Fruit Biology and Nutrient Analysis Quiz
48 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What temperature was used to dry the butter paper bags containing the powdered samples?

  • 70 !C
  • 75 !C (correct)
  • 50 !C
  • 65 !C

The endocarp of a tomato fruit is the outermost layer.

False (B)

What instrument was used for estimating mineral nutrients?

Atomic absorption spectrophotometer

The contents of the nutrient analysis were expressed in mg g-1 dry weight (DW) for ____ and in micrograms per gram DW for ____.

<p>K; Ca</p> Signup and view all the answers

Which layer of the fruit is described as 'berdasarkan pencaran' in the provided content?

<p>Pericarp (C)</p> Signup and view all the answers

Match the following fruit types with their descriptions:

<p>Berry = All fleshy Drupe = Endocarp hardens Nut = All layers harden</p> Signup and view all the answers

The mesocarp is the outer layer of a tomato fruit.

<p>False (B)</p> Signup and view all the answers

What is the general method used for storing powdered samples until further use?

<p>Desiccator under dark conditions</p> Signup and view all the answers

What are the major physiological events that occur during fruit ripening?

<p>Change in color, texture, taste, and aroma (C)</p> Signup and view all the answers

Ripening of fruit is indicated with solid lines after the climacteric phase.

<p>True (A)</p> Signup and view all the answers

What does qRT-PCR stand for?

<p>quantitative Reverse Transcription Polymerase Chain Reaction</p> Signup and view all the answers

The fruit becomes easier to digest and more susceptible to ______ by microbes during the ripening process.

<p>decay</p> Signup and view all the answers

Match the stages of apple fruit development with their respective days after anthesis (DAA):

<p>0 DAA = Initial stage 14 DAA = Early development 60 DAA = Mid development 132 DAA = Mature stage</p> Signup and view all the answers

Which enzyme is considered a non-pectolytic enzyme?

<p>Endo-1,4-β-glucanases (D)</p> Signup and view all the answers

Non-climacteric fruits exhibit a rapid increase in respiration rate during ripening.

<p>False (B)</p> Signup and view all the answers

What factors change as fruit ripens?

<p>Color, texture, taste, and aroma (B)</p> Signup and view all the answers

The structure and composition of ripe fruit remain unchanged compared to unripe fruit.

<p>False (B)</p> Signup and view all the answers

What phenomenon does exogenous ethylene treatment induce in mature climacteric fruit?

<p>Production of endogenous ethylene</p> Signup and view all the answers

In the maturation of non-climacteric fruits, the respiration rate typically _______ observed.

<p>is not</p> Signup and view all the answers

What is the role of housekeeping genes in fruit development studies?

<p>To serve as baseline controls for gene expression analysis</p> Signup and view all the answers

What is the effect of exogenous ethylene on respiration rate?

<p>Increases (B)</p> Signup and view all the answers

Endogenous ethylene production is not triggered at the pre-climacteric stage.

<p>True (A)</p> Signup and view all the answers

Match the following statements with their corresponding effects:

<p>Autocatalytic induction = Endogenous ethylene production Respiration rate increases = Effect of exogenous ethylene treatment Degreening = Observed in some citrus fruits Non-climacteric fruits = Maturation without ethylene burst</p> Signup and view all the answers

An increase in respiration rate is observed in ______ fruits, while non-climacteric fruits show no such increase.

<p>climacteric</p> Signup and view all the answers

What is a primary factor that influences fruit size?

<p>Number of leaves per fruit (B)</p> Signup and view all the answers

Removing excess fruits at an early stage of development allows remaining fruits to grow larger.

<p>True (A)</p> Signup and view all the answers

What role do leaves play in the growth of fruit?

<p>Leaves provide photosynthates for fruit development.</p> Signup and view all the answers

In the case of apples, removing excessive _____ can enhance the growth of the remaining fruit.

<p>fruits</p> Signup and view all the answers

Match the following terms with their descriptions:

<p>Photosynthates = Nutrients produced through photosynthesis Genetic basis = Limits the potential size of fruit in a species Competition = Struggle for resources among plants Leaf count = Determines the availability of photosynthates for fruit</p> Signup and view all the answers

What is a consequence of having too many fruits and too few leaves?

<p>Reduced fruit size (B)</p> Signup and view all the answers

It is possible for an apple to grow as large as a watermelon by just removing other fruits.

<p>False (B)</p> Signup and view all the answers

What happens to the seeds within a fruit during its development?

<p>The seeds develop along with the fruit.</p> Signup and view all the answers

Which hormone is primarily involved in seed development?

<p>Gibberellin (A)</p> Signup and view all the answers

Auxin has no role in embryo growth.

<p>False (B)</p> Signup and view all the answers

What is the effect of gibberellin-deficient mutants in pea?

<p>They show reduced embryo growth.</p> Signup and view all the answers

Gibberellins were originally thought to play a __________ role in seed development.

<p>minor</p> Signup and view all the answers

What influences the final seed size?

<p>All of the above (D)</p> Signup and view all the answers

What is IAA an abbreviation for?

<p>Indoleacetic acid</p> Signup and view all the answers

Match the following hormones to their functions:

<p>Auxin = Establishes auxin gradient during embryo development Gibberellin = Promotes seed development Indoleacetic acid = Stimulates cell division Ethylene = Regulates fruit ripening</p> Signup and view all the answers

Free and conjugated forms of __________ stimulate seed development.

<p>Indoleacetic acid</p> Signup and view all the answers

What role does the 'ghost' play in plant growth according to the findings?

<p>It plays a more important role than embryos in synthesizing auxin and GA. (A)</p> Signup and view all the answers

The insertion of FveAGL80 into the JH4 vector was not necessary for the experiment.

<p>False (B)</p> Signup and view all the answers

What technique was used to analyze the fertilized seeds from F2 plants?

<p>Confocal microscopy</p> Signup and view all the answers

The gRNA sequence necessary to avoid impacts of parental imprinting is _____

<p>CGATGGACTCCCAACGGGGAAGG</p> Signup and view all the answers

Which method was used to confirm the editing of genomic sequences?

<p>PCR and sequencing (A)</p> Signup and view all the answers

What major challenge is mentioned regarding dissecting seeds of other fruit types like tomato?

<p>Seeds are embedded and mixed with internal tissues.</p> Signup and view all the answers

Match the following processes with their respective roles:

<p>Auxin synthesis = Promotes fruit set GA biosynthesis = Stimulates growth Seed dissection = Facilitates gene expression study PCR = Confirms genomic editing</p> Signup and view all the answers

What conclusion about the role of ghosts does this study draw?

<p>Ghosts significantly contribute to GA biosynthesis. (A)</p> Signup and view all the answers

Flashcards

Exocarp

The outermost layer of a fruit.

Mesocarp

The middle layer of a fruit, often the fleshy part.

Endocarp

The innermost layer of a fruit, often hard and surrounding the seeds.

Berry

A type of fruit with a fleshy pericarp that is completely edible.

Signup and view all the flashcards

Drupe

A type of fruit with a fleshy pericarp, but the endocarp is hard and stony.

Signup and view all the flashcards

Nut

A type of fruit with a hard pericarp that surrounds the seed.

Signup and view all the flashcards

Oven Drying

A method of drying samples in an oven at a specific temperature until they reach a constant weight.

Signup and view all the flashcards

Atomic Absorption Spectrophotometer

A technique used to measure the concentration of elements in a sample using a specialized instrument.

Signup and view all the flashcards

Fruit Ripening

A series of changes in color, texture, taste, and aroma that occur in mature fruits as they reach their peak edible state.

Signup and view all the flashcards

Fruit Aroma Production

The production of volatile compounds, such as esters, aldehydes, and ketones, that contribute to the characteristic aroma of fruits.

Signup and view all the flashcards

Changes in Fruit Composition

Changes in the composition and structure of a fruit during ripening, making it easier to digest and more susceptible to microbial decomposition.

Signup and view all the flashcards

Climacteric

The increase in respiration rate observed during fruit ripening, leading to an increase in energy production and a burst of biochemical activity.

Signup and view all the flashcards

Pre-Climacteric

The period of fruit development before the climacteric occurs, marked by gradual changes in composition and color.

Signup and view all the flashcards

Gene Expression Analysis

The process of measuring gene expression levels at different stages of fruit development to identify genes that play a role in ripening.

Signup and view all the flashcards

Quantitative Reverse Transcription PCR (qRT-PCR)

A technique used to assess the abundance of specific messenger RNA (mRNA) molecules in a sample, reflecting gene expression levels.

Signup and view all the flashcards

Regulated Genes

Genes involved in key metabolic pathways regulated during fruit development and ripening, such as sugar metabolism, pigment production, and aroma formation.

Signup and view all the flashcards

Non-pectolytic enzymes

Enzymes that break down cell walls, such as endo-1, 4-β-glucanases (EGase), endo-1,4-β-xylanases, β-xylanases, xyloglucan endotransglucosylase/hydrolases (XTH).

Signup and view all the flashcards

Respiration rate

The rate at which a fruit consumes oxygen and releases carbon dioxide during respiration. This rate increases during ripening in climacteric fruits, but remains relatively constant or declines in non-climacteric fruits.

Signup and view all the flashcards

Effect of Exogenous Ethylene Treatment

The effect of adding ethylene gas to a fruit. In climacteric fruits, ethylene treatment can trigger a cascade of ripening processes, leading to an increase in respiration rate and the production of more ethylene. However, in non-climacteric fruits, ethylene treatment does not stimulate ripening, although it may have other effects such as changing color.

Signup and view all the flashcards

Climacteric stage

A stage in fruit development characterized by a rapid increase in respiration rate, often accompanied by ethylene production. This is typical of climacteric fruits like bananas, apples, and tomatoes.

Signup and view all the flashcards

Climacteric fruits

Fruits that experience a surge in ethylene production and respiration during the ripening process. Examples include avocados, bananas, mangoes, and apples.

Signup and view all the flashcards

Non-climacteric fruits

Fruits that do not undergo a burst of ethylene production or a significant increase in respiration during ripening. They typically ripen gradually and include fruits like citrus, grapes, and strawberries.

Signup and view all the flashcards

Maturation and ripening in non-climacteric fruits

Fruits that ripen gradually without a significant change in respiration rate. They don't typically produce large amounts of ethylene, and their ripening is more influenced by factors like sugars and acids.

Signup and view all the flashcards

Endogenous Ethylene Production

The release of ethylene by the fruit itself. In climacteric fruits, this release can be autocatalytic, meaning it triggers even more ethylene production, accelerating the ripening process.

Signup and view all the flashcards

Seed Number and Distribution

The amount and distribution of seeds in a fruit influences its size.

Signup and view all the flashcards

Auxin (IAA)

A plant hormone that plays a crucial role in fruit development. It promotes cell division, particularly in the early stages of fruit growth.

Signup and view all the flashcards

Gibberellins

A plant hormone involved in fruit development, but its role is less significant compared to auxin. It generally affects the final size of the fruit.

Signup and view all the flashcards

Pericarp

The outer layer of a fruit, often fleshy and edible.

Signup and view all the flashcards

Receptacle

The central core of a fruit, often containing seeds.

Signup and view all the flashcards

Auxin Gradient in Embryo Development

The auxin gradient is essential for establishing the appropriate bipolar symmetry during embryo development.

Signup and view all the flashcards

Free and Conjugated IAA

Free and conjugated forms of indoleacetic acid (IAA) are abundant in developing seeds and play a crucial role in fruit development.

Signup and view all the flashcards

IAA Importance in Early Fruit Development

During the cell division stages of fruit development (Stages I and II), free IAA is crucial for normal fruit development.

Signup and view all the flashcards

Cellular Size Limit

Each cell in the plant has a limit to its maximum size, which is why fruit development is limited by cell division and size.

Signup and view all the flashcards

Fruit Development

Fruit development is a balance between cell division and cell growth.

Signup and view all the flashcards

Leaves and Fruit Size

The number of leaves on a plant directly impacts the size of the fruit. More leaves mean more photosynthesis, supplying the developing fruit with nutrients.

Signup and view all the flashcards

Leaf to Fruit Ratio

The amount of leaves per fruit determines how big the fruit can grow. More leaves mean more resources for the fruit to grow larger.

Signup and view all the flashcards

Competition for Resources

Plants need enough leaves to support the development of all their fruits. If there are too many fruits and not enough leaves, the fruit will compete for resources leading to smaller fruits.

Signup and view all the flashcards

Fruit Thinning

The number of fruits on a plant can influence the size of each individual fruit. Removing some fruits early on can allow the remaining fruit to grow larger.

Signup and view all the flashcards

Genetic Limits

The genetic makeup of a species determines the maximum potential size of its fruit. Even with ideal conditions, a fruit can't grow beyond its genetic limits.

Signup and view all the flashcards

Leaf Waste

Having too many leaves per fruit is wasteful, as the plant is producing more food than the fruit can use.

Signup and view all the flashcards

Confirm Editing by PCR and Sequencing

A method used to confirm that the targeted gene was successfully edited by CRISPR-Cas9 technology using genomic DNA sequencing.

Signup and view all the flashcards

CRISPR-Cas9 Technology

A molecular tool used to introduce a gene into the plant genome at a specific location, allowing for the study of gene function and the creation of improved crops.

Signup and view all the flashcards

Ghost

The part of the seed that remains after the embryo is removed, often containing important regulatory factors for fruit development and ripening.

Signup and view all the flashcards

Homozygous Lines

The use of homozygous lines, where both copies of a gene are identical, to ensure that traits are consistently inherited from one generation to the next.

Signup and view all the flashcards

Binary Vector

A type of vector, often used in plant genetic engineering, for carrying and delivering genes into plant cells, allowing for gene manipulation and transformation.

Signup and view all the flashcards

Role of Ghost in GA Biosynthesis

The synthesis of gibberellin (GA), an important plant hormone involved in fruit development and ripening, is likely controlled by more than one gene.

Signup and view all the flashcards

Study Notes

Learning Outcomes

  • Students will be able to describe the process of fruit formation and maturation.
  • Students will be able to compare diverse fruit structures and types.

What is a Fruit?

  • Botanically, a fruit is one or more ovaries, along with associated tissues, that have matured and ripened.
  • Horticulturally, a fruit is one or more mature ovaries plus accessory tissues; possessing high sugar content and typically eaten as dessert, in salads, or snacks.

Fruit Structure and Development

  • Fruits develop as a result of pollination and/or fertilization.
  • Fruit is an accessory reproductive structure in flowering plants (angiosperms).
  • It contains seeds.

Fruit Classification

  • Simple Fruit: Develops from a single pistil (e.g., pea, tomato, apple, cucumber).
  • Aggregate Fruit: Develops from multiple, separate carpels of a single flower (e.g., strawberry, raspberry).
  • Multiple Fruit: Develops from multiple carpels of multiple flowers within an inflorescence (e.g., pineapple, fig).
  • Accessory Fruit: Develops from tissues other than the ovary (e.g., apple, pear).

Factors Influencing Fruit Structure

  • Flower structure influences fruit structure.
  • Ovary position, number of ovaries.

Fruit Maturation

  • Fruit maturation is typically characterized by changes in color, texture, flavor, and aroma. These changes are due to increases in the production of volatile compounds, associated with fruit ripening.
  • This occurs as the fruit ripens and the starch is converted to sugar.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

Struktur dan Perkembangan Tumbuhan (BI-2207) PDF

Description

Test your knowledge on fruit biology, nutrient analysis, and associated processes. This quiz covers topics such as fruit ripening, nutrient estimation, and the anatomy of fruits like tomatoes. Ideal for students in biology or agricultural sciences.

More Like This

Fruit Composition and Ripening
36 questions

Fruit Composition and Ripening

FaultlessSyntax avatar
FaultlessSyntax
Plant Biology: Fruit Growth Processes
1 questions

Plant Biology: Fruit Growth Processes

EvaluativeStatistics avatar
EvaluativeStatistics
Biology: God's Living Creation Quiz 4
5 questions

Biology: God's Living Creation Quiz 4

ExaltedDalmatianJasper3739 avatar
ExaltedDalmatianJasper3739
Biology: God's Living Creation - Fruits
6 questions

Biology: God's Living Creation - Fruits

ExaltedDalmatianJasper3739 avatar
ExaltedDalmatianJasper3739
Use Quizgecko on...
Browser
Open
Browser
Browser