Human Genetic Variability & Its Consequences (FFP1 2022-23) PDF

Royal College of Surgeons in Ireland – Medical University of Bahrain Human genetic variability and its consequences Module : Foundations for Practice 1 FFP1 Class : Year 1 Semester 1 Lecturer : Paul O’Farrell Date : 11 October 2022...

Royal College of Surgeons in Ireland – Medical University of Bahrain Human genetic variability and its consequences Module : Foundations for Practice 1 FFP1 Class : Year 1 Semester 1 Lecturer : Paul O’Farrell Date : 11 October 2022 1 Learning objectives Describe the nature and extent of ‘large scale’ germ-line genetic variation (CNVs, translocations, issues of chromosome number) in the human genome Discuss the consequences of germline human genetic variation Describe the nature and extent of ‘small scale’ germ-line genetic variation (SNPs, microsatellites, insertions & deletions) in the human genome Describe the features of pathogenic mutations (i.e., non-synonymous, stop, frameshift, splice, gene expression altering etc.) Discuss the nature and extent of genetic variation in malignant cells. Differences between individual human genomes What do we see when we align - processor speed any two genomes? They will look identical at approx 99.9% of DNA bases Cost of sequencing an individual genome But they will also be 0.1% different.. What do those differences actually look like? Why are they there? We’re supposed to be different! Humans reproduce sexually It appears the evolutionary purpose of sex is to introduce genetic differences into the population This allows for evolution of new traits Allows the population to adapt to new environmental stresses Protects the population from being completely wiped out by disease “A theory of heredity, Darwin realized…was of pivotal importance….Heredity had to possess constancy and inconstancy, stability and mutation” Siddharta Mukherjee, The Gene: An Intimate History Other consequences of genetic variation Different response to environment – susceptibility to environmental stresses Different response of immune system to disease – Different haplotypes Implications for transplant – Host vs graft / graft vs host Different response to pharmacological agents (see Pharmacogenetics lecture) – “Personalized medicine” Some “disease genes” may have advantages in some conditions – SCA : Malaria – CF : Cholera? Pathology vs normal range of human variation? Table of genetic variation Large scale Aneuploidy One or more individual chromosomes in extra copy, or missing Translocations/transversions ‘Mixed’ chromosomes Copy number variants (CNVs) Relatively large sections of DNA duplicated or deleted Small scale Single nucleotide polymorphism Single base-pair difference (SNPs) microsatellites Repeated units of DNA Insertions & deletions One or two bases, duplicated or deleted Large scale – Aneuploidy Aneuploidy: one or more individual chromosomes are present in an extra copy, or are missing. Example here is trisomy of chromosome 21 (Down syndrome) Incidence: rare (approx 1:1000 newborns) Clinical relevance: Usually causes large- scale changes in gene expression with associated clinical consequences (e.g. learning disability, development delay) Other viable trisomy – 13 (Patau Syndrome) – 18 (Edwards Syndrome) – XXY (Kleinefelters) Viable monosomy (X – Turner) Large scale - Translocations/transversions Exchange of DNA during meiosis, between two different chromosomes Incidence: approx 1:500 newborns Clinical relevance: Depends on event. – Is there net gain or loss of DNA? – Is there disruption of gene sequence? Do issues arise in gametogenesis -meiosis? Large scale - Copy number variants Deletions or duplications of DNA of >1000 base-pairs in size. They can be several million bases in size Incidence: We all carry multiple copy number variants in our genome Clinical relevance: Most are benign, but larger ones (>1 million base-pairs) tend to be pathogenic (learning disability, autism, epilepsy etc) Small scale – microsatellites Short (2-5bp) repeat units in DNA sequence 5’ – CCGTGCATGCATGCATGCATGCACC – 3’ Alternatively: 5’ – CCG(TGCA)5CC – 3’ The number of copies varies from individual to individual Incidence: common: we all carry approximately 10,000 microsatellites in our genomes. Clinical relevance: rarely disease causing. Vast majority are benign. Small scale : Single Nucleotide Polymorphisms A single base-pair change in the DNA. Commonly referred to as ‘SNiPs” 5’ - CGTACGATGACCCA/TAGCTAGCCCTA – 3’ Incidence: We all carry around 3.5 million SNPs Clinical relevance – as for microsatellite variation, vast majority are benign, or have very small effect on disease, but in rare cases they can be strong/disease causing. Small scale – insertions/deletions Small sections of DNA (one or a limited number of base-pairs) that are present in some individuals, but not in others 5’ – CGTAC[G]ATGACCCTAGCTAGCCCTA – 3’ Incidence: common: we all carry approximately 20,000 in our genomes. Clinical relevance: rarely disease causing. Vast majority are benign. Can be damaging if they occur in exons. The features of pathogenic mutations The vast majority of “mutations” occur outside of genes (98% of the genome is not ‘genic’). As a result, the majority of mutations do not themselves cause disease. Pathogenic mutations alter gene function deleteriously. E.g they do one or more of following – Knock-out or increase copy number of a gene (CNV) – rearrange multiple genes (i.e. transversion/translocation) – Change the amino acid sequence (non-synonymous mutation) – Lead to premature stop of translation (non-sense mutation) – Alter splicing (splice-site mutation) The features of large-scale pathogenic mutations Large scale pathogenic variation (ploidy, translocations, CNVs etc) results in: – Gross changes in gene expression – i.e. protein levels from multiple different genes are altered. E.g. trisomy 21 & its impact on gene expression The features of small-scale pathogenic mutations. Small-scale pathogenic variation results : – Changing of amino-acid sequence – Skipping or introduction of an exon (aberrant splicing) – Premature stop to translation – E.g. CFTR delta-508 (deletion of an amino acid – phenylalanine). Result is the protein can’t leave the ER for further processing The genetic code is critical in the interpretation of small-scale coding variation Genetic mutations: 1. Silent/synonymous = same aa 2. Missense/nonsynonymous = different aa 3. Nonsense/stop = stop codon introduced 4. Frameshift (from insertion/deletion) The nature and extent of genetic variation in malignant cells. Note this is somatic rather than germline mutation Cancer is characterized by ‘genomic instability’ Genetic changes lead to cancer, and cancer causes genetic changes Genomic instability in cancer cells allows rapid “evolution” Critical “driver” mutations allow – Genomic instability to persist – Safety mechanisms to be bypassed – Allow rapid growth and division of cells – Allow for metastasis The nature and extent of genetic variation in malignant cells. Genomic instability in cancer cells leads to large scale deletions and amplifications Chromosomal rearrangements Epigenetic changes The genetic instability allows for faster ‘evolution’ of the cancer Cancer is not a single disease Different cancers arise from different tissues Within a cancer, different ‘clones’ of cells often exist Some clones may be sensitive to one pharmacological agent, but not to another Genetic characterisation of cancers is a growing field – Specific genes (BCR-Abl, HER2 etc) – Tumour profiling Copy number change of 241 genes in different breast cancer tumours and cell lines http://genome-www.stanford.edu/acgh_breast/images/fig2.html Further reading: Human Molecular Genetics (Strachan & Read), 4th edition. – Chapter 13 Meisenberg & Simmons 4th ed ;chapter 7, p117-8