Fruit Biology and Nutrient Analysis Quiz
48 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What temperature was used to dry the butter paper bags containing the powdered samples?

  • 70 !C
  • 75 !C (correct)
  • 50 !C
  • 65 !C
  • The endocarp of a tomato fruit is the outermost layer.

    False

    What instrument was used for estimating mineral nutrients?

    Atomic absorption spectrophotometer

    The contents of the nutrient analysis were expressed in mg g-1 dry weight (DW) for ____ and in micrograms per gram DW for ____.

    <p>K; Ca</p> Signup and view all the answers

    Which layer of the fruit is described as 'berdasarkan pencaran' in the provided content?

    <p>Pericarp</p> Signup and view all the answers

    Match the following fruit types with their descriptions:

    <p>Berry = All fleshy Drupe = Endocarp hardens Nut = All layers harden</p> Signup and view all the answers

    The mesocarp is the outer layer of a tomato fruit.

    <p>False</p> Signup and view all the answers

    What is the general method used for storing powdered samples until further use?

    <p>Desiccator under dark conditions</p> Signup and view all the answers

    What are the major physiological events that occur during fruit ripening?

    <p>Change in color, texture, taste, and aroma</p> Signup and view all the answers

    Ripening of fruit is indicated with solid lines after the climacteric phase.

    <p>True</p> Signup and view all the answers

    What does qRT-PCR stand for?

    <p>quantitative Reverse Transcription Polymerase Chain Reaction</p> Signup and view all the answers

    The fruit becomes easier to digest and more susceptible to ______ by microbes during the ripening process.

    <p>decay</p> Signup and view all the answers

    Match the stages of apple fruit development with their respective days after anthesis (DAA):

    <p>0 DAA = Initial stage 14 DAA = Early development 60 DAA = Mid development 132 DAA = Mature stage</p> Signup and view all the answers

    Which enzyme is considered a non-pectolytic enzyme?

    <p>Endo-1,4-β-glucanases</p> Signup and view all the answers

    Non-climacteric fruits exhibit a rapid increase in respiration rate during ripening.

    <p>False</p> Signup and view all the answers

    What factors change as fruit ripens?

    <p>Color, texture, taste, and aroma</p> Signup and view all the answers

    The structure and composition of ripe fruit remain unchanged compared to unripe fruit.

    <p>False</p> Signup and view all the answers

    What phenomenon does exogenous ethylene treatment induce in mature climacteric fruit?

    <p>Production of endogenous ethylene</p> Signup and view all the answers

    In the maturation of non-climacteric fruits, the respiration rate typically _______ observed.

    <p>is not</p> Signup and view all the answers

    What is the role of housekeeping genes in fruit development studies?

    <p>To serve as baseline controls for gene expression analysis</p> Signup and view all the answers

    What is the effect of exogenous ethylene on respiration rate?

    <p>Increases</p> Signup and view all the answers

    Endogenous ethylene production is not triggered at the pre-climacteric stage.

    <p>True</p> Signup and view all the answers

    Match the following statements with their corresponding effects:

    <p>Autocatalytic induction = Endogenous ethylene production Respiration rate increases = Effect of exogenous ethylene treatment Degreening = Observed in some citrus fruits Non-climacteric fruits = Maturation without ethylene burst</p> Signup and view all the answers

    An increase in respiration rate is observed in ______ fruits, while non-climacteric fruits show no such increase.

    <p>climacteric</p> Signup and view all the answers

    What is a primary factor that influences fruit size?

    <p>Number of leaves per fruit</p> Signup and view all the answers

    Removing excess fruits at an early stage of development allows remaining fruits to grow larger.

    <p>True</p> Signup and view all the answers

    What role do leaves play in the growth of fruit?

    <p>Leaves provide photosynthates for fruit development.</p> Signup and view all the answers

    In the case of apples, removing excessive _____ can enhance the growth of the remaining fruit.

    <p>fruits</p> Signup and view all the answers

    Match the following terms with their descriptions:

    <p>Photosynthates = Nutrients produced through photosynthesis Genetic basis = Limits the potential size of fruit in a species Competition = Struggle for resources among plants Leaf count = Determines the availability of photosynthates for fruit</p> Signup and view all the answers

    What is a consequence of having too many fruits and too few leaves?

    <p>Reduced fruit size</p> Signup and view all the answers

    It is possible for an apple to grow as large as a watermelon by just removing other fruits.

    <p>False</p> Signup and view all the answers

    What happens to the seeds within a fruit during its development?

    <p>The seeds develop along with the fruit.</p> Signup and view all the answers

    Which hormone is primarily involved in seed development?

    <p>Gibberellin</p> Signup and view all the answers

    Auxin has no role in embryo growth.

    <p>False</p> Signup and view all the answers

    What is the effect of gibberellin-deficient mutants in pea?

    <p>They show reduced embryo growth.</p> Signup and view all the answers

    Gibberellins were originally thought to play a __________ role in seed development.

    <p>minor</p> Signup and view all the answers

    What influences the final seed size?

    <p>All of the above</p> Signup and view all the answers

    What is IAA an abbreviation for?

    <p>Indoleacetic acid</p> Signup and view all the answers

    Match the following hormones to their functions:

    <p>Auxin = Establishes auxin gradient during embryo development Gibberellin = Promotes seed development Indoleacetic acid = Stimulates cell division Ethylene = Regulates fruit ripening</p> Signup and view all the answers

    Free and conjugated forms of __________ stimulate seed development.

    <p>Indoleacetic acid</p> Signup and view all the answers

    What role does the 'ghost' play in plant growth according to the findings?

    <p>It plays a more important role than embryos in synthesizing auxin and GA.</p> Signup and view all the answers

    The insertion of FveAGL80 into the JH4 vector was not necessary for the experiment.

    <p>False</p> Signup and view all the answers

    What technique was used to analyze the fertilized seeds from F2 plants?

    <p>Confocal microscopy</p> Signup and view all the answers

    The gRNA sequence necessary to avoid impacts of parental imprinting is _____

    <p>CGATGGACTCCCAACGGGGAAGG</p> Signup and view all the answers

    Which method was used to confirm the editing of genomic sequences?

    <p>PCR and sequencing</p> Signup and view all the answers

    What major challenge is mentioned regarding dissecting seeds of other fruit types like tomato?

    <p>Seeds are embedded and mixed with internal tissues.</p> Signup and view all the answers

    Match the following processes with their respective roles:

    <p>Auxin synthesis = Promotes fruit set GA biosynthesis = Stimulates growth Seed dissection = Facilitates gene expression study PCR = Confirms genomic editing</p> Signup and view all the answers

    What conclusion about the role of ghosts does this study draw?

    <p>Ghosts significantly contribute to GA biosynthesis.</p> Signup and view all the answers

    Study Notes

    Learning Outcomes

    • Students will be able to describe the process of fruit formation and maturation.
    • Students will be able to compare diverse fruit structures and types.

    What is a Fruit?

    • Botanically, a fruit is one or more ovaries, along with associated tissues, that have matured and ripened.
    • Horticulturally, a fruit is one or more mature ovaries plus accessory tissues; possessing high sugar content and typically eaten as dessert, in salads, or snacks.

    Fruit Structure and Development

    • Fruits develop as a result of pollination and/or fertilization.
    • Fruit is an accessory reproductive structure in flowering plants (angiosperms).
    • It contains seeds.

    Fruit Classification

    • Simple Fruit: Develops from a single pistil (e.g., pea, tomato, apple, cucumber).
    • Aggregate Fruit: Develops from multiple, separate carpels of a single flower (e.g., strawberry, raspberry).
    • Multiple Fruit: Develops from multiple carpels of multiple flowers within an inflorescence (e.g., pineapple, fig).
    • Accessory Fruit: Develops from tissues other than the ovary (e.g., apple, pear).

    Factors Influencing Fruit Structure

    • Flower structure influences fruit structure.
    • Ovary position, number of ovaries.

    Fruit Maturation

    • Fruit maturation is typically characterized by changes in color, texture, flavor, and aroma. These changes are due to increases in the production of volatile compounds, associated with fruit ripening.
    • This occurs as the fruit ripens and the starch is converted to sugar.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    Description

    Test your knowledge on fruit biology, nutrient analysis, and associated processes. This quiz covers topics such as fruit ripening, nutrient estimation, and the anatomy of fruits like tomatoes. Ideal for students in biology or agricultural sciences.

    More Like This

    Plant Biology: Fruit Growth Processes
    1 questions
    Biology: God's Living Creation Quiz 4
    5 questions

    Biology: God's Living Creation Quiz 4

    ExaltedDalmatianJasper3739 avatar
    ExaltedDalmatianJasper3739
    Biology: God's Living Creation - Fruits
    6 questions
    Biology: God's Living Creation Quiz 4
    10 questions

    Biology: God's Living Creation Quiz 4

    ExaltedDalmatianJasper3739 avatar
    ExaltedDalmatianJasper3739
    Use Quizgecko on...
    Browser
    Browser