Gene Expression Part 1 to 4 for D2L (1) PDF

Review – DNA replication 1 DNA 1 Synthesis Review 2 2 2 DNA Synthesis 3 Review Energy 3  4 DNA Synthesis Review...

Review – DNA replication 1 DNA 1 Synthesis Review 2 2 2 DNA Synthesis 3 Review Energy 3  4 DNA Synthesis Review -Excises RNA primer -Replaces primer w DNA 5 -What is it’s role? 6 4 4  Which of the following is TRUE? A) Okazaki fragments are used to synthesize A B) Okazaki fragments are used to synthesize B A B C) Primase is ONLY needed for lagging strand D) DNA Pol III is ONLY needed for leading strand E)TWO of the above 5 Gene Expression: Gene Outline Expression - Outline Part 1. Overview gene expression Part 2. Transcription – RNA – Steps of transcription – Pre-mRNA modifications Part 3. Translation – Genetic code – tRNA – Steps of translation Part 4. Mutations 6 Gene Expression What does the term “gene expression” mean? Which processes does it involve? Transcription of DNA into RNA Translation of RNA into Protein 7 Central Dogma of Biology 1 1. DNA replication 2. Transcription 3. Translation 2 What occurs during the process of transcription? What occurs during the process of Translation? 3 8  Heritable Defects and Enzymes DNA holds genetic information within the sequences of its nucleotides - this information is expressed as protein. Archibald Garrod (1902) was the first to suggest that genes dictate phenotype through enzymes Alkaptonuria hereditary disease caused by the absence of an oxidase enzyme that breaks down homogentistic acid (alkapton) no enzyme = build up of homogentistic acid, which becomes oxidized and turns black 9 Phornphutkul et al 2002 NEJM  “One Gene – One Enzyme” REFINED Not all proteins are enzymes, yet their synthesis depends on specific genes tweaked the hypothesis to “one gene - one protein” Later research showed that many proteins are composed of several polypeptide subunits, each of which has its own gene ex. hemoglobin: four polypeptide subunits, two alpha and two beta subunits so two genes required Idea restated as “one gene - one polypeptide” hypothesis. However we know that even this is limited ex. splice variants 10  Gene Expression Overview Gene expression: transcription and translation Transcription A DNA strand provides a template for the synthesis of a complementary RNA strand mRNA, tRNA, rRNA, snRNA, other RNA types Which of the RNA’s contains the code for amino acid sequences? Translation mRNA is used to determine the amino acid sequence of a polypeptide Translation occurs at ribosomes Some key differences in prokaryotes vs eukaryotes…. 11 LOCATION of gene expression, eukaryotes Transcription – nucleus (produces pre-mRNA) RNA processing nucleus (pre-RNA  mature mRNA) Translation –mRNA exits via nucleopores to cytoplasm, translate to protein on ribosomes (mature mRNA  polypeptide) 12  RNA terminology There are various types of RNA in a cell. 4 key types: mRNA, messenger RNA: dictates the amino acid (AA) sequence of a polypeptide tRNA, transfer RNA: transport amino acids to the ribosomes during translation, and transfer the AA to the growing polypeptide chain rRNA, ribosomal RNA: Along with ribosomal proteins, compose ribosomes (which are location for translation) snRNA, small nuclear RNA: along with proteins, forms complexes that are used in eukaryotic RNA processing 13 Gene Expression: Gene Outline Expression - Outline Part 1. Overview gene expression Part 2. Transcription – RNA – Steps of transcription – Pre-mRNA modifications Part 3. Translation – Genetic code – tRNA – Steps of translation Part 4. Mutations 14 Transcription 15  Transcription: key features Transcription - mechanism that converts messages encoded by DNA into a complementary RNA copy (i.e. mRNA) RNA polymerase synthesizes this RNA Only one of the two DNA strands is copied template (antisense) strand = transcribed non-template coding strand = not transcribed RNA polymerase adds ribonucleotides to the Transcription is growing 3’ end of an mRNA chain DNA-directed  Synthesis proceeds in 5’3’ direction synthesis of RNA  Thus the template is “read” 3’5’ direction 16  Transcription Overview -DNA is separated for transcription -only one side of DNA double helix serves as template -DNA temporarily unwinds, then rewinds following transcription -RNA Pol makes a 3’ end mRNA which is complementary 5’end -Each new nucleotide is added to the 3’ OH at 3’ end of growing chain 17 Transcription - Gene Structure Gene = Promoter + Transcription unit Less than 2% of the DNA in humans codes for genes (thus over 98% is non-coding!) 3 stages of transcription: initiation, elongation, termination Transcription initiates at promoter (incl TATA), while the terminator signals the end of transcription 18  i. Initiation - Finding the Genes Genes are identified by promoters, specific nucleotide sequences Promoter region includes TATA Box ~30 B.P. upstream of transcription start site Transcription factors bind and attract RNA polymerase RNA polymerase binds to promoter region Bacteria contain a single type of RNA polymerase TATA Box  TFs Eukaryotes contain three RNA polymerases (I, II, and III) RNA Pol is recruited to Promoter Region Other regulatory proteins involved (not shown) 19  i. Initiation (con’t) -DNA is unwound to expose template strand, TFs released -RNA polymerase begins RNA synthesis at transcription start site -RNA nucleotides are paired complementary to template in 5’3’ direction 20  ii. Elongation -RNA polymerase continues moving along and unwinding template -It continues to synthesize and elongate the mRNA by adding complementary RNA nucleotides in 5’3’ direction 21  iii. Termination -At the terminator, RNA polymerase releases from the template -The pre-mRNA transcript is released -The DNA rewinds to its double helix (more transcripts will be made) -Note that only the transcription unit of the gene was copied to mRNA 22  At Home Exercise What is the meaning of the “Central Dogma of Biology”? Describe the main similarities and differences between DNA replication, transcription, and translation What are the similarities and differences between DNA Polymerase and RNA polymerase (with respect to their function)? 23  Select the FALSE statement: A. Transcription produces RNA B. Translation involves the synthesis of polypeptides C. DNA replication occurs in the nucleus, while transcription and translation occur in the cytoplasm D. There are several types of RNA; mRNA contains the code for synthesizing polypeptides E. None of the above, they are all correct 24  In-Class Questions A. To initiate transcription, the RNA polymerase binds to the DNA template at the ________________ (location). B. Describe the initiation process for transcription A. Promoter region - just upstream to the ‘coding’ region of DNA (transcription unit). B. Transcription factors bind to the TATA box within the promoter region and to other regulatory sequences. The TFs recruit RNA polymerase, which attaches, unwinds the DNA double helix and begins synthesizing the new RNA – In which direction is the mRNA synthesized? In which direction is the DNA template strand “read”? 25 A segment of DNA has the nucleotide sequence of 5’-GCATTAGAC-3’. What would be the sequence of its complementary mRNA ? A. 5’ CGUAAUCUG 3’ B. 5’ CGTAATCTG 3’ C. 5’ GUCUAAUGC 3’ D. 5’ GTCTAATGC 3’ 26 A template strand of DNA has the sequence 5'AATACGG3', which mRNA sequence will be transcribed? A. 5‘ CCGTATT 3' B. 3‘ CCGTATT 5' C. 5‘ UUAUGCC 3' D. 5‘ CCGUAUU 3' E. 5‘ GGCATAA 3' 27  Which statement(s) is/are TRUE? A. During transcription, helicase unwinds the DNA double helix B. DNA Polymerases add nucleotides in a 5’-->3’ direction, while RNA Polymerase adds nucleotides in a 3’-->5’ direction C. DNA Pol III synthesizes the leading and lagging strands in DNA replication, while RNA polymerase synthesizes RNA in transcription D. The start codon, AUG, is found in the promoter region of the gene E. ALL of the above are true 28 RNA Processing: Post-transcriptional Modifications 29  Eukaryotic RNA modification Nuclear enzymes modify pre-mRNA before it is sent to the cytoplasm 5’ G CAP Poly (A) TAIL 1. 5’ end : – 5’ Cap - modified form of guanine is added, next to 5’ UTR – This helps protect mRNA from hydrolytic enzymes and assists in ribosome attachment 2. 3’ end : – Poly(A) Tail - 50 to 250 adenine nucleotides added – Inhibits hydrolysis of mRNA end – Directs export of mRNA from the nucleus 30  Eukaryotic RNA Modification (con’t) 3. RNA Splicing Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides – Introns: “Intervening Sequences”; noncoding sections  Lie between coding regions  REMOVED – Exons: “Expressed Sequences”; coding regions  Spliced together: single uninterrupted message  Translated into amino acid sequences plus the 5’ and 3’ untranslated (UTR) regions 31  Splicing Exons (self study slide) Mediated by a spliceosome  Composed of snRNPs, Small nuclear ribonucleoproteins (Each contains a snRNA + associated proteins) snRNA in the snRNPs base pair with edges of the intron, which allows precise removal of the intron and ligation of the exons The spliceosome complex cleaves out the intron, snRNPs released & reused Intrinsic – in some cases introns accomplish this on their own: the intron “twists itself out” 32 Why do Genes have Introns? (self study) Several possible functions: Some introns regulate gene activity Alternative RNA splicing More than one polypeptide can be synthesized from the same gene, depending on how the pre-mRNA introns are spliced out ex. Tropomyosin Humans: 20,000 genes, but can make 100,000 proteins Exon Shuffling Exons control particular protein domains (area of particular shape) – new combinations for evolution 33  In-Class Questions Discuss the 3 types of post-transcriptional modifications to the pre-mRNA What is the location of the processing and where will the mature mRNA be transported next? 34  Genetic Code Genetic code consists of a series of information blocks called codons. – triplet code, 43 = 64 codons  Unambiguous: each codon can only code for one amino acid – open reading frame (ORF)  Begin translation at AUG – the ORF contains the codons from AUG (start) to a termination/stop codon – Universality of the Code: shared by all organisms from simplest bacteria to most complex plants and animals 35  Universality of the Code The genetic code is shared by all organisms from the simplest bacteria to the most complex plants and animals Some exceptions, ex. stop codon UGA codes for tryptophan in mitochondria Universality of code allows for implantation of genes from one species to another 36  In-Class Questions 1. How many codons? How many amino acids exist? Thus the codon table has redundancies. 2. How many codons code for amino acids? 3. Which ones do NOT? 4. What is the start codon for translation of all mRNAs? 5. What are the termination (stop) codons? 6. List the two amino acids that do NOT have redundant codons (one unique codon causes their translation) 37  Features of the Genetic Code mRNA Codons are written 5’ --> 3’ 64 codons total mRNA mRNA One start codon (AUG: Met), 3 stop codons (No AAs) Redundancy (except for Met and Trp) Universality Unambiguous 38 mRNA mRNA mRNA peptide bond N-terminus NH2-Met- -Ala- -Ser- -Ile-COOH C-terminus 5’CUCGGUAUGGCCUCUAUUUGAGAGUA3’ mRNA strand 39 Gene Expression: Gene Outline Expression - Outline Part 1. Overview gene expression Part 2. Transcription – RNA – Steps of transcription – Pre-mRNA modifications Part 3. Translation – Genetic code – tRNA – Steps of translation Part 4. Mutations 40 LOCATION of gene expression, eukaryotes Transcription – nucleus (produces pre-mRNA) RNA processing nucleus (pre-RNA  mature mRNA) Translation –mRNA exits via nucleopores to cytoplasm, translate to protein on ribosomes (mature mRNA  polypeptide) 41  tRNA – transfer RNA Small RNAs, role is to bring the AAs to the ribosome so that they can be assembled into polypeptides Amino acid at one end, anticodon at other end The correct AA must be on tRNA with corresponding anti-codon Aminoacyl tRNA synthetase – adds AAs to tRNA (“charging”) 42  tRNA Anticodons Bind to mRNA Codons tRNA has an anticodon on its “bottom” this base-pairs with codons in mRNA 43  Example. Amino Acid Tryptophan: what is the anticodon? Trp Codon: 5’-UGG-3’ mRNA Anticodon 3’-ACC-5’ tRNA Trp A C C U G G 3’ 5’ 44  Ribosomes Protein and rRNA complex: small subunit and large subunit – Catalytic activity in large subunit “A” site: Aminoacyl tRNA binds “P” site: Peptidyl tRNA binds “E” site: exit site Note: antibiotics 45  Translation: A. Initiation Small ribosomal subunit forms a complex with Met-tRNA and GTP This binds to mRNA at 5’ UTR and Cap – initiator tRNA molecule and SSU “scan” along the mRNA for a start codon – large subunit settles down on top  the codon next to AUG start is exposed at A-site and ready for tRNA binding 46  Translation: B. Elongation – Each new amino acid (attached to tRNA) enters the “A” site – Peptidyl transferase cleaves the growing polypeptide (“P” site) and binds it to the new amino acid located at “A” – The ribosome translocates 3 codons over to allow entry of a new charged tRNA to enter with its amino acid – The “empty” tRNA (no attached amino acid), leaves out of the “E” site 47 48  Translation: C. Termination Termination – Release factors have anticodons to Stop codons (UAG, UAA, UGA) – Release factors bind to stop codon – Newly made polypeptide is released from the ribosome 49 50 Translation 5’ vs 3’ ends Review N- vs C-terminus Enzyme that transfers AAs? Type of bonds 51  Which structure A represents an ANTICODON? B C 52 Polyribosome: Many ribosomes can translate an mRNA at the same time 53  Differences Between Prokaryotic and Eukaryotic Gene Expression Location of transcription:  Eukaryotes: transcription occurs in the nucleus, translation in cytoplasm (/threaded in to RER). Prokaryotes: transcription and translation in Cytoplasm  As a result, in prokaryotes, mRNA can be transcribed and translated simultaneously Different types of RNA polymerases  One generic RNA pol in prokaryotes  Several in eukaryotes different functions 54  Differences Between Prokaryotic and Eukaryotic Gene Expression (con’t) mRNA processing occurs in eukaryotes: – 5’ Cap and 3’ Poly (A) tail are added and removal of introns. Not in prokaryotes Polystronic mRNAs in prokarytoes: Individual mRNA transcripts can contain information from several gene, to make a “set” of proteins 55  Protein Targetting Eukaryotes create some proteins with a “signal peptide” which directs it to the ER All ribosomes start out as “free ribosomes” 56 Which amino acid would be attached to the tRNA carrying the anticodon “CGU” ? A. Alanine (Ala) B. Threonine (Thr) C. Arginine (Arg) D. Cysteine (Cys) 57 The three-nucleotide codon system is arranged into ___ total combinations. There is/are ___ codon(s) that do NOT code for AAs A.16, 3 B. 64, 1 C. 64, 3 D.128, 1 58 Each amino acid in a protein is specified by A. several genes B. a promoter C. a mRNA with redundant codons (degenerate) D. a codon on the mRNA E. a codon on the DNA 59 During translation, ribosomes “slide” along an mRNA molecule one codon at a time. Which of the following occurs? a) tRNA from the A site transfers to the P site. tRNA from the P site moves to the E site and is released b) tRNA from the P site moves into the A site. tRNA from the A site moves to the E site and is released c) tRNA from the A site departs from the ribosome to attach to a new amino acid. All new/incoming tRNAs bind at the P site d) ALL of the above 60  If a codon reads “5’-UAC’3’”, its complementary anticodon will be: A. GUA, located on the tRNA B. ATG, located on the DNA template C. AUG, located on the mRNA D. AUG, located on the tRNA E. GUA, located on the mRNA 61  When mRNA leaves the cell's nucleus…. A. The mRNA interacts with tRNA, which provides amino acids B. The mRNA synthesizes tRNAs on a ribosome C. The mRNA is translated, with the help of tRNAs which provide nucleotides D. The mRNA is translated on a ribosome, and rRNAs provide the amino acids necessary 62 Which of the following statements is TRUE about prokaryotic gene expression? A. Prokaryotic mRNAs must have introns spliced out. B. Prokaryotic mRNAs are often translated before transcription is complete. C. Each prokaryotic mRNA contains the transcript of only one gene. D. Prokaryotic transcription occurs in the nucleus, while translation occurs in the cytoplasm E. ALL of these statements are correct. 63  In-Class Exercise (from practice worksheet) Suppose the non-template strand of a (very short) bacterial gene has following sequence: 5’ TGAGTATGTTTGGTGGACGATGAAGT 3’ [a) Write out sequence of the template strand 3’5’] b) Write out sequence of the transcribed mRNA 5’3’ c) Translate the mRNA and label ends of the polypeptide Assume there’s a b.p. substitution U  C, now mRNA reads: 5’UGAGUAUGUUUGGCGGACGAUGAAGU-3’ d)Translate the mRNA, label the ends. What type of mutation is this? What is the result on the polypeptide? e) what if the previous b.p. substituted: GA 5’UGAGUAUGUUUGAUGGACGAUGAAGU-3’ 64  Don’t forget to label the ends of the polypeptide and nucleic NH2 -Met- -Phe -Gly--Gly -Arg -COOH acids! mRNA transcript 5’- UGAGUAUGUUUGGUGACGAUGAAGU-3’ 65 Gene Expression: Gene Outline Expression - Outline Part 1. Overview gene expression Part 2. Transcription – RNA – Steps of transcription – Pre-mRNA modifications Part 3. Translation – Genetic code – tRNA – Steps of translation Part 4. Mutations 66  Point mutations Mutations – Changes in genetic material – May be transmitted to future generations if they occur in germ-line cells point mutation - chemical change in just one base pair of a gene Ie. sickle-cell disease – Caused by a mutation of a single base pair in the gene that codes for Β-hemoglobin – A → T = Glutamic acid → Valine 67  Different Kinds of Mutations Base-pair substitution – Replacement of one base with another Silent mutations – Same amino acids because of redundancy in the genetic code (“wobble”). No change in protein. – [Synonymous: new AA similar to “normal” one] Missense mutations – Still code for an amino acid but with wrong properties Nonsense mutations – Change an amino acid codon into a stop codon, shorter protein 68  Frameshift Mutations Insertions and deletions – alter the open reading frame (ORF) – A single addition or deletion, or pairs of additions or deletions affect ORF – Groups of three BPs do NOT cause a frameshift – All the nucleotides downstream of the deletion or insertion will be improperly grouped into codons Usually have a disastrous effect on the resulting protein – more so than substitutions do (rule of thumb) 69  Summary – Types of Mutations Point Mutations, Base pair substitutions: – Silent (no change to AA) – Missense (one new/changed AA) – Nonsense (stop codon) Frameshift Mutations – Insertion (1 or 2 bases, not 3) – Deletion (1 or 2 bases, not 3) Note that the earlier in the translation sequence, the more deleterious the effects of the insertions and deletions 70 71  UCA to Ser to Pro 72 UGC to 73 Different Kinds of Mutations GGU to 74  Mutagens Chemical or physical agents that interact with DNA to cause mutations Physical agents – High-energy radiation (X-rays; UV) – Others interfere with DNA replication by inserting into DNA and distorting the double helix Chemical mutagens – Some are base analogues that may be substituted into DNA but that pair incorrectly during DNA replication – Still others alter pairing properties of normal bases 75  In-Class Exercise In-Class Exercise (from (from practice practice worksheet) worksheet) Suppose the non-template strand of a (very short) bacterial gene has following sequence: 5’ TGAGTATGTTTGGTGGACGATGAAGT 3’ a) Write out sequence of the template strand 3’5’ b) Write out sequence of the transcribed mRNA 5’3’ c) Translate the mRNA and label ends of the polypeptide Assume there’s a b.p. substitution U  C, now mRNA reads: 5’UGAGUAUGUUUGGCGGACGAUGAAGU-3’ d)Translate the mRNA, label the ends. What type of mutation is this? What is the result on the polypeptide? e) what if the subsequent b.p. substituted: GA 5’UGAGUAUGUUUGAUGGACGAUGAAGU-3’ 76  NH2 -Met -Phe -Gly- -Gly -Arg -COOH b) mRNA transcript 5’- UGAGUAUGUUUGGAGGUCGAUGAAGU-3’ C NH2 -Met- -Phe -Gly--Gly--Arg-COOH Silent Mutation 77  NH2 -Met- -Phe- -Gly- -Gly- -Arg -COOH Wildtype AA sequence mRNA transcript with B.P. subst 5’- UGAGUAUGUUUGAUGGACGAUGAAGU-3’ Polypeptide sequence w NH2 -Met- -Phe -Asp-Gly- -Arg-COOH mutation Missense Mutation 78 REVIEW – GENE EXPRESSION 79  Review: Transcription 1. Which enzyme adds ribonucleotides to build the mRNA transcript? 2. To initiate transcription, this enzyme binds to the _________region of the gene. RNA Pol is recruited when ________ bind to this region. 3. mRNA transcript is synthesized______ (direction) 4. LIST 3 POST-TRANSCRIPTIONAL Modifications to mRNA 5. Where are codons found? 80 Which mutation would be most likely to have a catastrophic effect on the functioning of a protein? A. base substitution near the start of sequence B. deletion of one base near the start of the coding sequence C. base deletion near the end of the coding sequence (but not in stop codon) D. deletion of three bases near the start of the coding sequence, but not in the start codon E. insertion of one base near the end of the coding sequence (but not in stop codon) 81 At Home Exercise: Replication vs Transcription vs Translation How is DNA replication initiated? – Ori: proteins mark the site for initiation, helicase unwinds dbl helix, an RNA primer (primase) is laid. DNA polymerase extends primer at 3’OH with dNTPs, deoxyNucleoside Tri-Phosphates How is transcription initiated? – Attracted by TFs, RNA polymerase binds to promoter and starts adding complementary bases (rNTPs) at transcription start point – no primer is needed How is translation initiated? – Met tRNA binds to Psite at small subunit of ribosome. This complex binds to 5’ cap/UTR of mRNA then scans for the start codon UAG. The anticodon on tRNA (AUC) binds to mRNA start codon 82 At Home Exercise: Replication vs Transcription vs Translation What are the products of replication, transcription, translation? – Replication: exact copy of the DNA double helix Transcription: mRNA, translation: polypeptide During DNA replication which enzyme lays down the new DNA nucleotides (base pairs)? During Transcription which enzyme produces the mRNA? What are the products of mitosis vs meiosis? Which process above needs to occur prior to mitosis or meiosis? – Mitosis: 2 daughter cells, each with exact copy of the DNA from parent cell. Meiosis: 4 daughter cells, each haploid with ½ DNA content 83  At Home Exercise: List the Locations! 1. DNA replication occurs in the _____________ 2. Cellular respiration: Glycolysis in the _____b_____, citric acid cycle in the ____c and electron transport chain ___c___; proton motive force is a gradient across the ____d____ (build up of H+ in the ___e__)  List the organelle and specific structure in organelle 3. Photosynthesis: ____a____(organelle). The light reactions in the ____b____, its electron transport chain ___c___. Calvin cycle ___d__  List the organelle and structure 4. Transcription _____a_____ and Translation _____b_____ 5. Mitosis _____a______ and Meiosis ____b______ 84