Struktur dan Perkembangan Tumbuhan (BI-2207) PDF

2024/12/17 STRUKTUR DAN PERKEMBANGAN TUMBUHAN (BI – 2207) Sekolah Ilmu dan Teknologi Hayati...

2024/12/17 STRUKTUR DAN PERKEMBANGAN TUMBUHAN (BI – 2207) Sekolah Ilmu dan Teknologi Hayati (SITH) @sithitb @sithitb sith.itb.ac.id School of Life Sciences and Technology 1 Learning outcome Setelah mengikuti kuliah ini, mahasiswa dapat : 1. Menjelaskan proses pembentukan dan pematangan buah. 2. Membandingkan keragaman struktur dan jenis buah 2 1  2024/12/17 True Fruits and Accessory Fruits Apa FIGURE yang 9-31Edimaksud dengan buah? FIGURE 9-31F Berdasarkan ilmu botani, buah adalah : Ø Buah adalah satu atau lebih ovarium(bakal buah), bersama dengan jaringan aksesori lainnya, yang sudah true fruit accessory fruit mengalami pendewasaan dan pematangan FIGURE 9-32 Berdasarkan ilmu hortikultura, buah adalah: Ø satu atau lebih ovarium bersama dengan jaringan aksesori lainnya yang sudah mengalami pendewasaan ❚ Fruit Types and Seed dan pematangan, memiliki kadar gula relatif tinggi kadar gula dan, secara fungsional, biasanya dimakan Dispersal sebagai makanan penutup, atau sebagai bagian salad atau camilan TABLE 9-4 3 Buah merupakan organ tempat biji berkembang dan akan membantu proses penyebaran biji. (A) © Alexander Chernyakov/iStock TABLE 9-4 Agents of Dispersal Agent Descriptive Term Animals Zoochory Attached to animal Epizoochory Eaten by animal Endozoochory Birds Ornithochory Mammals Mammaliochory Bats Chiropterochory Ants Myrmecochory (B) © DustyPixel/iStock Wind Anemochory FIGURE 9-32 (A) The red, edible flesh of strawberry is really the receptacle, not Water Hydrochory carpel tissue. It is therefore an accessory fruit. The “seeds” are true fruits, each derived from one carpel of the flower. (B) Pineapples develop from the coalescence of all the Dispersed by the plant itself Autochory many true fruits of one inflorescence, so they are a multiple fruit. In addition, many Seeds, fruits, and asexual propagules can be dispersed by many means. These are a noncarpellary tissues become involved, and are therefore accessory fruits as well. few of the most common types. Bracts are visible here. 4 244 Chapter 9: Flowers and Reproduction 4 2  2024/12/17 Buah merupakan struktur reproduksi tambahan pada tumbuhan Angiospermae yang di dalamnya mengandung biji. Perkembangan buah dirangsang oleh adanya polinasi dan/atau fertilisasi. 5 5 Klasifikasi Buah Asal Buah A. Buah tunggal – terbentuk dari satu pistilum (pea, tomato, lily, apple, cucumber) B. Buah agregat – terbentuk dari beberapa pistilum yang terpisah dalam satu bunga tunggal (strawberry, raspberry) C. Buah majemuk – terbentuk dari beberapa pistilum pada perbungaan dan biasanya bergabung dengan bagian bunga/perbungaan lainnya (nanas, nangka, murbei, fig) 6 6 3  2024/12/17 Struktur bunga mempengaruhi struktur buah. Figure 38.11 Developmental origin of different classes of fruits. Posisi ovarium Stigma Flowers Petal Stigma Style Carpel Style Jumlah ovarium Carpel Ovary Ø Bunga tunggal – satu Stigma Stamen Sepal Stamen pistil Stamen Ovary Ovule Ovule Ovary (in receptacle) Pea flower Raspberry flower Pineapple inflorescence Apple flower Ø Bunga tunggal - Carpel (fruitlet) Remains of Each segment Remains of beberapa ovarium yang develops stamens and styles stigma and from the Sepals Seed style carpel saling terpisah Ovary Withered of one flower Ø Bunga stamen Seed majemuk/perbungaan Pea fruit Raspberry fruit Pineapple fruit Receptacle Apple fruit (a) Simple fruit. A simple fruit (b) Aggregate fruit. An (c) Multiple fruit. A multiple (d) Accessory fruit. An develops from a single carpel aggregate fruit develops fruit develops from many accessory fruit develops (or several fused carpels) of from many separate carpels of the many largely from tissues other one flower (examples: pea, carpels of one flower flowers that form an than the ovary. In the apple lemon, peanut). (examples: raspberry, inflorescence (examples: fruit, the ovary is embedded blackberry, strawberry). pineapple, fig). in a fleshy receptacle. becomes stony (the pit) while the outer parts stay fleshy. As fruit, such as a soybean pod, involves the aging and drying the ovary grows, the other parts of the flower usually wither out of fruit tissues, the process in a fleshy fruit is more elabo- and are shed. rate. Complex interactions of hormones result in an edible Fruits are classified into several types, depending on their fruit that entices animals that disperse the seeds. The fruit’s developmental origin. Most fruits are derived from a single “pulp” becomes softer as enzymes digest components of cell 7 carpel or several fused carpels and are called simple fruits (Figure 38.11a). An aggregate fruit results from a single walls. The color usually changes from green to another color, making the fruit more visible among the leaves. The fruit flower that has more than one separate carpel, each forming becomes sweeter as organic acids or starch molecules are con- a small fruit (Figure 38.11b). These “fruitlets” are clustered verted to sugar, which may reach a concentration of 20% in together on a single receptacle, as in a raspberry. A multiple a ripe fruit. Figure 38.12 examines some mechanisms of seed fruit develops from an inflorescence, a group of flowers and fruit dispersal in more detail. tightly clustered together. When the walls of the many ova- In this section, you have learned about the key features of ries start to thicken, they fuse together and become incorpo- sexual reproduction in angiosperms—flowers, double fertil- rated into one fruit, as in a pineapple (Figure 38.11c). ization, and fruits. Next, we’ll examine asexual reproduction. In some angiosperms, other floral parts contribute to what we commonly call the fruit. Such fruits are called accessory fruits. In apple flowers, the ovary is embedded in the recep- CONCEPT CHECK 38.1 tacle, and the fleshy part of this simple fruit is derived mainly 1. Distinguish between pollination and fertilization. from the enlarged receptacle; only the apple core develops 2. WHAT IF? If flowers had shorter styles, pollen tubes would from the ovary (Figure 38.11d). Another example is the more easily reach the embryo sac. Suggest an explanation for why very long styles have evolved in most species of strawberry, an aggregate fruit consisting of an enlarged recep- flowering plants. tacle studded with tiny, partially embedded fruits, each bear- 3. MAKE CONNECTIONS Does the life cycle of humans have ing a single seed. any structures analogous to plant gametophytes? Explain A fruit usually ripens about the same time that its seeds your answer. (See Figures 13.5 and 13.6.) complete their development. Whereas the ripening of a dry For suggested answers, see Appendix A. CHAPTER 38 Angiosperm Reproduction and Biotechnology 831 URRY8743_12_SE_C38_PRF.indd 831 11/6/19 12:51 PM Posisi ovarium 1. Superior (ovarium tumbuh di atas bagian bunga yang lain) (bakal buah) menghasilkan buah berry (terutama dari jaringan ovarium) contoh : anggur 8 4  2024/12/17 Posisi ovarium (bakal buah) 9 Jumlah ovarium A. Buah tunggal – terbentuk dari satu pistilum (pea, tomato, lily, apple, cucumber) B. Buah agregat – terbentuk dari beberapa pistilum yang terpisah dalam satu bunga tunggal (strawberry, raspberry) C. Buah majemuk – terbentuk dari beberapa pistilum pada perbungaan dan biasanya bergabung dengan bagian bunga/perbungaan lainnya (nanas, nangka, murbei, fig) 10 10 5  2024/12/17 Gametophytes, Pollination, S Beberapa ovarium dalam satu bunga à Stigma buah agregat/buah ganda Stigma Stamen Stamen menghasilkan Buah Agregat Stigma Ovule Ovar apat melibatkan jaringan reseptakel Ovule Stamen Ovule recep Contoh : Blackberry, strawberry Pea flower Raspberry flower Pear flower Stigma Stamen Receptacle Carpel (fruitlet) Seed Seed Stigma Planta (2012) 235:1123–1139 Pea fruit Raspberry fruit Pear fruit dormancy is associated with long-term viability. However, from a cluster of flowers a many orthodox seeds can be stored for a long time under as in pineapple. Some ex seed-bank conditions at low temperature. types are illustrated in Fig 11 The developmental sw growing fruit depends on Fruit Development and Ripening most angiosperms, the g True fruits are found only in the flowering plants. In fact, unfertilized. fruits are a defining feature of the angiosperms, since angio means “vessel” or “container” in Greek and sperm Arabidopsis and tomat means “seed.” Diverse fruit types are represented in early the study of fruit deve Cretaceous fossils, including nuts and fleshy drupes and Arabidopsis has been a k berries. Fruits are typically derived from a mature ovary dry, dehiscent fruits. The g containing seeds, but they can also include a variety of from the fusion of two ca other tissues. For instance, the fleshy part of the straw- the pistil, and forms in th berry is actually the receptacle, while the true fruits are dopsis and many other m the dry achenes embedded in this tissue. fruit tissues develop, incl Fruits are seed-dispersal units and they can be grouped carp (known also as the v according to several features (see WEB TOPIC 21.7). Based septum, and valve marg on their composition and moisture content, they can be replum borders (Figure 2 Plant dry or 6/E Physiology either Taiz/Zeiger fleshy. If the fruit splits to release its seeds, Help! margins I can’t find differentiate any good into reference Sinauer Associates Morales Studio dehiscent. The fleshy fruits that flower it is termed we are most structure. Also, not sure whata dehiscence; the margins familiar with are indehiscent TZ6e_21.32 Date 07-24-14 and occur in a variety of fruits have relatively few ce forms. Tomatoes, bananas, and grapes are defined botani- some of these may be lign cally as berries, in which the seeds are embedded in a ated with fruit dehiscence fleshy mass, while peaches, plums, apricots, and almonds Much of what we kno are classified as drupes, in which the seed is enclosed in fleshy, indehiscent fruits h Beberapa ovarium dalam satu bunga a stony endocarp. Apples and pears are pome fruits, in which the edible tissue is derived from accessory struc- (Solanum lycopersicum), a m (Solanaceae) (Figure 21.3 à buah agregat/buah ganda tures such as floral parts or the receptacle. Fruits can also sis, the fruit is derived from be defined as simple, with a mature single or compound pel walls are called the pe ovary, as in hazelnut, Arabidopsis, and tomato. Alterna- in Arabidopsis), and the se tively, they may be aggregate, where flowers have multi- Unlike Arabidopsis fruits ple carpels that are not joined together, as in raspberry. and the carpels remain co Finally, they may be multiple, where the fruit is formed cell division is usually foll 12 21_TZ6e.indd 655 6 Fig. 6 Fragaria vesca early fruit development. Columns a–e Increas- nied by browning of the stigma follo ing maturity of the fruit, from day of anthesis to 13 days post anthesis the style. The ovary wall changes pr  2024/12/17 Bunga majemuk menghasilkan buah majemuk è jaringan ovulum saling berfusi Contoh : nanas, nangka reseptakel & Individual ovarium Berry-like Fruits berkembang menjadi buah 13 Bunga majemuk 14 7  2024/12/17 Asal mula pembentukan buah buah sejati è ovarium/ bakal buah, dan buah semu è ovarium dan/atau bagian bunga yang lain 15 15 Plant Physiol. Rep. on over 10% but less than 30% of the fruit surface), light weight of 1.0 g (accurate up to four decimal points) was red (pinkish-red or red colour on over 60% but red colour then taken for the estimation of different mineral nutrients. covers not more than 90% of the fruit surface) and red ripe The procedures followed for sample drying, digestion and (red colour on overall surface of the fruit). This catego- estimation of different nutrients were as per Tandon rization was based on the description provided by (1998), Jones (2001), Gupta (2007) and Paul and Srivas- Rubatzky and Yamaguchi (1997) and Jones (2008). Outer tava (2007). The procedures were followed after their pericarp was then separated from the other parts (locular proper standardization. gel, radial pericarp and the seed portions) of tomato fruits (Fig. 1). Three replications (each represented by a com- Digestion of sample posite sample of 5 tomatoes) for each ripening stage were used to analyze the content of mineral nutrients at different Di-acid digestion of samples was carried out for the esti- ripening stages for different varieties. Outer pericarp was mation of P, K, Mg, Ca, Fe, Zn, Cu and Mn while, dry- used as sample material for the estimations of different ashing was done for determination of B (Jones 2001, and Bagian dinding mineral nutrients. The reason for selecting this part of Paul and Srivastava 2007). tomato fruit for analysis was based on the established finding that one can study and simulate ripening and Estimation of P ripening-related changes of tomato fruit as a whole (at ovarium physiological, biochemical and molecular levels) with the Vanadomolybdophosphoric yellow colour method given by slices of its outer pericarp (Saltveit 1989; Campbell et al. Kitson and Millon (1944) and described by Gupta (2007) 1990; Ben-Arie et al. 1995; Sozzi et al. 2002; Lana et al. was followed. The obtained values were expressed in mg 2006). The excised outer pericarp parts of the tomato fruit g-1 DW. were rinsed twice with double-distilled water, blotted dry and kept in oven for drying at 70 !C. Dried pieces of Analyses of K and Ca pericarp were then ground in a mixer grinder (made up of stainless steel) to get a fine powder. Sample wise powder K and Ca were analyzed using flame photometer (Elico packets in butter paper bags (variety wise and ripening make, India) with facility of internal calibration. Contents stage wise) were stored inside desiccator under dark till of nutrients were expressed in mg g-1 dry weight (DW) for Pericarp further use. K and in micrograms per gram DW (lg g-1 DW) for Ca. Nutrient analysis Analyses of Fe, Zn, Cu, Mg and Mn Exocarp (lapisan luar) Butter paper bags (containing the powdered samples) were removed from desiccator and kept in oven for drying at These mineral nutrients were estimated using atomic absorption spectrophotometer (Electronic Corporation of 75 !C till the bags attained a constant dry weight. Dry Mesocarp (lapisan tengah) India Ltd.). Contents were expressed in lg g-1 DW. Fig. 1 Cross section through Endocarp (lapisan dalam tomato fruit showing different parts Semuanya berdaging - berry Bagian endocarp mengeras - drupa Semua lapisan mengeras - nut 123 16 8  2024/12/17 Deskripsi Jenis Buah A. Buah berdaging Beri, baka – buah yang memiliki daging buah lembut/lunak dan berdaging, kadang-kadang mengandung banyak biji è Lycopersicum esculentum, Vitis vinifera, Musa paradisiaca, Carica papaya 17 17 a. Hesperidium – buah baka yang terspesialisasi memiliki daging buah yang berminyak, mengandung kelenjar lisigen. eksokarp / flavedo – epidermis luar, berkutikula, beberapa lapis parenkim subepidermis padat, mengandung kelenjar minyak dan sel berlkristal mesokarp / albedo – parenkim dengan ruang antara sel besar (aerenkim) dan di antaranya terdapat jaringan pembuluh endokarp – epidermis dalam dan beberapa lapis parenkim yang padat. Pada bagian ini dihasilkan kantung berisi cairan è Citrus maxima, Citrus sinensis dll. 18 18 9  2024/12/17 b. Pepo – buah baka dengan kulit/daging buah tebal dan bagian eksokarp memiliki tonjolan (accessory rind) è Cucurbita moschata, Cucumis melo, C. sativus 19 19 2. Drupa – buah umumnya berbiji satu, memiliki dinding buah yang berdaging di bagian luarnya dan keras di bagian dalamnya (endocarp mengeras) è Mangifera indica, aprikot, plum, olive, Cocos nucifera 20 20 10  2024/12/17 3. Pome – Buah semu berdaging dengan bagian tengah yang memiliki struktur menyerupai tulang / rawan è Pyrus malus 21 21 B. Buah kering 1. Buah yang tidak pecah saat matang a. Achene – buah berbiji satu, dinding buah dan kulit biji terpisah (Ranunculus, strawberry, Helianthus annuus) 22 22 11  2024/12/17 b. Caryopsis (grain) – buah berbiji satu, dinding buah bersatu dengan kulit biji (jagung, gandum) 23 23 c. Samara – buah berbiji satu, memiliki sayap (angsana, Acer) d. Nut – buah berbiji satu dengan dinding yang mengeras, sebagian atau seluruhnya dikelilingi oleh cawan atau cangkang (oak, hazelnut) 24 24 12  2024/12/17 2. Buah yang memecah saat matang a. Follicle – buah yang berasal dari satu karpel, memecah pada alur punggung (Catharanthus, Asclepias, Magnolia) b. Legume – buah yang berasal dari satu karpel yang memecah sepanjang alur perut Buah folikel Buah legum / polong 25 25 c. Siliqua – buah yang berkembang dari dua karpel, memecah pada dua alur, melepaskan kedua karpelnya dan menyisakan sekat. (pada tumbuhan Brassicaceae) d. Capsule – buah yang berkembang dari beberapa karpel, memecah sepanjang persatuan karpel atau melalui pori (durian, lili, Canna) 26 26 13  2024/12/17 Perkembangan buah / ‘Fruit Set’ 27 Tahapan Pertumbuhan perkembangan Ø Peningkatan karakter fisik yang bersifat ‘irreversible’ pada tumbuhan atau bagian tumbuhan yang sedang berkembang buah Pembelahan sel à pertambahan jumlah sel dalam buah) Ekspansi/Pembesaran sel à pertambahan ukuran buah hingga mencapai ukuran dewasa Periode pematangan Periode Ekspansi Sel Berat segar buah Perioda Polinasi/ Pembelahan Fertilisasi sel Waktu Setelah titik ini, tidak akan ada lagi sel dalam buah yang membelah 28 14  2024/12/17 BMC Plant Biology 2008, 8:16 http://www.biomedcentral.com/1471-2229/8/16 A B C D E F G H Starch accumulation Starch decline Peak rate of cell expansion Ripening Cell division Cell expansion 0 14 25 35 60 87 132 146 Days after anthesis (DAA) Figurefruit Apple 1 development Apple fruit development. Apple fruit at various stages of development. A, 0 DAA, B, 14 DAA, C, 35 DAA, D, 60 DAA, E, 29 87 DAA, F, 132 DAA, G, 146 DAA. H, diagram of fruit development showing the timing of major physiological events and the sampling time points, adapted from [17–19]. Ripening is shown as a solid and dashed red, solid from the time of the climacteric and dashed for events prior to the climacteric. Bar = 1 cm. reverse transcriptase-PCR (qRT-PCR) to examine steady- significant to least significant and genes for qRT-PCR state RNA levels during fruit development. Genes for qRT- selected at regular intervals from this list (approximately PCR were initially selected from the list of genes that sig- every 50th gene). Several genes were also chosen for qRT- nificantly changed their expression during fruit develop- PCR to confirm expression patterns of genes in particular ment. The list of regulated genes was ordered from most pathways (see below). Three housekeeping genes were Page 4 of 29 Tahapan Perkembangan Buah (page number not for citation purposes) 30 15  2024/12/17 Pematangan buah 27.2 Physiological Changes During Fruit Ripening 863 Umumnya merupakan ciri khas buah berdaging, melibatkan serangkaian perubahan warna, tekstur, rasa, dan aroma (karena produksi berbagai senyawa volatil) yang terjadi pada buah yang sudah dewasa Perubahan struktur dan komposisi buah matang à mudah dicerna dan mudah mengalami pembusukan oleh mikroba sehingga dapat mengekspos biji di dalam buah. Umumnya terjadi ketika masih melekat pada tanaman induknya dimulai dengan adanya akumulasi gula akibat hidrolisis pati, hilangnyarasa asam, pengeringan lateks jika buah dewasa latiferous, pelunakan tekstur, perubahan warna kulit Fig. 27.3 Different physiological changes that take place during fruit ripening process. PME, pectin methyl esterase (Box 27.4). Coordination and synergistic action of a variety of cell wall-modifying 31 enzymes are responsible for these changes. Structural changes in the cell wall are associated with the dissolution of middle lamella and disruption of the primary cell wall which leads to loss of firmness in mature fruits. These include depolymerization and solubilization of the polysaccharides and pectin components along with rearrangements of their associations. Modifications of polysaccharides may occur depending on the type of fruit. Table 27.2 summarizes the major modifications in the cell wall polysaccharides during ripening in some climacteric and non-climacteric fruits. In tomato, cell wall modifications include both depolymerization and solubi- lization of polyuronides and hemicelluloses. Cell wall-modifying enzymes are 872 broadly categorized as pectolytic and27non-pectolytic, Fruit Development and Ripening depending on the specific polysaccharide used as substrate. Endo- and exo-polygalacturonases, pectin acetylesterases Table 27.4 Comparison (PAE), ofpectate of the physiology lyases climacteric (PL), pectin fruit and non-climacteric methylesterases ripening (PME), β-galactosidases, and α- L-arabinofuranosidases are pectolytic enzymes. The activity Characteristic of these enzymes leads to cleavage or modification of the polysaccharide backbone S. No. feature Climacteric fruit Non-climacteric fruit and removal of neutral sugars from the branched side chains. Removal of methyl 1. Endogenous ester groups from Increases Does the fruit cell wall by PME facilitates not increase access of polygalacturonase ethylene(PG) levelstoprior its substrate. PME is expressed before ripening and is downregulated by to start of fruit ethylene during ripening. Repression of PME by antisense resulted in increased fruit ripening viscosity. Non-pectolytic enzymes, such as endo-1, 4-β-glucanases (EGase), endo- 2. Respiration rate 1,4-β-xylanases, Increases Either remains β-xylanases, xyloglucan endotransglucosylase/hydrolases (XTH), Pematangan prior to onset of fruit unchanged or there is ripening steady decline until senescence Buah 3. Effect of exogenous ethylene treatment i. Production of Autocatalytic induction of Not triggered endogenous endogenous ethylene production if ethylene treated at mature climacteric fruit stage. However, at pre-climacteric stage, endogenous ethylene production is not triggered ii. Respiration rate Increases Increases iii. Acceleration of Yes No. In some fruits, such fruit ripening as citrus, degreening is seen In non-climacteric fruits, maturation and ripening processes occur without a burst of ethylene production. Increase in the rate of respiration has also not been observed. However, a certain level of endogenous ethylene is produced in non-climacteric fruits. Exogenous ethylene treatment increases respiration rate but does not trigger 32 the production of endogenous ethylene, and fruit ripening is not accelerated in non-climacteric fruits. A comparative account of important events taking place in climacteric and non-climacteric fruits accompanying ripening process is summarized in Table 27.4. Recently, the involvement of ethylene in strawberry fruit ripening has been reported (Box 27.3). Respiration rate in strawberry fruit is stimulated by ethylene in a dose-dependent manner and results in slight acceleration of the cell wall softening process. There is an increase in the expression of ethylene receptor 16 which increases the response to elevated ethylene levels in strawberry, indicating that a low level of ethylene is sufficient to trigger ripening process. Exogenous application of ethylene in citrus accelerates respiration rate and stimulates chloro- phyll degradation and carotenoid biosynthesis. Treatment with ethylene antagonists,  2024/12/17 Buah klimakterik 33 34 17  2024/12/17 Faktor-Faktor yang Mempengaruhi Pematangan Buah Klimakterik Faktor-faktor yang mempengaruhi produksi dan kerja C2H4 dapat dimanipulasi untuk mengontrol pematangan. Perlakuan etilen: – menstimulasi pematangan yang lebih cepat dan lebih seragam dengan mengoordinasikan awal pematangan. – reduksi waktu antara panen dan konsumsi dapat berarti kualitas dan nilai gizi yang lebih baik. 35 FISIOLOGI PERKEMBANGAN TUMBUHAN (BA – 2104) Sekolah Ilmu dan Teknologi Hayati (SITH) @sithitb @sithitb sith.itb.ac.id School of Life Sciences and Technology 36 18  2024/12/17 Faktor-faktor yang mempengaruhi ukuran buah 1. Jumlah sel per buah 2. Jumlah daun per buah 3. Kompetisi di dalam tumbuhan untuk mendapatkan fotosintat 4. Pembentukan biji 37 Pola Pertumbuhan Buah – Pembelahan & Pembesaran sel Periode Ekspansi Sel Periode pematangan Pembelahan sel Ø Menetapkan potensi untuk ukuran buah tertinggi Berat segar buah Pendewasaan (Buah berukuran penuh) Ekspansi Sel Ø Buah mencapai ukuran dewasa Perioda Penyerbukan/ Pembelahan Fertilisasi Sel Waktu 38 19  2024/12/17 Jumlah Sel per Buah Setiap sel memiliki pembatasan ukuran à banyak sel yang lebih penting! Setiap sel tunggal dari mitosis Hanya memiliki potensi untuk mencapai ukuran maksimum tertentu Membatasi Potensi Ukuran Buah Pembelahan sel 1 cell 4 cells 1 cell 9 cells 39 Faktor-faktor yang mempengaruhi ukuran buah- Jumlah daun per buah Daun - sumber fotosintat (dari fiksasi karbon), buah- buahan yang berkembang adalah ‘sink’ untuk fotosintat Lebih banyak daun per buah à buah lebih besar 40 20  2024/12/17 Perkembangan Buah Selama perkembangan buah, biji yang ada di dalamnya juga turut berkembang. Perkembangan buah memerlukan : 1. Nutrisi à hasil fotosintat 41 41 Faktor-faktor yang mempengaruhi ukuran buah - Kompetisi di dalam tumbuhan untuk mendapatkan fotosintat Pada tanaman, jumlah daun tidak cukup untuk mendukung perkembangan setiap buah Terlalu banyak buah dan terlalu sedikit daun Menghilangkan beberapa buah pada tahap awal perkembangannya memungkinkan buah yang tersisa bertambah besar 42 21  2024/12/17 Seberapa jauh kita bisa lakukan untuk mengurangi persaingan? Pada apel, penghilangan buah dan hanya menyisakan satu buah agar tumbuh besar sebesar semangka? NO Dasar genetic suatu spesies tidak akan memungkinkan buah menjadi sangat besar! Terlalu banyak daun per buah adalah pemborosan! seed development BOX 8 GETTING MORE IN DEPTH ON THE SUBJECT SIGNIFICANCE OF APOMIXIS 43 Apomixis is significant in agriculture and horticulture because the seedling plants have the same genotype as the (Poa pratensis), ‘King Ranch’ bluestem (Andropogun), ‘Argentine’ Bahia grass (Paspalum notatum), and ‘Tucson’ mother plant (28). This asexual process eliminates variability side oats grama (Bouteloua curtipendula). and “fixes” the characteristics of any cultivar immediately. There has been a recent resurgence in research con- However, the apomictic life cycle has the same juvenile cerning apomixis. It has been known for some time that period found in sexually derived seeds. apomixis is an inherited trait and that the gene maps to a Only a few economically important food crops exhibit single chromosome (68). This indicates that there is a sin- apomixis. These include Citrus, mango (Mangifera), and gle apomixis gene and that if that gene is isolated it could mangosteen (Garcinia). All three have adventitious embry- be used to genetically engineer apomixis into important ony. They have mainly been exploited as clonal seedling crop plants. The major benefit would be that apomixis understocks for grafting and budding because they are would fix hybrid vigor (heterosis) in crops that now require virus-free, show seedling vigor, and are uniform. However, costly crossing between inbred parents. It would also be a Pembentukan biji sexual embryos can also be produced and can exhibit simple way to eliminate virus in traditionally vegetatively unwanted variability. Use of DNA fingerprinting is being propagated crops like potato. The seed produced would used to separate sexual and asexual embryos for under- have the same genetics of the parents, but because the stock production. embryo is derived from a single cell, it should be virus- Several grass species and cultivars are facultative free. gametophytic apomicts. These include Kentucky bluegrass Jumlah dan penyebaran biji (pada buah berbiji banyak) akan mempengaruhi ukuran buah Auxin Setiap biji yang sedang berkembang mengirimkan Gibberellins were originally thought to play only sinyal hormon Free and conjugated (auksin) forms of indoleacetic acid yang (IAA) merangsang a minor role in seed development. Gibberellin- are abundant perkembangan pericarp in developing seeds. Free dan/atau IAA is high dur- reseptakel di sekitar deficient mutants in tomato and Arabidopsis gener- ally show normal seed development only affecting ing cell division stages of development (Stages I and II) ataufordinormal and is essential dekatnya. embryo and endosperm final seed size. However in pea, gibberellins are development. An auxin gradient is required to establish required for embryo growth (66). In gibberellin- Jika appropriate bipolarhanya symmetry beberapa during embryobiji yang berkembang, develop- buah deficient mutants that akan show reduced gibberellin ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31656-y memiliki ment. Mutations bentuk that cause seeds to yang have lowkecil, auxin aneh; jika bijigibberellin biosynthesis, terlalu issedikit required to sustain production or reduced auxin transport generally result à absisi in malformed embryos with fused cotyledons and poor endosperm development (74). Fertilization Conjugated forms of IAA are abundant in mature seeds and during germination. Free IAA is released FveAGL62/80 from the conjugated forms for utilization during early FveATHB29b/30 seedling growth. There is evidence that auxin from the developing seed signals the fruit to continue to develop FveYUC10 (Fig. 28). Fruits usually abscise if seeds abort or are Auxin unfertilized. Auxin applied to tomato or strawberry can Biosynthesis induce parthenocarpic fruit development (see Box 9). Auxin transport Achene Receptacle Gibberellins Seedcoat Endosperm Various forms of gibberellins are abundant during Fig. 7 A model illustrating the FveAGL62-FveATHB module. Upon fertilization, FveAGL62 and FveAGL80 expression is induced in the endosperm and the FveAGL62/FveAGL80 heterodimers act to switch off the transcription of FveATHB genes, lifting the transcriptional repression of auxin biosynthesis genes seed development (Stages I and II). Most of the Figure 28 such as FveYUC10, leading to the synthesis and accumulation of auxin. Upon being transported to receptacle, auxin stimulates receptacle fruit development. biochemistry known about gibberellins was first Strawberry “fruit” (receptacle) enlargement requires auxin 46 investigated in developing seeds. Active forms decline Strawberry Gene IDs. All the genomic and CDS sequences of F. vesca genes from the developing seed (actually the fruit-achene). mentioned Notice in the manuscript can be found in GDR (rosaceae.org) using their gene were driven by the Arabidopsis Ubiquitin 10 promoter. After transformation into F. vesca, 10 and 12 independent lines of FveATHB29b-OE and FveATHB30-OE how the only swelling in the receptacle tissueversion IDs (genome is around the version 2.0; genome version 4.0 annotation 2.0 annotation respectively were confirmed by PCR genotyping. at seed maturity and are replaced by conjugated version 2.0) as follows: FveAGL62 (gene01789; FvH4_2g03030), FveAGL80 developing achenes (red arrow). The(gene22916; black arrow shows FveAGL80L1 FvH4_6g08460), a (gene18029; FvH4_6g21170), forms of gibberellins. Like auxin, these conjugated non-fertilized seed where you can still see the(gene04949, FveAGL80L2 style and FvH4_7g09730), FveAGL80L3 (gene22967; Analyses of Arabidopsis atagl62 mutants. The full-length FveAGL62 ORF (663 bp) was PCR amplified and assembled with the upstream and downstream forms of gibberellins are utilized during germination. stigma attached. There is no swelling FvH4_6g08570), FveAGL80L4 (gene23924; FvH4_6g43410), FveATHB29b in this FvH4_5g17830), (gene09326; area because FveATHB30 (gene03815; FvH4_6g48610), fragments of AtAGL62. The 2074 bp upstream fragment of AtAGL62 contains the there is no developing seed to provide the auxin. FveATHB22 (gene01920; FvH4_1g20040), FveYUC5 (gene32686; FvH4_2g14550), promoter and 5’UTR, while the 1054 bp downstream fragment contains the 3’UTR FveYUC10 (gene27796; FvH4_2g24750), FveYUC11 (gene06886; FvH4_4g17980), of AtAGL62. This ProAtAGL62::FveAGL62:terAtAGL62 chimeric gene was cloned FveTAR1 (gene31791/gene37056; FvH4_5g05900), FveTAA1 (gene03586; into pMDC9935 and transformed via floral dip into the Arabidopsis atagl62-2 FvH4_4g25850), FveGA20OX1c (gene19436; FvH4_7g12610), FveGA20OX1d (−/+) heterozygous plant. After germination on ½ MS medium with 30 µg/ml (gene13360; FvH4_7g28670), FveGA3OX1b (gene01060; FvH4_2g30010), Fve- hygromycin, the hygromycin-resistant seedlings were further genotyped using GA3OX1c (gene01059; FvH4_2g30020), FvePIN2 (gene12312; FvH4_4g06850), FvePP2a (gene03773; FvH4_4g27700). Salk022148/atagl62-2 T-DNA genotyping primers (Supplementary Table 1). 12 independent agl62-2−/− homozygote plants containing the ProA- tAGL62::FveAGL62:terAtAGL62 transgene were obtained and analyzed. 22 To analyze the auxin reporters (R2D2 or ProAtYUC10::3xnGFP) in atagl62-2 CRISPR and GUS constructs and transgenic strawberry generation. To gen- seeds, atagl62-2 (−/+) plants were crossed with plants harboring R2D2 or erate the F. vesca agl62 mutants, gRNA1 (GGGTGCGCAAGGCGAGCCAGGGG) ProAtYUC10::3xnGFP. The F1 plants containing both the atagl62-2 mutation and or gRNA3 (CTATCACAGACTCCACGCAGGGG) targeting the coding region of the reporter gene were confirmed by PCR and GFP fluorescence. F2 plants FveAGL62 were inserted into the JH4 entry vector and then incorporated into the homozygous for the reporter gene and heterozygous for the atagl62-2 mutation binary vector JH19 via gateway cloning34. To generate the fveagl80 mutant, one were obtained by genotyping and segregation. Homozygous ProAtYUC10::3xnGFP gRNA (CGATGGACTCCCAACGGGGAAGG) targeting the coding region of is necessary to avoid impacts of parental imprinting. Fertilized seeds from F2 plants FveAGL80 was inserted into the JH4 entry vector and then incorporated into the were analyzed under a Leica SP5X Confocal microscope (Leica Co. USA). binary vector JH19. To confirm editing, genomic sequences spanning the target site of respective genes were amplified by PCR and sequenced. All primers used in this  ghost. This reveals a prominent role of ghost in GA biosynthesis, a conclusion contrary to that of Csukasi et al. (2011). This il- lustrates the power of genome-wide studies in that they allow simultaneous examination of all family members. Taking advantage of the accessibility of achenes on the out- side surface of the receptacle, we were able to dissect the seed out of the achene and the embryo out of the seed. This provided 2024/12/17 us an unprecedented opportunity to resolve gene expression between embryo and the remaining seed (ghost) and enabled us to discover that ghosts likely play a more important role than the embryos in the synthesis of auxin and GA for fruit set. Such fine dissection and separation of embryos from remaining seeds would prove highly challenging in other fruit types, such as to- mato, the seeds of which are embedded and mixed with the internal tissues. Our study provides a wealth of genomic information on the Efek hormonal dari biji earliest stages of fruit development, which is an understudied but critically important area of fruit research. Past molecular studies have largely focused on the ripening of the strawberry fruit (Aharoni and O’Connell, 2002; Garcia-Gago et al., 2009). Pada stroberi, setiap achene memiliki satu The availability of our RNA-seq data to the entire research biji dan merangsang jaringan reseptakel community (via Sequence Read Archive at the National Center for Biotechnology Information (NCBI) or via http://bioinformatics. Normal, puluhan achenes untuk berkembang. Beberapa achenes dapat towson.edu/strawberry/Default.aspx) paves the way for future menghasilkan buah yang salah bentuk! functional dissection of genes and networks that regulate fruit set and fruit growth. Tiga achenes n of Embryo and Ghost. Satu achene ng sets of genes between upre- mbryo 3 and ghost 3 when each is Figure 10. A Model of Strawberry Fruit Development. Venn diagram are graphic repre- 47 different sets of genes with similar A diagram illustrating auxin and GA biosynthesis and transport in the 3 and ghost 3. Pink indicates upre- achene soon after fertilization. Fertilization-induced auxin and GA ac- white indicates no change. Number cumulation in the ghost are transported to the ovary wall (route 1) and the written beneath the seed diagram. receptacle (route 2), shown by the two red arrows. The arrow from auxin of embryo 3–abundant and ghost to GA within the ghost indicates the positive effect of auxin on GA bio- synthesis. In route 1 to the ovary wall, PIN-dependent transport of auxin may be necessary to promote local auxin and GA biosynthesis in the cultivated strawberry fruit de- ovary wall. In route 2 from ghost to receptacle, GA and auxin may be A3ox was expressed at a level transported via a PIN-independent mechanism (or both PIN-dependent han in the achene. They con- and independent mechanisms). Upon arriving at the receptacle, auxin the main source of GA bio- and GA exert their effects by stimulating downstream signaling events for ox1 is expressed at low levels receptacle growth. Perubahan hormon selama empat fase pertama perkembangan buah dalam tomat (Lycopersicon esculentum). 48 23  2024/12/17 Pengecualian! Buah dapat berkembang tanpa penyerbukan atau fertilisasi dan perkembangan biji à parthenocarpy From: parthenos (Gr., maiden) carpic (Gr., fruit) contoh: pisang, jeruk navel, anggur tanpa biji 49 49 Buah partenokarpi : Vegetatif partenocarpy - buah berkembang tanpa didahului oleh adanya polinasi, mis. Musa sp., Ananas comosus, Citrus Stimulatif partenokarpi - buah berkembang akibat adanya stimulasi polinasi tanpa dilanjutkan dengan adanya fertilisasi, mis. Poa sp. à Tabung polen – ezim untuk induksi produksi auksin Stenospermocarpic - buah berkembang akibat adanya polinasi dan fertilisasi, akan tetapi terjadi aborsi embrio sebelum buah dewasa, mis. Prunus, Vitis, Pyrus sp. Kadar auksin pada buah partenokarpi >> buah berbiji 50 50 24  2024/12/17 51 51 Keterbatasan buah tanpa biji Kurangnya stabilitas dan keseragaman dalam ekspresi Parthenocarpy Ekspresi Parthenocarpy dalam buah sangat bervariasi dan tidak stabil, seperti mangga, manggis. dll. Buah berukuran kecil Buah partenokarpik umumnya berukuran kecil à perubahan hormon dalam buah karena tidak adanya biji Buah cacat Buah partenokarpik kadang-kadang akan menghasilkan buah cacat à ketidakseimbangan hormon dalam perkembangan buah. produksi benih komersial Tanpa biji mengakibatkan produksi benih terhambat 53 25  10/12/24 1 Biji, õ berkembang dari ovulum (bakal biji) õ Berisi embrio dan cadangan makanan (endosperm, perisperm) õ Dorman saat dewasa Struktur Umum Biji 2 1  10/12/24 Pada biji terkandung tiga komponen yang berbeda secara genetik a. embryo, b. endosperm, c. Kulit biji/testa. 3 Schematic sketch of seed development in the model plant Arabidopsis. Sundaresan V PNAS 2005;102:17887-17888 ©2005 by National Academ y of Sciences 4 2  10/12/24 õ Biji exalbuminous, adalah biji yang hanya mengandung sedikit endosperm atau tidak ada sama sekali ô Mis. : Biji pada tumbuhan Fabaceae, Citrus (mengandung klorofil) õ Biji albuminous, adalah biji yang mengandung endoperm atau perispem ô Perisperm, jaringan nuselus yang persisten dan volumenya bertambah sejalan dengan perkembangan biji, misalnya pada tumbuhan Piperaceae, Nymphaeaceae 5 1. Eksternal (luar) a. arilus, jaringan yang berkembang pada permukaan biji Durio zibethinus, arilus tebal berdaging Nephelium lappaceum Myristica fragrans, arilus berdaging kering, berwarna merah è Elaeosoma, arilus yang mengandung minyak/lemak. ex. Trillium, Hyachintus Fungsi : penyebaran biji oleh semut 6 3  10/12/24 Arilus Arilus ariloid Berasal dari funikulus berasal dari bagian selain funikulus karunkula strophiola tumbuh dekat mikropil menempel pada raphe R. communis 7 b. Testa, berkembang dari satu atau 2 integumen, nuselus (kadang-kadang) A B Struktur anatomi kulit biji/testa. A. Sinapis alba; B. Citrus aurantiaca 8 4  10/12/24 õ Lapisan testa : ô Sarkotesta – lapisan terluar ô Sklerotesta – bagian tengah, tebal dan keras ô Endotesta – lapisan terdalam, selaput tipis & berdaging Pada Gnetum gnemon, ô sarkotesta, bagian terluar berwarna hijau/merah ô sklerotesta, bagian tengah, keras ô endotesta, berupa selaput tipis Pada Salacca edulis, sarkotesta – putih berdaging Pada Punica granatum, sarkotesta berair 9 c. Rambut atau sayap ó Gossypium – rambut ó Swietenia macrophylla – sayap d. Mikropil, pori/lubang tempat keluarnya radikula saat perkecambahan e. Hilum, tempat/sisa pelekatan (titik temu) funikulus dengan biji f. Raphe, bagian/tempat pelekatan funikulus dengan integumen. Mis., pada biji anatrop, kampilotrop 10 5  10/12/24 a. Endosperm (poliploid), hasil pembuahan inti polar + inti sperma penyimpanan cadangan makanan & nutrisi untuk embrio b. Pada beberapa tumbuhan dikotil, ex. Fabaceae, endosperm menghilang saat pendewasaan embrio c. Pada Nicotiana tabacum dan Ricinus communis, endosperm persisten dan besar. 11 õ Pada tumbuhan monokotil, endosperm mengisi 70% biomassa biji Endosperm lap. Aleuron – protein Endosperm – karbohidrat 12 6  10/12/24 õ Struktur endosperm, ô halus/rata (umum) ô ruminan, Annonaceae, Passifloraceae, Myristicaceae õ Sifat endosperm, ô farinosus (berbutir), ô carnosus (berdaging), R. communis, C. nucifera ô corneum (tanduk, keras) - Coffea arrabica ô lapideus (keras seperti batu) – Areca catechu ô aquosus (berair) – C. nucifera ô hyalinus (bening) – Arenga pinnata, lontar/siwalan 13 2. Embrio, bakal sporofit ô radikula ô plumula 3. Kotiledon, ô Merupakan daun pertama ô Tempat penyimpanan cadangan makanan ô Organ fotosintesis pertama untuk tumbuhan 14 7  10/12/24 Tujuan utama perkembangan biji : õ Pemantapan pola dasar tubuh tumbuhan, sumbu akar - pucuk õ Akumulasi cadangan makanan untuk proses perkecambahan õ Persiapan dormansi biji Selama perkembangan biji, embrio berdiferensiasi menjadi 2 sistem organ, yaitu : õ sumbu embrio. Sumbu embrio terdiri atas meristem akar dan pucuk yang akan membentuk tumbuhan dewasa setelah perkecambahan biji. õ Kotiledon, merupakan sistem organ yang berdiferensiasi paling akhir, yang akan mengalami penuaan setelah perkecambahan dan bertanggung jawab untuk mensintesis dan menyimpan cadangan makanan untuk proses perkecambahan. 15 16 8  10/12/24 è mencakup perkembangan dari saat fertilisasi sampai fase dormansi. è Peristiwa utama yang terjadi selama embriogenesis adalah : 1. Pemantapan bentuk dasar tumbuhan. ó Pola aksial à pembentukan sumbu basal-apikal (pucuk – akar) ó Pola radial menghasilkan tiga sistem jaringan 2. Penyusunan jaringan meristematik untuk mengelaborasi struktur setelah masa embrio (daun, akar, bunga dsb.). 3. Pemantapan penyimpanan cadangan makanan yang cukup untuk perkecambahan embrio sampai kecambah bersifat autotrof. 17 19 9  10/12/24 õ Pembelahan asimetris pada zigot bakal embrio suspensor õ Diferensiasi organ embrionik dan jaringan yang ada di dalamnya selama masa transisi dari stadium globular ke stadium jantung. Pola radial dan aksial. (a) Pola radial pada Angiospermae mulai pada saat stadium globular Perkembangan embrio stadium transisi dan menghasilkan tiga system jaringan. (b) Pola globular - jantung aksial (sumbu akar-pucuk) terbentuk saat stadium jantung. 20 õ Pada stadium torpedo, ô determinasi hipokotil dan radikula terjadi ô diferensiasi prokambium ô embrio berklorofil õ Pada beberapa tumbuhan, kotiledon tumbuh cukup lama sehingga kotiledon tersebut harus melengkung untuk menyesuaikan diri dengan bentuk bakal biji. Embrio kemudian menyerupai tongkat untuk berjalan. 21 10  10/12/24 22 22 Embriogenesis pada tumbuhan dikotil Embriogenesis pada tumbuhan monokotil 23 11  10/12/24 24 25 12  10/12/24 õ Three criteria that define a somatic embryo ô bipolar structure (shoot and root pole) ô no vascular connection to surrounding cells ô single-cell origin õ Potential applications to crop improvement ô haploids for breeding, mutant screening ô germplasm storage and preservation ô "artificial seeds" 26 õ "Artificial seeds" ô clonal propagation – theoretically much faster, easier to mechanize than micropropagation ô the alfalfa model ó callus initiation (using NAA) ó embryo induction (using 2,4-D) ó embryo formation (deleting 2,4-D), addition of ABA "normalizes" development ó embryo "conversion" – treatments to get greenhouse plantlets to 1st trifoliate leaf 27 13  10/12/24 õ Results have not lived up to the promise ô somatic embryos are highly susceptible to desiccation ô "conversion" rates are low ô shelf life is short ô encapsulation techniques have yet to be perfected õ Potential uses ô breeders might maintain elite genotypes more cheaply ô double-cross hybrid seed could be produced more efficiently 28 Fungsi kotiledon : menyokong tumbuhan à dapat menjadi daun fotosintetik ketika berkecambah õ Pada tumbuhan Pisum sativum (ercis) è kotiledon berfungsi sebagai tempat penyimpanan cadangan makanan untuk perkecambahan õ Pada tumbuhan monokotil è satu kotiledon yang berkembang (skutelum), membesar dan menekan endosperm, selanjutnya membantu transfer nutrisi dari endosperm pada saat perkecambahan. ô kotiledon à haustorium 29 14  10/12/24 30 Ketidakmampuan biji untuk berkecambah è kondisi fisik dan fisiologis pada biji yang mencegah perkecambahan pada waktu yang tidak tepat / sesuai è mempertahankan diri terhadap kondisi yang tidak sesuai (panas, dingin, kekeringan dll.) è Mekanisme biologis untuk menjamin perkecambahan biji berlangsung pada kondisi dan waktu yang tepat untuk mendukung pertumbuhan dan kesintasan yang tepat 31 15  10/12/24 Penyebab à ketidakmampuan sumbu embrio untuk mengatasi hambatan : õ endogen – embrio itu sendiri õ eksogen – jaringan di luar embrio Proses dormansi õ desikasi – berkurangnya kadar air dalam biji õ diferensiasi testa õ sintesis protein, transkripsi gen terhenti õ pengurangan laju respirasi dan proses metabolisme 32 Jenis Dormansi Biji Jenis dormansi Penyebab Eksogen Testa Fisik Impermeabilitas Kimiawi Inhibitor Mekanis Penghalang Endogen Jaringan embrio Morfologis Immature Fisiologis Kebutuhan metabolit 33 16  10/12/24 34 è Proses munculnya/keluarnya radikula dari dalam biji (melalui testa) yang diawali oleh masuknya air ke dalam biji (imbibisi) 35 17  10/12/24 36 is ys starch Fruit+Seed Coat r ol d maltose hy Endosperm sugar exocytosis Aleurone Layer cotyledon a-amylase monocot tion sla is lys tran shoot apex