BIOL10221 2024 Molecular Biology Lecture Notes (Effects of Mutations) PDF

BIOL10221 Molecular Biology Module 9 - Lecture 1: Effects of mutations I Ray O’Keefe [email protected] What will we cover? Effects of mutations on the information content of a gene Point, insertion, deletion, frameshift and readthrough mutations Mutations foun...

BIOL10221 Molecular Biology Module 9 - Lecture 1: Effects of mutations I Ray O’Keefe [email protected] What will we cover? Effects of mutations on the information content of a gene Point, insertion, deletion, frameshift and readthrough mutations Mutations found in Cystic Fibrosis to illustrate effects on synthesis/activity of a gene product Why is it important? Mutations are important during evolution and for diversity of organisms However, some mutations may cause disease BIOL10221 Module 9 - Lecture 1 2 Point mutation One base pair is replaced with another Transition purine to purine (AG) or pyrimidine to pyrimidine (TC) Transversion purine to pyrimidine or vice versa (A or G  T or C) BIOL10221 Module 9 - Lecture 3 1 Insertion mutation One or more base pairs are inserted BIOL10221 Module 9 - Lecture 4 1 Deletion mutation One or more base pairs are deleted BIOL10221 Module 9 - Lecture 5 1 Inversion mutation Two or more base pairs are excised and reinserted in the opposite orientation BIOL10221 Module 9 - Lecture 6 1  Effects of point mutations on genes RNA AUGGGAGCUCUAUUAACCUAA RNA AUGGGAGCUCUAUUGACCUAA BIOL10221 Module 9 - Lecture 7 1 BIOL10221 Module 9 - Lecture 8 1  Effects of point mutations on genes Synonymous mutation – no effect on the amino acid sequence Also called a silent mutation though silent mutations also include those in intergenic regions RNA AUGGGAGCUCUAUUAACCUAA RNA AUGGGAGCUCUAUUGACCUAA BIOL10221 Module 9 - Lecture Leu 9 1 BIOL10221 Module 9 - Lecture 10 1  Effects of point mutations on genes RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGAGAGCUCUAUUAACCUAA BIOL10221 Module 9 - Lecture 11 1 BIOL10221 Module 9 - Lecture 12 1  Effects of point mutations on genes Non-synonymous mutation – changes the amino acid sequence Also called a missense mutation RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGAGAGCUCUAUUAACCUAA Arg BIOL10221 Module 9 - Lecture 13  Effects of point mutations on genes RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGGGAGCUCUAUGAACCUAA BIOL10221 Module 9 - Lecture 14 1 BIOL10221 Module 9 - Lecture 15 1  Effects of point mutations on genes Nonsense mutation – changes a codon for an amino acid into a stop codon RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGGGAGCUCUAUGAACCUAA BIOL10221 Module 9 - Lecture 16 1  Effects of point mutations on genes RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGGGAGCUCUAUUAACCUUA BIOL10221 Module 9 - Lecture 17 1 BIOL10221 Module 9 - Lecture 18 1  Effects of point mutations on genes Readthrough mutation – changes a stop codon to a codon for an amino acid RNA AUGGGAGCUCUAUUAACCUAA Mutated sequence RNA AUGGGAGCUCUAUGAACCUUA BIOL10221 Module 9 - Lecture 19 1  Effects of insertions and deletions on genes Frameshift mutations – change the reading frame All codons downstream of the mutation are changed RNA AUGGGAGCUCUAUUAACCUAA A AUGGGGAGCUCUAUUAACCUAAUUUGA AUGGGGCUCUAUUAA BIOL10221 Module 9 - Lecture 20 1 Reversing the effect of a mutation (Suppressive mutations) In second site reversion a second mutation restores the correct amino acid sequence, though the nucleotide sequence is still altered UUA UUU CUU BIOL10221 Module 9 - Lecture 21 1 BIOL10221 Module 9 - Lecture 22 1 Monogenic Disorders Inherited diseases caused by defects in individual genes How many known Monogenic Disorders? About 6000 known – 10,000 estimated in total One of the most common Monogenic Disorders in UK? Cystic Fibrosis BIOL10221 Module 9 - Lecture 23 1  Effects of mutations on the cystic fibrosis gene human chromosome 7 The cystic fibrosis transmembrane regulator (CFTR) gene The normal gene directs synthesis of the CFTR protein CFTR protein is a chloride channel on the cell surface Mutation in CFTR causes and is responsible for proper a dysfunction of the salt balance of salt and water and water balance leading within a cell and outside the to thick mucous and cell excessive loss of salt in the sweat BIOL10221 Module 9 - Lecture 24 1  Effects of mutations on the cystic fibrosis gene Loss of function – recessive disorder – need mutations in both copies/alleles of the gene Carriers – mutation in only one copy/allele of the gene Commonest mutation in UK patients is called F508 or F508del (68% of cases) Deletion () of three nucleotides Removes a codon for phenylalanine (F) This is the 508th amino acid in the polypeptide (1480 amino acids in total) Ile Ile Phe Gly Val NORMAL …AUC AUC UUU GGU GUU… F508 …AUC AUU GGU GUU… Ile Ile Gly Val The CFTR protein is still made but does not get to the cell surface/membrane BIOL10221 Module 9 - Lecture 25 1 BIOL10221 Module 9 - Lecture 26 1 Effects of mutations on the cystic fibrosis gene Next commonest mutation is G542X (2.5% of cases) Nonsense mutation Changes a glycine (G) at position 542 to a stop codon (X) Gly NORMAL …GUU CUU GGA GAA GGU… G542X …GUU CUU UGA GAA GGU… Stop The CFTR protein is not made the abnormal position of the stop codon causes the mRNA to be degraded BIOL10221 Module 9 - Lecture 27 1 BIOL10221 Module 9 - Lecture 28 1 Effects of mutations on the cystic fibrosis gene Third commonest mutation is G551D (1.5% of cases) Non-synonymous point mutation (Missense mutation) Changes a glycine (G) at position 551 to an aspartic acid (D) Gly NORMAL …GGC… G551D …GAC… Asp The CFTR protein is made and gets to the cell surface but works at only 4% of the normal rate BIOL10221 Module 9 - Lecture 29 1 BIOL10221 Module 9 - Lecture 30 1  Treatment for Cystic Fibrosis Orkambi is made up of Ivacaftor and Lumacaftor. The treatment has been shown to be effective in people with CF with two copies (homozygous) of the F508del mutation. https://www.orkambihcp.com/mechanism-of-action BIOL10221 Module 9 - Lecture 31 1 Resources Reading BROWN, Chapter 16 pages 313–315, 331–332, 335 ALBERTS (6th ed) pages 308-312 Blackboard PDF files with Objectives, Terms, Questions and Answers Further Study Module Mutations and Human Disease BIOL10221 Module 9 - Lecture 32 1  BIOL10221 Molecular Biology Module 9 - Lecture 1: Effects of mutations I Ray O’Keefe [email protected]