introns are removed via a process called splicing RNA Processing  RNA Processing Newly synthesized heterogeneous nuclear RNA must be modified before it is fully functional Caps are added for initiation of translation & stability A poly adenine tail (~30-100 A’s long) is also added Introns are removed via a process called splicing Remember, RNA processing is only possible in eukaryotic cells The next step is nuclear export so the mRNA can be translated into a polypeptide strand  Different RNA Molecules In Tl’n, mRNA is translated into a stretch of amino acids by enzymes and other RNA molecules! Ribosomal RNA (rRNA) are a major component of the organelles (ribosomes) that construct proteins Transfer RNA (tRNA) are “interpreters” that read the mRNA code; insert amino acids to the growing protein  Different RNA Molecules In Tl’n, mRNA is translated into a stretch of amino acids by enzymes and other RNA molecules! Ribosomal RNA (rRNA) are a major component of the organelles (ribosomes) that construct proteins Transfer RNA (tRNA) are “interpreters” that read the mRNA code; insert amino acids to the growing protein tRNA takes on a characteristic cloverleaf structure Amino acid attachment site (always “CCA”) at 3’ end Each has a unique anticodon, which pairs to the codon on the mRNA during translation  The Genetic Code The information to encode a single amino acid is carried in a sequence of three nucleotides 3 nucleotides gives 43 different combinations to encode the 20 amino acids Each triplet is called a codon The code is de- generate Some codons are STOP codons  The Genetic Code The information to encode a single amino acid is carried in a sequence of three nucleotides 3 nucleotides gives 43 different combinations to encode the 20 amino acids Each triplet is called a codon The code is de- generate AUG is also the START codon  Translation The nucleic acid code in a mature mRNA is translated into amino acids to synthesize polypeptides In eukaryotes, mature mRNA is exported out of the nucleus into the cytoplasm where it is translated by ribosomes One mRNA transcript can be translated many times over—even simul- taneously—by many ribosomes  Translation There are 4 stages in protein synthesis: 1. Initiation: small and large ribosomal subunits bind mRNA; first tRNA also binds  Translation There are 4 stages in protein synthesis: 2. Elongation: ribosome catalyzes the formation of a peptide bond between the amino acid in the peptidyl site (P site) and the amino acyl site (A site) Peptide bond  Translation There are 4 stages in protein synthesis: 3. Translocation: ribosome ratchets over one codon jettisoning empty tRNA and accommodating another amino acyl tRNA; STEPS 2 & 3 REPEAT UNTIL…  Translation There are 4 stages in protein synthesis: 4. Termination: elongation ceases once a STOP codon is reached (UAA, UAG, or UGA); release factors bind the ribosome and the complex falls off  Translation 3:41  The Central Dogma Next, the nucleic acid code in the mature mRNA is translated into amino acids to synthesize polypeptides In eukaryotes, mature mRNA is exported out of the nucleus into the cytoplasm where it is translated by ribosomes There are 4 stages in protein synthesis: 1. Initiation – requires amino acids, tRNAs, & energy 2. Elongation 3. Translocation 4. Termination – Elongation ceases once a STOP codon is reached (UAA, UAG, or UGA); the complex falls off An “interpretive dance” of Translation  is Highly The flow of information or gene expression is highly Regulated regulated; here are only 6 examples  Mutations Change DNA Mutations can involve substitutions, insertions, or deletions of one or more nucleotides in a DNA molecule Nucleotide substitution mutations alter the sequence, but not the number of nucleotides in a gene Involve one (“point”) or only a small number of bases 5’ ATGGCCACGGTTCTTCCTATA ATGGCCACGGGTCTTCCTATA 3’ 3’ TACCGGTGCCCAGAAGGATAT TACCGGTGCCAAGAAGGATAT 5’  Mutations Mutations can involve substitutions, insertions, or Change DNA deletions of one or more nucleotides in a DNA molecule Nucleotide substitution mutations alter the sequence, but not the number of nucleotides in a gene Frameshift mutations result from the insertion or deletion of bases Because codons are composed of three bases, inserting or deleting a single base in DNA can drastically affect mRNA translation THE DOG AND THE CAT ARE OUT… TED OGA NDT HEC ATA REO UT… THH EDO GAN DTH ECA TAR EOU T…  Mutations Mutations can involve substitutions, insertions, or Change DNA deletions of one or more nucleotides in a DNA molecule Nucleotide substitution mutations alter the sequence, but not the number of nucleotides in a gene Frameshift mutations result from the insertion or deletion of bases  Misfolding Can Mutations can alter polypeptide folding causing genetic Cause Disease disorders like Alzheimer’s disease & cystic fibrosis (CF) CF results from defective folding of the CF transmembrane conductance regulator (CFTR) protein Δ508 = misfolded protein It is identified by the cell as defective and destroyed before it ever leaves the ER Mutations aren’t the only cause of improper protein folding  Misfolding Can Some proteins can refold and change their 3D shape Cause Disease Protein refolding diseases are called prion diseases Prions are protein folded into an infectious conformation that is the cause of several disorders Creutzfeldt-Jakob disease is the human variant of mad-cow disease (BSE) In vCJD & BSE, the prions cause normal proteins in the body to refold into new, infectious 3D shapes that kill cells in the brain and nervous system Misfolding Can Cause Disease