Questions and Answers
Los fragmentos del DNA de un bacteriografo es insertado en la sección Crispr del sistema CRISPR-Cas
True
Una de las modificaciones de los snoRAs(Rna pequeños nucleares) amlos tRNAs de la célula en convertir uracilos a pseudoracil.
False
Todas son función de los RNA no codificamte excepto :
Todas la mencionadas son funciones
¿Cuál de las siguientes NO es una característica del codigo genético?
Signup and view all the answers
Las acetiltransferasas funcionarán directamente en cuál de los siguientes procesos.
Signup and view all the answers
Uno de los resultados de la unión de RISC al mRNA durante la interferencia del RNA es inhibir la traducción sin degradar el mRNA.
Signup and view all the answers
Ambos parentales (macho y hembra) usualmente generan impronta genómica del mismo gen.
Signup and view all the answers
¿Cuál de las horquillas formadas en el atenuador favorecerá que ocurra regulación por atenuación en el operón de triptófano (terminación del proceso)?
Signup and view all the answers
La impronta genómica es el resultado de:
Signup and view all the answers
¿Cual de las siguientes es la región donde se coloca la molécula reguladora del operón?
Signup and view all the answers
La formación del cuerpo de Bar permite que ambos sexos expresen cantidades diferantes de las proteinas asociadas a los genes que se encuentran localizados en el cromosoma X.
Signup and view all the answers
CRISP RNA guía la endonucleasa para que corte ONA extraño
Signup and view all the answers
La función de la secuencia Shine Delgarno en el mensajero procariota es permitir la alineación correcta entre el RNA mensajero y la subunidad grande del ribosoma.
Signup and view all the answers
Ocurrio una mutación en el gen que produce el represor del operon de lactosa que evita que el producto del gen se una a alolactosa. ¿Cómo será el nivel de expresión del operón en ausencia de lactosa?
Signup and view all the answers
EL RNA ribosomal 18S tendrá complementariedad de bases con la secuencia Kozak en eucariotas lo que permitirà la union del mensajero al ribosoma.
Signup and view all the answers
Las isla de GC están asociadas con
Signup and view all the answers
Se requieren 61 diferentes tRNA para la traducción tanto en la célula (in vivo) como en un ensayo (in vitro). Select one:
Signup and view all the answers
Las bacterias tienen un cRNA llamado Oxys que regulo la traducción al unirse a la secuencia Shine-Dalgerno, prevee que el ribosoma se pegue. ¿Cuál es la función de OxyS?
Signup and view all the answers
La enzima acetiltransferasa está directamente envuelta en
Signup and view all the answers
¿ Qué sucederia si una secuencia aislante entre dos genes está austente?
Signup and view all the answers
La alolactosa funciona como un inductor en el operon de lactosa, mientras que triptófano actúa como un corepresor en el operon de triptófano.
Signup and view all the answers
La modulación de los factores reguladores de transcripción es mediante una de las siguientes: unión de moléculas efectoras, interacción proteína-proteina o modificaciones covalentes.
Signup and view all the answers
La impronta genética se considera un ejemplo de regulación epigenética debido a que:
Signup and view all the answers
La regulación del operador en el operón de lactosa es un ejeropio de regulacion genética trans.
Signup and view all the answers
¿Cuál de las siguientes es cierta en relación con los poliribosomas?
Signup and view all the answers
piRNA (PIWI-RNA) su función es prever que se muevan elementos de trasposición.
Signup and view all the answers
LOS HOTAIR es Un NA no codificantes que funcionan en la alteración de la estructura de la cromátida inactivando la transcripción.
Signup and view all the answers
La peptidil transferasa que esta activo durante el proceso de sintesis de proteinas es una riboenzima.
Signup and view all the answers
La región o cegiones del tRNA que determinan cuál aminoácido será transportado por él es(son):
Signup and view all the answers
Signup and view all the answers
¿A qué nivel usted esperaría observar una regulación más eficiente?
Signup and view all the answers
Durante el proceso de elongación de la proteina la Peptidil transferasa transfiere el el polipeptido en formación del sitio P y se Transfiere al A del ribosoma
Signup and view all the answers
El tRNA cuyo anticodón es CCU puede leer los codones GOU, GGC y GGA. Esta situación ilustra:
Signup and view all the answers
¿Cuál de las siguientes no es un ejemplo de regulación a nivel de procesamiento del mRNA?
Signup and view all the answers
En una célula que está llevando a cabo el proceso de traducción se colocan cuatro IRNAs que producen la siguiente secuencia de anticodones: 3 UAC6' 3'GCU5* SAUA5 3'CUCE Basado en esta intormación indique la secuenca de codones en el mRNA que es complementaria a la secuencia de tRNA presentada anteriormente
Signup and view all the answers
Un gen produce un mensajero que debe tener 400 aminoácidos.En un organismo se produce una mutación que cambio el codón 300 por un codón de terminación usted esperaría que:
Signup and view all the answers
¿Cuái de las siguientes no es un ejemplo de regulación traduccional en procanotas?
Signup and view all the answers
El gen responsable de le atenuacion del operón de triptofano es trpl.
Signup and view all the answers
¿Cuál de las siguientes parejas de moléculas le permitirá regular un gen inducible bajo control negativo?
Signup and view all the answers
¿Cuál de las siglentes no es considerado un elemento regulador?
Signup and view all the answers
Las metilaciones del DNA son realizados por los factores de transcripción de regulación para influenciar la expresión gonética.
Signup and view all the answers
Una regulación alostérica se genera cuando_______
Signup and view all the answers
Un gen en particular tiene una mutación en su NFR (regiones libres de nucleosomas) generando una unión anormal con las histonas ¿ Que efecto esperaría tenga esta mutación en la expresión de ese gen?
Signup and view all the answers
¿Cuántos amino ácidos tendrá el polipéptido generado por la sigiente secuencia codificante de mRNA: 5- GCCACCAUGCGCGGCCAAUUACGAAGGUUUUGCUGAC CAGGUCAA-3'
Signup and view all the answers
Se dice que un alelo es paramutagénico cuando este cambia la expresión de otro alelo.
Signup and view all the answers
¿Cuál de las siguientes es importante en el proceso de impronta ("imprinting") genómico?
Signup and view all the answers
El RNA antisentido_______
Signup and view all the answers
Study Notes
CRISPR-Cas System
- The DNA fragment of a bacteriophage is inserted into the CRISPR section of the CRISPR-Cas system.
- CRISPR RNA guides the endonuclease to cut the DNA.
RNA Modification
- One of the modifications of snoRNAs is to convert uracils to pseudouridines in tRNAs.
- All snoRNAs are non-coding RNAs except for one.
Genetic Code
- One of the characteristics of the genetic code is not mentioned in the text.
- Acetyltransferases function directly in one of the following processes.
RNA Interference
- One of the results of RISC binding to mRNA during RNA interference is to inhibit translation without degrading the mRNA.
Genomic Imprinting
- Genomic imprinting is the result of differences in gene expression between parental alleles.
- Both parental alleles (male and female) usually generate genomic imprinting of the same gene.
Operon Regulation
- The formation of a stem-loop structure in the attenuator favors the occurrence of regulation by attenuation in the tryptophan operon.
- The regulatory molecule binds to the operator region of the operon.
- The lac operon is an example of transcriptional regulation.
tRNA and Ribosomes
- The function of the Shine-Dalgarno sequence in prokaryotic mRNA is to allow correct alignment between the mRNA and the large subunit of the ribosome.
- The 18S rRNA has complementarity with the Kozak sequence in eukaryotes, allowing the binding of the mRNA to the ribosome.
Transcriptional Regulation
- The modulation of transcription factors is through one of the following: binding of effector molecules, protein-protein interactions, or covalent modifications.
- The lac operon is an example of transcriptional regulation, and the trp operon is an example of transcriptional regulation by repression.
Epigenetic Regulation
- Genomic imprinting is considered an example of epigenetic regulation because it affects gene expression without altering the DNA sequence.
- The HOTAIR is a non-coding RNA that functions in altering chromatin structure, inactivating transcription.
Protein Synthesis
- Peptidyl transferase is a riboenzyme that is active during protein synthesis.
- The region of the tRNA that determines which amino acid will be transported by it is the anticodon.
Translation Regulation
- One of the following is not an example of translational regulation in prokaryotes.
- The binding of the regulator molecule to the operator region of the operon is an example of translational regulation.
Regulatory Elements
- The trpl gene is responsible for the attenuation of the tryptophan operon.
- The following is not considered a regulatory element: metylation of DNA.
Gene Regulation
- A mutation in the NFR (nucleosome-free region) of a gene can affect the expression of that gene.
- The regulation of gene expression can occur at multiple levels, including transcriptional and translational regulation.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
Description
Test your knowledge on the insertion of bacteriophage DNA fragments into the Crispr section of the CRISPR-Cas system. Explore how this process impacts genetic engineering and immunity in bacteria.
