BIO 211 Final Exam Study Guide Fall 2024 PDF

BIO 211 Final Exam Study Guide-Karp Fall 2024 The final exam is worth 11% of your BIO 211 grade and is cumulative. The exam will be individual only (no group component) and must be taken using the Lockdown Browser in our Biosciences classroom at 2pm on Monda...

BIO 211 Final Exam Study Guide-Karp Fall 2024 The final exam is worth 11% of your BIO 211 grade and is cumulative. The exam will be individual only (no group component) and must be taken using the Lockdown Browser in our Biosciences classroom at 2pm on Monday Dec 9. In extenuating circumstances such as illness, a makeup exam can be scheduled at the testing center in consultation with Dr. Karp. Any exams taken outside of these scenarios will receive an automatic 0. The final exam will have two portions: short answer and multiple choice. Section A is a list of 6 possible short answer questions – the final exam will contain three of these questions. Section B lists topics and key terminology you should be familiar with to answer the 30-35 multiple choice questions that will be on the final exam. Part A. Potential short answer questions. Three of the short answer questions listed below will be asked on the exam, exactly as shown. As you study, use your notes, note-taking guides, text, Powerpoints, activities, and/or homework to help you prepare your answers. (You will not be able to use your notes or any other materials during the exam). 1. Avery, MacLeod, and McCarty experiment a. Describe the Avery, MacLeod and McCarty experiment by answering the questions below. Hint, your answer should include RNAse, DNAse, protease, smooth bacteria (aka virulent or IIIS), rough bacteria (aka avirulent or IIR), heat-killed cells, live cells, and transformation/transforming principle. 1. The purpose of the experiment showing that DNA is genetic material 2. The design of the experiment (including types of bacteria used and 3 treatments). cells and igpi proteasy.ch f cells no transformation geneticmaterial Gimeno s am 3. Describe the positive and negative controls that were included in this experiment, if any. N A 4. If any controls were missing, describe the positive and negative controls that could have been included in this experiment. positive control separate heat control w o bacteria bacteria w o anything added negative living 5. The results of the experiment and the interpretation of the results. b. State what would have been observed for each of the 3 treatments if protein were the genetic material. protease would transformed not have 2. Gene transfer in bacteria  a. Describe in some detail (at least 3-4 sentences) each of the three mechanisms by which bacteria can exchange genetic material. EEEgt.im tntgfihtirgaE im gbiiIEromS'nitiMmen scantn'atgeeniiiamng.net Transduction delivery virus infects bacterium and picks up some of its DNA defiling FEIthrewPsterium b. State whether cell-cell contact is required for each mechanism. conjugation 2 bacteria connect the pilus can transfer geneticmaterialdirectly from one to the 0th involves exchange of plasmids c. You grow some his- bacteria and some leu- bacteria together in a flask and find that you now get some colonies growing on minimal medium. Design a set of experiments that would tell you which of the three mechanisms was operating. Include any controls that would help you have more confidence in your results. transformation atypselfths knownto infect both his w virus then E5kge inqetn minrectnis aaihtifiinktig.in 3. Central Dogma si conectpn iFEtEut es EE aaee m a. From the DNA molecule below, transcribe the resulting RNA molecule. Assume transcription starts with the first nucleotide. (Sequence pisaiet 5provided on exam will be different from this sequence). 5’ ATGACGGACAGTTACCCCAATTAGCGGAAG 3’ (non-template strand) 3’ TACTGCCTGTCAATGGGGTTAATCGCCTTC 5’ (template strand) UACUGCCUGUCAAUGGGGUUAAUCGCCUUC 3 b. In what part of the cell is this RNA produced in bacteria? In eukaryotes? cytoplasm 1 huddles c. List the three aspects of mRNA processing that occur only in eukaryotes and convert the pre-mRNA into the mature mRNA. adding a poly A tail 5 cap d. intron splicing Translate the RNA molecule into a protein. (Genetic code will be given). 4. Regulation of gene expression a. Give an example of a process that regulates gene expression at each of the following levels in eukaryotes. Include a brief explanation of how that process works.  Chromatin structure DNA methylation addition of methyl group turns off gene prevents transcription factors from binding Transcriptional regulation DNA binding proteins that initiate transcription Control is whether gene on OFF Post-transcriptional regulation Adding a poly A tail protects MRNA from degradations helps export from nucleu b. Which one of the levels listed in part (a) is most commonly used in bacteria? Briefly explain one example. Transcriptional Lac operon controls breakdown of lactose when lactose is absent a repressorprotein binds to operatorregion blocki 5. 19secPactose is present it binds to repressor causing it torelease from D Meiosis for (2n = 4), how manyto be allowing a. If a cell has genes two pairs needed lactose metabolism of homologous chromosomes transcribed chromosomes and how many DNA molecules/sister chromatids does it have at each stage of meiosis? Include prophase I, metaphase I, anaphase I, telophase I, prophase II, metaphase II, anaphase II, telophase II, and products of meiosis (gametes). sina.mn to i b. When provided with a picture of chromosomes, be able to distinguish between homologous chromosomes and sister chromatids. mar 7 7 Wous n hehe c. What are the two processes discussed in class that generate genetic variation? At what stage of meiosis does each process occur? Choose from prophase I, metaphase I, anaphase I, telophase I, prophase II, metaphase II, anaphase II, telophase II. prophase I crossing over anaphase I independent assortment 6. Cancer a. Although cancer is not usually inherited in a Mendelian way in families, it is said to be a genetic disease. Explain why cancer can be considered to be a genetic disease. cancer isn't itself inherited but the mutations that can cause it are inherited  b. Describe the relationship between cancer and environmental mutagens, including two specific examples of environmental mutagens. UV radiation forms thymine dimers that create kink in DNA structure Kink can disrupt DNA replication can lead to mutations chemicals cig smoke contains many chemical mutagens that can cans mutations in DNA of c. Describe specific examples (fromlung cells class) of one tumor suppressor gene and one oncogene, and explain how the normal form of each gene changes to contribute to cancer (is the mutation loss-of-function or gain-of-function, and what is the effect of that mutation on protein and on the pathway?). checkpoints when issues tumor suppressor p53 stops cells lossafion oncogene ras gain of function growthstops when cell hagrow promotes cell normally protooncogene Part B. Topics/Questions to study to help you prepare for the multiple choice questions. There will be approximately 30-35 multiple choice questions, and each of the points below will be addressed in some way in these questions. Additionally, some of the short answer questions listed above may be converted into multiple choice questions. 1. What is the relationship between which cells contain genes (the DNA), and which cells express genes (i.e. where RNA or protein is made)? Put another way: Do you find the same DNA in all cells? Do you find the same RNA or protein in all cells? Yes igia.EPT.fraenxor 2. Is the genetic material DNA in all cases? What is an exception? No viruses have RNA as genetic material 3. What is the Central Dogma and which processes are involved? DNAtrans.fi NAIaProtein 4. Describe solutions to DNA packaging within cells: how is bacterial DNA packaged as compared/contrasted to eukaryotic DNA? Know key terminology: chromatin, nucleosomes, supercoiling, histones. 5. Replication: what are the similarities and key differences between replication in bacteria, eukaryotes, and in vitro (PCR)? Key terminology: primer, leading and lagging strand, NA gyrase nucleosome creation, helicase, gyrase, DNA polymerase (specific names in E. coli and supercoilsPCR), origin of replication. ghee tappletiete Feature Bacteria Eukaryotes PCR ension Primers RNA RNA NA Leading Lagging strand Yes Yes NA poisomerase  111 Yes yes denaturation by heal enermes found DNApolymerase 111 Taq polymerase 8 and iffier Nucleosome None DNA Yes None it'Enture Gyrgfisomerase Topoisomerase None gyrase 11 origin of Replication single multiple defined by primers 6. Describe the mechanisms used by bacteria to exchange genetic information (conjugation, transformation, transduction) and what happens during each. 7. Know the basic biology of bacteriophages, the viruses that infect bacteria, including the main aspects of their life cycle and how they exchange genetic information. Key terminology: lytic, lysogenic/lysogeny. lytic explodes into bacteria inserts its own DNA lysogenic phage goes replicates w other DNA Physteria 8. Describe how agarose gel electrophoresis works (used in lab to view DNA) - what determines how far the DNA will travel in the gel? DNA samples are placed in wells 1 end of gel electric current is applied making DNAC charge move towards positiveend of gel makes Shorter fragments travel fastergofarther P.IT instituferffe that 9. Describe similarities and differences between transcription and replication. similarities differences replication transcription purpostorGateauget copy ofPutftp.totfeipustynthts PenthplletoPYodulesfewme use complementary basepairing product 2 identicalDNA me single RNA me use enzymes to cameoutprocesses that jfjetpheeesis.ee Eddie ftp.EEhg.to 10. Transcription: what are the similarities and key differences between transcription in bacteria and eukaryotes? Key terminology: promoter, sigma factor, transcription factors, rho termination protein, RNA polymerases (how many in each?), polarity (5' and 3' ends of nucleic acids). 11. Be able to write the RNA sequence (with correct 5’/3’ notation) after transcription if given a DNA template strand, or vice versa: write a DNA template with 5’/3’ notation if given an RNA molecule. In what direction does new synthesis occur? 3 AT GC 5 template opposite nontemplate 5 TAC G 3 I RNA 5 UACG 3  12. The Genetic Code: Know the key characteristics of the genetic code and how to use it to determine amino acids from mRNA sequence. Key terminology: degenerate, universal, non- overlapping, unambiguous, codon, amino acid. encoded by more than 1 codon degenerate most a are a universal geneticcode is the same in all organisms nonoverlapping ahoisetidfeaainonetheapher.ua party outer other Yapping unambiguous each codon specifies only 1 a a 13. How is gene expression regulated in eukaryotes? bacteria? At what level(s) does gene expression most often occur in each? eukaryotes bacteria transcriptional regulation transit.ph nfifrs proteins thathelp turn to primarily regulated here specificgenes on off by binding DNA enhancerssilencers DNA sequences that involves repressors activators or to transcription rates that bind to operator regions Esplicinngessremoving intronsjoining extrons of DNA to either inhibit promote 14. Epigenetics: know the definition of epigenetics and the types of regulators that affect epigenetic phenotypes. Does epigenetic regulation involve changing the DNA sequence? Does DNA methylation result in increased or decreased gene expression? Key terminology: DNA methylation, X-chromosome inactivation. epigenetics studiessequencer genes are turned on off w o changing actual DNA methylation methyl groups are addedturn off genes gene expression x chromosome inactivation in females where 1 X chromosome is turned off 15. Sex determination: explain how sex is determined in mammals (including the key gene) and how sex is determined in fruit flies. mammals fruit flies ratio of chromosomes to set of autosomes T.EE enEevelopmsEnt9hteste xx female 16. Chromosome mutations: describe the four types of chromosome rearrangements and which type most often leads to the evolution of new gene families (ex. globin gene family). 17. DNA Mutations: explain the difference between the many types of mutations we studied (missense, nonsense, silent, frameshift, loss-of-function, gain-of-function), and how each affects amino acids. missense single nucleotide change that results in diff a a being protein incinerated into Ehes nonsense single nucleotide change that converts an A TC a a codon into a stop codon ex 5 AGTC 3 40 ALOTC prhfsilesiendemfeatt.io leucine not alter a a sequen AA of protein stop frameshift insertiondeletion of nucleotides loss of function result in proton w reduced or gentgeading mutthane IFLeticcode 11in favevarioustypes of mutations missense nonsense frameshift 18. Do mutations occur in a random way (by chance), or in order to confer a selective advantage to an organism? What some environmental factors that induce mutations? During which cellular process do most mutations arise? environmental factors DNAreplication randomly UVradiation chemicals virusescan integrateDNAintohostcells 19. Cancer: Define and contrast proto-oncogenes, oncogenes, and tumor suppressors. How do these groups of genes normally regulate the cell cycle and how are they altered to promote cancer? Describe the specific examples emphasized in class. Key terminology: cell-cycle checkpoint, apoptosis. b4replical Protoone Itamar etphtntpf.si refar9thsdigisnion a'he fffintmito5 IS oncogene mutatedoverexpressedversions orproto oncogenes apoptosis programmed cell death drives cancerous growthby promoting cell division eliminating damaged unnecessary cell tumor suppressors inhibitcell divisionprevent uncontrolled cell 914thbrakes on a car 20. List the social impacts of the human genome project. privacyethics how to protect people's privacy concerns abt discrimination genetic testing broughtup personalizedmedicine 21. Describe the stages of meiosis. How is meiosis I different from meiosis II? Which events happen in meiosis I? Meiosis II? AI Products Off prophase mJaphase I anaphase I telophase I g x 22. Describe each of Mendel’s main principles (dominance, segregation, and independent gifted assortment). Explain how meiotic processes lead to two of those principles. Do those events occur during meiosis I or meiosis II? Key terminology: homologous and non-homologous chromosomes. independent assortmentgenes for diff traits dominance sometraitsdominant mask the are preseere.ae others EEshEn Ephernaited recessive Eaiiqteni.EEmnhmEh segregationeach organism has 2 alleles metaphase I for each trait whichseparateduring formation 23. Be able to deduce the mode of inheritance for a trait by examining a pedigree, including X- linked dominant/recessive, Y-linked, autosomal dominant/recessive, and mitochondrial. X linked recessive common in males to daughter whopas Fodonstompass trait to sons pass it it X linkeddominant affects women more pass to daughters not sons 24. Describe how epistasis leads to different ABO blood types depending on the genotype at both the H/h locus and the IA/IB/i locus. Be able to solve problems using this example without being given the definitions of these genotypes and phenotypes. IA IA or Iti Type A IAIA HH TypeA IB IB IB i Type B It peot IAIBInk or ftp.t AB I IB hh Type O ii type 0  25. Explain the relationship between gene distance and crossing over. Key terminology: recombination frequency, map distance, crossing over, % recombination. mange distance measure or the distance 18stSep.EE mmg ipofnggiE map between genes on a chromosome based on recombination frequency recombination frequency measures likelihood of crossing over occurring between 2 genes Sansettasenetsetierh.IEoinisFareTmipndi 26. Explain what gene conservation across species means. What exactly is conserved about the gene? yoygeygtgnfreesen.to genesthat remain unchanged across diff species throughout evolution gene what's conserved actual DNA sequence of gene is similar identical acrossspecies Function of the gene 27. Describe the CRISPR-Cas9 system. What is the function of CRISPR in bacterial cells? You will also be given an opportunity to state one thing you learned in the class but was not asked in the exam. Bacteria Eukaryotic DNA is located in nucleoid DNA is packedinto chromatin includes pellet bacterial DNA undergo supercoiling chromatin is made DNA helix twistsupon itself Of compacts DNAinto manageable size 9se mmñts of DNA wound around a core of histone proteins histones proteins that help in packaging of DNA nucleosomes further foldcoil to fo more compact structures resulting in highly conden chromosomes  bacteria eukaryotes similarities promoter regions that signal promoter 10and 35 TATA box start of transcription initiation factors sigma mantillription ssymeizeptp.tk eprohYmea factor factors 895 53 end of RNA Byterase single RNA pol 1,11 111 termination rho protein cleavage deletion part of chromosome is lostdeleted HHH t.tt i duplication inversion segment of chromosome fairground and reattach aagfin.pt ranatg4mutated breakest ogsequence TAACT GCAGGT chromo inversion TAA ACTGGT translocation segment PEEone not flipped around centromere off of 1 chromosome breaks and attaches to another peri reciprocal centromere around centromere onreciprocal toµ to g It 9 11 p Q EE E R E EE H Hgment W H two chromosomes from 1 chromosome exchange s transferred to another