Podcast
Questions and Answers
Aneuploidy refers to the presence of extra copies or missing individual chromosomes.
Aneuploidy refers to the presence of extra copies or missing individual chromosomes.
True
Translocations involve the exchange of DNA between two identical chromosomes.
Translocations involve the exchange of DNA between two identical chromosomes.
False
Copy number variants are always pathogenic and lead to severe clinical issues.
Copy number variants are always pathogenic and lead to severe clinical issues.
False
Microsatellites are short repeat units in DNA that can vary between individuals.
Microsatellites are short repeat units in DNA that can vary between individuals.
Signup and view all the answers
Single nucleotide polymorphisms refer to changes in the entire DNA sequence.
Single nucleotide polymorphisms refer to changes in the entire DNA sequence.
Signup and view all the answers
The incidence of aneuploidy is approximately 1 in 100 newborns.
The incidence of aneuploidy is approximately 1 in 100 newborns.
Signup and view all the answers
Missense mutations result in the same amino acid being produced.
Missense mutations result in the same amino acid being produced.
Signup and view all the answers
Incidence of translocations is around 1 in 500 newborns.
Incidence of translocations is around 1 in 500 newborns.
Signup and view all the answers
Individuals typically carry around 10,000 microsatellites in their genomes.
Individuals typically carry around 10,000 microsatellites in their genomes.
Signup and view all the answers
Genomic instability allows for faster evolution of cancer cells.
Genomic instability allows for faster evolution of cancer cells.
Signup and view all the answers
Different cancers arise from the same tissue type.
Different cancers arise from the same tissue type.
Signup and view all the answers
Nonsense mutations introduce a stop codon, leading to protein truncation.
Nonsense mutations introduce a stop codon, leading to protein truncation.
Signup and view all the answers
Cancer is exclusively a germline mutation.
Cancer is exclusively a germline mutation.
Signup and view all the answers
Humans share approximately 99.9% of their DNA bases when comparing two genomes.
Humans share approximately 99.9% of their DNA bases when comparing two genomes.
Signup and view all the answers
The evolutionary purpose of sex in humans is to ensure complete genetic uniformity.
The evolutionary purpose of sex in humans is to ensure complete genetic uniformity.
Signup and view all the answers
Germ-line genetic variation includes both large scale and small scale variations.
Germ-line genetic variation includes both large scale and small scale variations.
Signup and view all the answers
Pathogenic mutations can include changes that alter gene expression.
Pathogenic mutations can include changes that alter gene expression.
Signup and view all the answers
Different responses to environmental stresses can arise due to genetic variations.
Different responses to environmental stresses can arise due to genetic variations.
Signup and view all the answers
Sickle Cell Anemia provides a disadvantage in malaria-prone regions.
Sickle Cell Anemia provides a disadvantage in malaria-prone regions.
Signup and view all the answers
Pharmacogenetics studies the different responses to pharmacological agents based on genetic makeup.
Pharmacogenetics studies the different responses to pharmacological agents based on genetic makeup.
Signup and view all the answers
Translocations are a type of small scale germ-line genetic variation.
Translocations are a type of small scale germ-line genetic variation.
Signup and view all the answers
We all carry approximately 20,000 SNPs in our genomes.
We all carry approximately 20,000 SNPs in our genomes.
Signup and view all the answers
The majority of mutations occur outside of genes.
The majority of mutations occur outside of genes.
Signup and view all the answers
Small-scale pathogenic variation leads to gross changes in gene expression.
Small-scale pathogenic variation leads to gross changes in gene expression.
Signup and view all the answers
Pathogenic mutations can lead to premature stop of translation.
Pathogenic mutations can lead to premature stop of translation.
Signup and view all the answers
The CFTR delta-508 mutation is an example of a small-scale pathogenic deletion.
The CFTR delta-508 mutation is an example of a small-scale pathogenic deletion.
Signup and view all the answers
Most SNPs are known to cause disease.
Most SNPs are known to cause disease.
Signup and view all the answers
SNPs can occur as small sections of DNA that differ between individuals.
SNPs can occur as small sections of DNA that differ between individuals.
Signup and view all the answers
Large-scale pathogenic variation does not affect gene expression.
Large-scale pathogenic variation does not affect gene expression.
Signup and view all the answers
Nonsense mutations result in the introduction of a stop codon.
Nonsense mutations result in the introduction of a stop codon.
Signup and view all the answers
Different clones of cancer cells can respond differently to pharmacological agents.
Different clones of cancer cells can respond differently to pharmacological agents.
Signup and view all the answers
Genomic stability in cancer cells is crucial for their rapid growth and metastasis.
Genomic stability in cancer cells is crucial for their rapid growth and metastasis.
Signup and view all the answers
Cancer is uniformly caused by germline mutations in all cases.
Cancer is uniformly caused by germline mutations in all cases.
Signup and view all the answers
Large-scale chromosomal rearrangements do not affect the evolution of cancer cells.
Large-scale chromosomal rearrangements do not affect the evolution of cancer cells.
Signup and view all the answers
Copy number variants (CNVs) are typically smaller than 1000 base-pairs in size.
Copy number variants (CNVs) are typically smaller than 1000 base-pairs in size.
Signup and view all the answers
Aneuploidy includes both viable and non-viable conditions caused by extra or missing chromosomes.
Aneuploidy includes both viable and non-viable conditions caused by extra or missing chromosomes.
Signup and view all the answers
Translocation events during meiosis have no impact on gene sequence and structure.
Translocation events during meiosis have no impact on gene sequence and structure.
Signup and view all the answers
The presence of microsatellites is common in human genomes, with approximately 10,000 per individual.
The presence of microsatellites is common in human genomes, with approximately 10,000 per individual.
Signup and view all the answers
Single nucleotide polymorphisms (SNPs) represent changes in multiple base pairs across the DNA.
Single nucleotide polymorphisms (SNPs) represent changes in multiple base pairs across the DNA.
Signup and view all the answers
The incidence of aneuploidy is approximately 1 in 100 newborns.
The incidence of aneuploidy is approximately 1 in 100 newborns.
Signup and view all the answers
Most copy number variants (CNVs) are benign, while larger ones tend to be pathogenic.
Most copy number variants (CNVs) are benign, while larger ones tend to be pathogenic.
Signup and view all the answers
The presence of a nonsense mutation guarantees a complete and functional protein product.
The presence of a nonsense mutation guarantees a complete and functional protein product.
Signup and view all the answers
The evolutionary purpose of sexual reproduction in humans is to maintain genetic uniformity.
The evolutionary purpose of sexual reproduction in humans is to maintain genetic uniformity.
Signup and view all the answers
Pathogenic mutations may result in premature stop codons that truncate proteins.
Pathogenic mutations may result in premature stop codons that truncate proteins.
Signup and view all the answers
Large-scale genetic variations in the human genome include translocations and copy number variants.
Large-scale genetic variations in the human genome include translocations and copy number variants.
Signup and view all the answers
Individuals respond to diseases in the same way due to genetic uniformity.
Individuals respond to diseases in the same way due to genetic uniformity.
Signup and view all the answers
Copy number variants are always beneficial and do not lead to any clinical issues.
Copy number variants are always beneficial and do not lead to any clinical issues.
Signup and view all the answers
Pharmacogenetics explores how genetic differences affect individuals' responses to medications.
Pharmacogenetics explores how genetic differences affect individuals' responses to medications.
Signup and view all the answers
Small-scale germ-line genetic variations include SNPs and can have significant effects on phenotype.
Small-scale germ-line genetic variations include SNPs and can have significant effects on phenotype.
Signup and view all the answers
The majority of human DNA bases are identical when comparing two genomes.
The majority of human DNA bases are identical when comparing two genomes.
Signup and view all the answers
Most SNPs are benign or have a very small effect on disease.
Most SNPs are benign or have a very small effect on disease.
Signup and view all the answers
Small-scale pathogenic variations cause extensive rearrangements across multiple genes.
Small-scale pathogenic variations cause extensive rearrangements across multiple genes.
Signup and view all the answers
Pathogenic mutations can lead to changes in the amino acid sequence of proteins.
Pathogenic mutations can lead to changes in the amino acid sequence of proteins.
Signup and view all the answers
About 98% of genetic mutations occur within genes.
About 98% of genetic mutations occur within genes.
Signup and view all the answers
A nonsense mutation introduces a stop codon leading to the full protein being produced.
A nonsense mutation introduces a stop codon leading to the full protein being produced.
Signup and view all the answers
The majority of pathogenic mutations alter gene function negatively.
The majority of pathogenic mutations alter gene function negatively.
Signup and view all the answers
The CFTR delta-508 mutation does not affect the protein's ability to function properly.
The CFTR delta-508 mutation does not affect the protein's ability to function properly.
Signup and view all the answers
Common pathogenic variations caused by CNVs and translocations result in gross alterations in gene expression.
Common pathogenic variations caused by CNVs and translocations result in gross alterations in gene expression.
Signup and view all the answers
The evolutionary purpose of sexual reproduction is to maintain genetic uniformity within a population.
The evolutionary purpose of sexual reproduction is to maintain genetic uniformity within a population.
Signup and view all the answers
Germline genetic variation only consists of large-scale changes in the human genome.
Germline genetic variation only consists of large-scale changes in the human genome.
Signup and view all the answers
Individuals exhibit identical responses to environmental stresses due to genetic uniformity.
Individuals exhibit identical responses to environmental stresses due to genetic uniformity.
Signup and view all the answers
Different haplotypes can lead to varied immune responses in individuals.
Different haplotypes can lead to varied immune responses in individuals.
Signup and view all the answers
Pathogenic mutations can include alterations in gene expression that do not lead to any deleterious effects.
Pathogenic mutations can include alterations in gene expression that do not lead to any deleterious effects.
Signup and view all the answers
The occurrence of copy number variants (CNVs) is always linked to severe clinical issues.
The occurrence of copy number variants (CNVs) is always linked to severe clinical issues.
Signup and view all the answers
Large-scale copy number variants can sometimes exceed one million base-pairs in size and may be pathogenic.
Large-scale copy number variants can sometimes exceed one million base-pairs in size and may be pathogenic.
Signup and view all the answers
Translocations in chromosomes do not alter the sequence or structure of the DNA.
Translocations in chromosomes do not alter the sequence or structure of the DNA.
Signup and view all the answers
All incidences of aneuploidy have the same clinical consequences regardless of the chromosome involved.
All incidences of aneuploidy have the same clinical consequences regardless of the chromosome involved.
Signup and view all the answers
Microsatellites are always disease-causing variations found in DNA sequences.
Microsatellites are always disease-causing variations found in DNA sequences.
Signup and view all the answers
Approximately 0.1% of DNA bases differ between any two human genomes.
Approximately 0.1% of DNA bases differ between any two human genomes.
Signup and view all the answers
Translocations during meiosis involve the exchange of DNA between homologous chromosomes.
Translocations during meiosis involve the exchange of DNA between homologous chromosomes.
Signup and view all the answers
Viable monosomy can occur when one chromosome is missing, such as in Turner Syndrome.
Viable monosomy can occur when one chromosome is missing, such as in Turner Syndrome.
Signup and view all the answers
Single nucleotide polymorphisms (SNPs) involve changes affecting multiple base-pairs in the DNA.
Single nucleotide polymorphisms (SNPs) involve changes affecting multiple base-pairs in the DNA.
Signup and view all the answers
The incidence of viable translocations in newborns is about 1 in 500.
The incidence of viable translocations in newborns is about 1 in 500.
Signup and view all the answers
Aneuploidy is commonly observed in the general population at a rate of approximately 1 in 10 newborns.
Aneuploidy is commonly observed in the general population at a rate of approximately 1 in 10 newborns.
Signup and view all the answers
Genomic instability in cancer cells allows for the bypassing of safety mechanisms and rapid cell division.
Genomic instability in cancer cells allows for the bypassing of safety mechanisms and rapid cell division.
Signup and view all the answers
Somatic mutations are inherited and affect all the cells in an organism.
Somatic mutations are inherited and affect all the cells in an organism.
Signup and view all the answers
SNPs are caused by changes in multiple base pairs of DNA.
SNPs are caused by changes in multiple base pairs of DNA.
Signup and view all the answers
The majority of pathogenic mutations occur within coding regions of genes.
The majority of pathogenic mutations occur within coding regions of genes.
Signup and view all the answers
Different clones of cancer cells often show uniform sensitivity to pharmacological agents.
Different clones of cancer cells often show uniform sensitivity to pharmacological agents.
Signup and view all the answers
Nonsense mutations introduce stop codons that can lead to shortened protein products.
Nonsense mutations introduce stop codons that can lead to shortened protein products.
Signup and view all the answers
Large-scale pathogenic variations can result in significant changes in gene expression across multiple genes.
Large-scale pathogenic variations can result in significant changes in gene expression across multiple genes.
Signup and view all the answers
Genomic instability leads to the elimination of chromosomal rearrangements in cancer.
Genomic instability leads to the elimination of chromosomal rearrangements in cancer.
Signup and view all the answers
Small-scale pathogenic mutations can result in the introduction of stop codons, leading to truncated proteins.
Small-scale pathogenic mutations can result in the introduction of stop codons, leading to truncated proteins.
Signup and view all the answers
Individuals typically have around 3.5 million SNPs in their genome.
Individuals typically have around 3.5 million SNPs in their genome.
Signup and view all the answers
Copy number variants (CNVs) are always beneficial and do not lead to any adverse clinical effects.
Copy number variants (CNVs) are always beneficial and do not lead to any adverse clinical effects.
Signup and view all the answers
Rearrangements due to pathogenic mutations can happen through mechanisms such as translocations or inversions.
Rearrangements due to pathogenic mutations can happen through mechanisms such as translocations or inversions.
Signup and view all the answers
The CFTR delta-508 mutation is an example of a small-scale pathogenic insertion.
The CFTR delta-508 mutation is an example of a small-scale pathogenic insertion.
Signup and view all the answers
Study Notes
Genetic Variation
- Genetic variation exists in all individuals, with approximately 0.1% variation in our genome.
- Sexual reproduction plays a role in introducing genetic differences amongst species.
- Genetic variation enables adaptations to new environments and protection against disease.
Large Scale Variation
-
Aneuploidy: Involves an extra copy or missing chromosome.
- Example: Trisomy 21 (Down Syndrome)
- Incidence: Rare, approximately 1 in 1000 newborns
- Impact: Affects gene expression, leading to clinical consequences like learning disability and developmental delays.
- Other viable trisomies include 13 (Patau Syndrome), 18 (Edwards Syndrome), and XXY (Kleinefelters).
- Viable monosomy (X - Turner) is also a form of aneuploidy.
-
Translocations/Transversions: Exchange of DNA segments between different chromosomes during meiosis.
- Incidence: Approximately 1 in 500 newborns.
- Impact: Clinical relevance depends on the event – is there a net gain or loss of DNA? Is gene sequence disrupted? Are there issues with gametogenesis (meiosis)?
-
Copy Number Variants (CNVs): Deletions or duplications of DNA larger than 1000 base pairs.
- Incidence: Present in all humans, and most are benign.
- Impact: Larger CNVs (>1 million base pairs) can be pathogenic, leading to learning disability, autism, epilepsy, and other conditions.
Small Scale Variation
-
Microsatellites: Short repeat units of DNA (2-5 base-pairs)
- Incidence: We all carry around 10,000 microsatellites.
- Impact: Rarely disease-causing, with most being benign.
-
Single Nucleotide Polymorphisms (SNPs): Single base-pair differences in DNA.
- Incidence: We all carry approximately 3.5 million SNPs.
- Impact: Most are benign or have a small effect on disease, but rare cases can have strong or disease-causing effects.
-
Insertions/Deletions: Small sections of missing or additional DNA (one or a few base pairs)
- Incidence: Found in all humans, approximately 20,000 in our genomes.
- Impact: Rarely disease-causing, and most are benign. Can be damaging if they occur in exons (protein-coding regions).
Genetic Mutations
- Mutations are typically found outside of genes (98% of the genome).
- Pathogenic mutations alter gene function.
- They can:
- Knock out or enhance copy number of a gene (CNV)
- Rearrange multiple genes (transversion/translocation)
- Change the amino acid sequence (non-synonymous mutation)
- Lead to premature protein termination (non-sense mutation)
- Alter splicing (splice-site mutation)
Large Scale Pathogenic Mutations
- Large-scale pathogenic variation (ploidy, translocations, CNVs) affects gene expression by altering protein levels from multiple genes.
- Example: Trisomy 21 (Down syndrome) and its impact on gene expression.
Small Scale Pathogenic Mutations
- Small-scale pathogenic variation results in:
- Changes in amino acid sequence.
- Exon skipping or introduction (aberrant splicing).
- Premature termination of protein translation.
- Example: CFTR delta-508 (deletion of a single amino acid - phenylalanine) leads to a protein that cannot leave the endoplasmic reticulum for processing.
Genetic Code and Mutations
- Genetic code is vital in interpreting small-scale coding variation.
- Mutations can be:
- Silent/synonymous: Same amino acid.
- Missense/non-synonymous: Different amino acid.
- Nonsense/stop: A stop codon is introduced.
- Frameshift: Caused by insertions or deletions, leading to a shift in the reading frame.
Genetic Variation in Cancer
- Cancer is characterized by "genomic instability."
- Cancer develops due to genetic changes, and the disease itself also causes further genetic changes.
- Genomic instability facilitates rapid cancer cell evolution, allowing for:
- Persistent genomic instability.
- Bypassing of safety mechanisms.
- Rapid cell growth and division.
- Metastasis.
Cancer Cell Variation
- Genomic instability results in large scale deletions and amplifications, chromosomal rearrangements, and epigenetic changes.
- It allows for faster evolution of cancerous cells.
Cancer and Diversity
- Cancer is not a single disease, and different cancers arise from various tissues.
- Within a single cancer, there are often multiple cell clones, each with unique characteristics.
- Some clones might be susceptible to one treatment but resistant to another.
- Genetic characterization of cancers is a growing field:
- Specific genes (BCR-Abl, HER2, etc.).
- Tumor profiling.
Further Reading
- Human Molecular Genetics (Strachan & Read), 4th edition, Chapter 13.
- Meisenberg & Simmons 4th ed, Chapter 7, p117-8.
Large-Scale Genetic Variation
-
Aneuploidy: One or more chromosomes are present in an extra copy or are missing.
- Example: Trisomy 21 (Down syndrome) - an extra copy of chromosome 21.
- Incidence: Rare, approximately 1 in 1000 newborns.
- Clinical Relevance: Usually causes significant changes in gene expression, leading to clinical consequences such as learning disabilities and developmental delays.
- Other Viable Trisomies: Trisomy 13 (Patau Syndrome), Trisomy 18 (Edwards Syndrome), XXY (Klinefelter's Syndrome).
- Viable Monosomy: X (Turner Syndrome).
-
Translocations/Transversions: Exchange of DNA during meiosis, between two different chromosomes.
- Incidence: Approximately 1 in 500 newborns.
-
Clinical Relevance: Depends on the event. Factors considered include:
- Net gain or loss of DNA.
- Disruption of gene sequence.
- Issues arising in gametogenesis (meiosis).
-
Copy Number Variants (CNVs): Deletions or duplications of DNA sections larger than 1000 base pairs. They can be several million base pairs in size.
- Incidence: Everyone carries multiple CNVs in their genome.
- Clinical Relevance: Most are benign. Larger CNVs (greater than 1 million base pairs) tend to be pathogenic, associated with conditions like learning disabilities, autism, and epilepsy.
Small-Scale Genetic Variation
-
Microsatellites: Short (2-5bp) repeat units within DNA sequences.
- Example: 5' - CCGTGCATGCATGCATGCATGCACC - 3' can be represented as 5' - CCG(TGCA)5CC - 3' with the number of copies varying between individuals.
- Incidence: Common in the human genome, with approximately 10,000 microsatellites per individual.
- Clinical Relevance: Rarely disease-causing. Vast majority are benign.
-
Single Nucleotide Polymorphisms (SNPs): A single base-pair change in the DNA sequence.
- Example: 5' - CGTACGATGACCCA/TAGCTAGCCCTA - 3'
- Incidence: We all carry around 3.5 million SNPs.
- Clinical Relevance: Similar to microsatellites, most are benign or have a very small effect on disease. However, in rare cases, they can be strongly linked to disease.
-
Insertions/Deletions: Small sections of DNA (one or a few base-pairs) that are present in some individuals but not in others.
- Example: 5' - CGTAC[G]ATGACCCTAGCTAGCCCTA - 3'
- Incidence: Common, with approximately 20,000 instances per individual.
- Clinical Relevance: Rarely disease-causing; vast majority are benign. However, they can be damaging if they occur in exons.
Pathogenic Mutations
- The Majority of Mutations Do Not Cause Disease: They occur outside of genes (98% of the genome is not 'genic').
-
Pathogenic Mutations Alter Gene Function Deleteriously: They can:
- Knock-out or increase copy number of a gene (CNV).
- Rearrange multiple genes (transversions/translocations).
- Change the amino acid sequence (non-synonymous mutation).
- Lead to premature termination of translation (nonsense mutation).
- Alter splicing (splice-site mutation).
Large-Scale Pathogenic Mutations
- Result in:
- Gross changes in gene expression – protein levels from multiple different genes are altered.
- Example: Trisomy 21 & its impact on gene expression.
Small-Scale Pathogenic Mutations
- Result in:
- Changing of amino-acid sequence.
- Skipping or introduction of an exon (aberrant splicing).
- Premature stop to translation.
- Example: CFTR delta-508 (deletion of an amino acid - phenylalanine). Result is the protein can't leave the ER for further processing.
Genetic Code & Small-Scale Coding Variation
-
Genetic Mutations:
- Silent/Synonymous: The same amino acid is coded.
- Missense/Nonsynonymous: A different amino acid is coded.
- Nonsense/Stop: A stop codon is introduced, terminating translation.
- Frameshift: Resulting from an insertion or deletion, shifts the reading frame, altering the amino acid sequence.
Genetic Variation in Malignant Cells
-
Cancer Is Characterised by Genomic Instability: Genetic changes lead to cancer, and cancer causes genetic changes.
-
Genomic Instability in Cancer Cells Allows for Rapid "Evolution": Critical "driver" mutations enable:
- Persistence of genomic instability.
- Bypassing of safety mechanisms.
- Rapid growth and division of cells.
- Metastasis.
-
Genomic Instability in Cancer Cells Leads to:
- Large-scale deletions and amplifications.
- Chromosomal rearrangements.
- Epigenetic changes.
Cancer – A Heterogeneous Disease
- Different Cancers Arise From Different Tissues.
- Different ‘Clones’ of Cells Often Exist Within a Cancer. Some clones may respond to one pharmacological agent but not another.
-
Genetic Characterisation of Cancers is a Growing Field:
- Specific genes (BCR-Abl, HER2 etc).
- Tumour profiling.
Further Reading
- Human Molecular Genetics (Strachan & Read), 4th edition - Chapter 13
- Meisenberg & Simmons 4th ed, chapter 7 (p117-8)
Large Scale Genetic Variation
- Aneuploidy: One or more chromosomes present in an extra copy or missing.
- Examples: Trisomy 21 (Down syndrome), Trisomy 13 (Patau Syndrome), Trisomy 18 (Edwards Syndrome), XXY (Klinefelter's), Monosomy X (Turner)
- Incidence: Rare, approximately 1 in 1000 newborns
- Clinical Relevance: Often causes significant alterations in gene expression, resulting in clinical consequences like learning disabilities and developmental delays.
Translocations/Transversions
- Definition: Exchange of DNA during meiosis between two different chromosomes.
- Incidence: Approximately 1 in 500 newborns.
- Clinical Relevance: Outcomes depend on the specific event. Factors to consider include net gain or loss of DNA, gene sequence disruption, and impact on gametogenesis (meiosis).
Copy Number Variants (CNVs)
- Definition: Relatively large sections of DNA (>1000 base pairs) that are duplicated or deleted.
- Incidence: All individuals carry multiple CNVs in their genome.
- Clinical Relevance: Most are benign, but larger CNVs (> 1 million base pairs) can be pathogenic, leading to conditions like learning disabilities, autism, and epilepsy.
Small Scale Genetic Variation
Microsatellites
- Definition: Short (2-5 base pair) repeat units in a DNA sequence.
- Incidence: Common, with approximately 10,000 microsatellites in each individual's genome.
- Clinical Relevance: Rarely disease-causing; vast majority are benign.
Single Nucleotide Polymorphisms (SNPs)
- Definition: Single base-pair change in the DNA sequence.
- Incidence: Individuals carry around 3.5 million SNPs.
- Clinical Relevance: Similar to microsatellites, most are benign or have minimal effect on disease, but in rare cases, they can be significant and contribute to specific diseases.
Insertions/ Deletions
- Definition: Small sections of DNA (one or a limited number of base pairs) that are present in some individuals but not others.
- Incidence: Common, with approximately 20,000 in each individual's genome.
- Clinical Relevance: Rarely disease-causing; most are benign. Deletions occurring within exons can be damaging.
The Features of Pathogenic Mutations
- Definitions: Mutations that alter gene function deleteriously.
-
Effects:
- Knock-out or increase the copy number of a gene (CNV).
- Rearrange multiple genes (transversions/translocations).
- Change the amino acid sequence (non-synonymous mutations).
- Lead to premature stop of translation (nonsense mutations).
- Alter splicing (splice-site mutations).
The Features of Large-Scale Pathogenic Mutations
-
Effects:
- Gross changes in gene expression. This means changes in protein levels from several different genes are altered.
Features of Small-Scale Pathogenic Mutations
-
Effects:
- Changing of amino-acid sequence
- Skipping or introduction of an exon (aberrant splicing)
- Premature stop to translation
- Example: CFTR delta-508 (deletion of an amino acid - phenylalanine). This results in a protein that cannot leave the ER for further processing.
The Genetic Code
- The genetic code is crucial for interpreting small-scale coding variation.
-
Types of Genetic Mutations:
- Silent/Synonymous: Same amino acid.
- Missense/Non-synonymous: Different amino acid.
- Nonsense/Stop: Stop codon introduced.
- Frameshift: Caused by an insertion or deletion, alters the reading frame.
Genetic Variation in Malignant Cells (Cancer)
- Genomic Instability: Cancer is characterized by genomic instability, meaning genetic changes lead to cancer, and cancer itself causes further genetic changes.
-
Driver Mutations: Critical driver mutations allow:
- Genomic instability to persist.
- Safety mechanisms to be bypassed.
- Rapid growth and division of cells.
- Metastasis to occur.
Genomic Instability in Cancer Cells
-
Effects:
- Large-scale deletions and amplifications.
- Chromosomal rearrangements.
- Epigenetic changes.
Cancer as a Multifaceted Disease
- Different cancers arise from different tissues.
- Within a single cancer, multiple clones of cells may exist.
- Some clones might be sensitive to certain pharmacological agents, while others are not.
Cancer Genetic Characterization
- Specific genes are investigated (BCR-Abl, HER2, etc.).
- Tumor profiling is a growing field.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
Related Documents
Description
Explore the concepts of genetic variation and large-scale genetic anomalies such as aneuploidy and translocations. This quiz covers the implications of these variations, including their role in evolution and associated clinical consequences. Test your knowledge on genetic diversity and its impact on health.
