DNA Week 4 PDF

Explain the structure of DNA explain how DNA profiling works: STRs and PCR make paternity/ maternity predictions describe the role of databases Which is the odd one out? Forensic Science: DNA Human body contains about 60 trillion cells 60,000,000,000,000...

Explain the structure of DNA explain how DNA profiling works: STRs and PCR make paternity/ maternity predictions describe the role of databases Which is the odd one out? Forensic Science: DNA Human body contains about 60 trillion cells 60,000,000,000,000 no nucleus no part ~ , Each cell (except red blood cells) contains your genetic material in its nucleus: 23 pairs of chromosomes, weighing 7 pg You cannot find DNA directly at the crime scene. You can find biological material that contains DNA: blood, semen, saliva, skin cells, hair (sometimes), body parts humans - 23 pairs of chromosomes 22 pairs autosomal (non-sex) 2 sex determining chromosomes male XY, female XX (Y is smaller and different shape) Different size and shape, largest denoted 1 etc. Different chromosomes contain different genes Pairs of chromosomes are described as homologous as they have the same size and contain the same genetic structure. One is inherited from the mother and the other from the father. When chromosomes are stained with fluorescent dyes they develop distinctive patterns of bright and dark bands What are chromosomes ? Chromosomes In nucleated cells, nuclear DNA is packaged in specific structural units called chromosomes. Within each one, the DNA is wound around small proteins called histones. Genes The DNA material in chromosomes is composed of 'coding' and 'non-coding' regions. The coding regions are known as genes. 5 % Genes range from 1000- 10,000 base pairs in size. The number of genes in the genome varies from species to species. More complex organisms tend to have more genes. Bacteria have several hundred to several thousand, humans have approx. 30,000. Non-protein coding regions of DNA (approx 95 %) – “junk” DNA The Human Genome A genome is all the genetic material. It is the entire set of hereditary instructions for building, running, and maintaining an organism, and passing life on to the next generation. the genome is divided into chromosomes; chromosomes contain genes, and genes are made of DNA. What is DNA made of? A sugar, a phosphate, a base = a nucleotide DNA is a polymer of nucleotides The sugar is 2-deoxyribose ribose 2-deoxyribose A phosphate found in Pat ester of 2- deoxyribose What is DNA made of? Nucleotide Which bases? adenine guanine cytosine thymine What is DNA made of? Therefore, we have four nucleotides A G C T  A What is DNA made of? G C T DNA is made of the four nucleotides in polymer chains. The phosphate links the sugars What is a double helix? DNA consists of two chains wound together, held in place by hydrogen bonds -not chemical bonds brong as a betwe 120 molecules ~ hydrogen bonding makes water a liquid The bases in DNA hydrogen bond to each other What is a double helix? But pairing of A and T or C and G is favoured (complementary base pairing) T 24 bonds C A G 3 H bonds Human DNA has about 3 billion base pairs Paris japonica: 150 billion base pairs: 91 metres long What is a double helix? the double helix is held together by hydrogen bonding  The Genetic Code We can write the code using the four letters A,T,C and G -C-C-T-G-A-G-G-A-G- A group of three letters (three nucleotides) codes for an amino acid in a protein -proline-glutamate-glutamate-  The Genetic Code -proline-glutamate-glutamate- Is part of haemoglobin (so CCTGAGGAG is part of the gene for haemoglobin) If one letter is wrong, a different amino acid will be in the chain of the haemoglobin -C-C-T-G-T-G-G-A-G- Codes for -proline-valine-glutamate- And causes sickle cell anaemia DNA “Fingerprinting” /put profiling Junk DNA has Uses Junk DNA but not variability so much variability in coding reg Sir Alec Jefferys (U. of Leicester) Restriction Fragment Length Polymorphism (RFLP) Needs blood or semen sample not very sensitive about the size of a dollar coin tech , req amt large of sample Gel electrophoresis and RFLP  Gel electrophoresis and RFLP short length of DNA which incorporates ~ a radioactive afor For Bill Clinton, the FBI used probe to e is part complementary of interest 7 probes 2 CBP by (1 in 8 trillion) more probes you use , more reliable The RFLP process for DNA analysis  Gel Electrophoresis 2.Load samples in the well 3.Add standards for comparison to other wells 5.Electric field is applied across the gel, bec DNA is a -ve charged molecule, the DNA fragments will migrate through the gel from -ve to +ve pole Diff fragments of DNA bec they are of diff sizes will migrate at diff rates 6.Diff fragments of DNA migrated diff distances Capillary Gel Electrophoresis Voltages is applied across the length of the tubing, the sample enters the -ve terminal, the diff DNA fragments then migrate along the length of the tubing towards the +ve terminal As they past a particular point, they can be detected using UV light as DNA fragments absorb UV and diff peaks is observed according to the diff fragments PCR (Polymerase chain reaction) Allows a specific region of DNA to be repeatedly duplicated. 25-30 cycles of PCR will give 1,000,000 copies Can analyse very small amounts: 36 cells (maybe even 9 - low copy number) saliva from cigarette ends, backs of stamps, barely visible blood stains PCR (Polymerase chain reaction) Each single cycle takes about 5 mins. Heating & cooling cycle Thermal cycler  PCR = polymerase chain reaction -GTCTCAGGTTCCAG- -GTCTCAGGTTCCAG- 94ºC -CAGAGTCCAAGGTC- -CAGAGTCCAAGGTC- double stranded DNA separate strands shortlengths D terest th nucleotides - adds -GTCTCAGGTTCCAG- ~ add DNA polymerase to primer by add primers CAGA and -CAGA enzyme CBP strand along CCAG add G, A, T and C 60ºC CCAG- 72ºC -CAGAGTCCAAGGTC- -GTCTCAGGTTCCAG- -GTCTCAGGTTCCAG- -CAGAGTCCAAGGTC- -CAGAGTCCAAGGTC- 2x copies of original DNA Short Tandem Repeats STRs are repeating lengths of base pairs (3-7) in blocks up to 400 in total AATGAATGAATGAATGAATGAATGAATG… (THO1) from person to person Vary by number of repeats: 1 e.g THO1 6,8 has sequences repeats of six and eight: repeats 1 6 from one parent; 8 from the other 1 THO1 6,8 is found in about 4% of people Short Tandem Repeats There are many known STRs ~ using multipleprosa Multiplexing: simultaneous analysis of multiple STRs U.S. National Database uses 13; UK uses 10 more sirs analysed , odds e higher For 3 STRs 1 in 5,000 you have of something 6 STRs 1 in 2,000,000 - unique 9 STRs 1 in 1,000,0000,000 13 STRs 1 in 100s of trillions world popl : 7 billion  STR and capillary gel electrophoresis Str will appear in pairs 3 STRs here Pairs: one in each pair from mother, the other from father STR and capillary gel electrophoresis  in this case : STR from mother & Paternity and Maternity Testing father 6 is 6/8 i salve 8 instead of a STRs of child must match both parents g e ,. peak but. , , pair it is overlaps a single bigger (pair perfectly from mother & other child one from father in each pair nature randomly selects one mother from each pair in mother combined & father , they to give ESTR in e part of i child father perfect match ! child of these I adults ! Biological Paternity and Maternity Testing child mother match ! Not complete match ! alleged father ! father NotI relate toa child some match due to chances some Brothers and sisters STR of sibling sibling some matches I child that of & some do not this is be ? when I STR froe mother & father child come together to give STR ofI child there is , randomness mother To prove that I people DMA siblings using : are father X compare PMA of 2 people ~ compare DNA of :2 people toe Dont of theirparents (to prove that are children they ofI same parents)  Where does your DNA come from? half from your mother and half from your father - randomly So brothers or sisters will have different DNA Except identical twins they have identical part , as they Sathis and Sabarish Raj from I same & same come egg sperm which splits after concepts criminal justice system as they are not easily distinguish problems for Marseilles Case 2013: identical twins, Elwin and Yoan Gomis, arrested for rape & sexual assault: CCTV and witnesses there small diff in are i genome still be? of copying errors ~ solt whole genome sequencing: €1,000,000 or more? & too expensive confession Colin Pitchfork Narborough, England 1983 Body of Lynda Mann (15) found – rape, murder Killer was blood type A 1986 Dawn Ashworth (15) A local boy, Richard Buckland, confesses to Dawn’s murder, but not Lynda’s Colin Pitchfork Alec Jeffreys was asked to help: him innocent not Richard , proved ~ DNA of suspect does not match either! But same man killed both ~ assuming murdererstate 1987 – DNA screening of all type A in the locality not murderer >1000 men tested – no matches incorrect is maybe assumpti ~ are , a local need to screen only men in certain age ranges, not too young Colin Pitchfork Ian Kelly (in the pub) admits to giving blood sample under the name of a colleague, Colin Pitchfork Pitchfork arrested and his DNA tested: match Confesses to both murders Life in prison; minimum 30 years DNA databases Many countries have databases of the DNA of known criminals (UK 1995) DNA from the crime Take DNA from the crime scene scene Check against database database If culprit has a criminal record, a match will be found suspect Also cold cases if the evidence has been preserved Lesley Molseed 1975 (example of cold case) Sexually assaulted and stabbed to death in 1975 & noPMA database yet , Ronald had no criminal record yet Stefan Kiszko – DNA match to wrongfully Ronald imprisoned for 16 Castree in years 2006 I he acquired a criminal record in e years that had a passed DNA submitted to e database years later identified him Lesley Molseed 1975 Problem number 1: most of the original witnesses are dead! Last living witness who visited the crime scene is Ronald Outerridge (rtd) Cretired E DMA comes from sexual assault ~ Problem number 2: is there proof that the sexual assault and the murder were done by the same person? "To do that it would be necessary to prove that the semen was deposited during the murder of the little girl and I found no evidence to show that was the case. It might have been, it might not." & not reasonable doubt : L Convicted: 30 years http://news.bbc.co.uk/2/hi/uk_news/england/west_yorkshire/7062395.stm- The Yorkshire Ripper Hoaxer serial killer Yorkshire, England –1975 onwards A series of prostitutes and others are murdered “Yorkshire Ripper” little/ link betw criminal no & victim 1978: Several letters are sent to the police, and a tape – believed to be genuine The accent (Geordie) sends police in the wrong direction The “Yorkshire Ripper” (Peter Sutcliffe) eventually arrested in 1981, 7 attacks including 3 murders later The Yorkshire Ripper Hoaxer 2005 Hoaxer case reopened DNA from the envelope matches a known criminal, John Humble 8 years in prison for “Perverting the Course of Justice” Kirk Bloodsworth Baltimore County, MD, USA 1985: Found guilty of rape-murder of Dawn Hamilton (9 years old) 1986: Conviction quashed (technicality) Retried: found guilty again - confirmed on appeal 1993: DNA tests of semen in the underwear - not a match released 2003: DNA ran through National Databank - matches Kimberly Shay Ruffner James Bain Florida, USA 1974: Found guilty of rape of a boy: identified by eye-witnesses 2009: released due to DNA evidence Compensation = 35 x $50,000 = $1.75M http://www.miamiherald.com/news/breaking-news/story/1386533.html http://news.bbc.co.uk/2/hi/americas/8419854.stm  genetic genealogy Even your relatives can give you away…… even though you may not be in e database, relatives be your may 1988 Lynette White , they will be similarities of DNA Stabbed to death Dont their w your Three men convicted…conviction quashed on appeal from blood stains , murderer's - blood as 2000 Crime scene reinvestigated – DNA sample found na cut probably himself I matched samples found blood matched on evictim's clothes ; cardboard box ; cigarette packet wrapper ; by accident wall ; exit route ; front door no perfect match in the database < has no criminal record person Even your relatives can give you away…… DNA shows unusual feature FGA27 in , 1 100 people 600 people in database match this 70 short listed 1 stands out his mother does not Teenager with a motoring offence have FGA27 but he from his father, Not born at the time of the murder got it his father is not e murderer Jeffrey Gafoor, his Uncle, convicted & father's brother , has FLA27 and his DNA was a matched Familial DNA “Golden State Killer” DNA from active 1974- the crime national database 1986 scene private databases: genealogy database Joseph James family group size e of DeAngelo i reduce gup by looking & arrested 2018 alibi age gender locate , , , suspect or suspects DNA comparison Mitochondrial DNA (mtDNA) A circular genome located in the mitochondria 16 569 bases, 37 genes Non-coding region known as the 'D-loop' exhibits variation between unrelated individuals of about 1–3% Higher copy number per cell and so more resistant to sample degradation than nuclear DNA mtDNA is inherited strictly from mother Not unique to an individual -not part same faster mutation than nuclear DNA as your mother & grandmother etc. conserved alonge maternal live) The Romanovs - Russia’s Imperial family Romanov family murdered/executed during the Russian Revolution, 1918.  - share MEDA w ~ share me DNA same me DNA child i child passed down Princess Alice & his me also matched e adult female & mtDNA of Princess Alice it is proves her mtDNA matched Tsarina E mtDNA from E Alexandra bones of e as they adult male share same those proving remains were Tsar Nicholas I mtDNA from Princess Alice The Romanovs - Russia’s Imperial family Did the Grand Duchess Anastasia survive? Berlin, 1920s, “Anna Anderson” claims to be Anastasia Dies, Virginia, USA, 1986 DNA testing of a surgical sample matches Franziska Schanzkowska She was not Anastasia How long can DNA survive? no simple ans Neanderthal DNA some nuclear and mitochondrial about 45,000 years Siberia 100,000,000 years? 300,000 years DNA is a relatively stable molecule survive for many years & can many Richard III, 1452-1485, King of England 1483-1485 Killed in the Battle of Bosworth, 22nd August 1485 Henry became King Buried in nearby Greyfriars Monastery Church, Leicester ~ public relates …..bad PR from Shakespeare &as he wrote a play Richard # abt as a villain Church demolished 1530s, grave site lost!  Richard III, 1452-1485, King of England 1483-1485 Location identified from old maps e church became a council carpark Excavation reveals a skeleton, But is it Richard? of church Location: the choir, but buried carelessly,1 facial reconstruct no shroud or coffin matches date Age: C dating 1456-1530 of Richard III's 14 ~ death Skeleton: late 20s-late 30s; scoliosis & Injuries: ten wounds, eight to the skull (Richard violent death consistent to battle , King in was in his mid 30s when he was killed e spine causing curvature of t shoulders to be http://www.le.ac.uk/richardiii/index.html uneven snakespear portrayed Richard as a http://antiquity.ac.uk/ant/087/ant0870519.htm ( hunched of e back scoliosis , suggesting an exaggerate noticable asymmetry Richard III, 1452-1485, King of England 1483-1485 they share otbart from secily DNA - mitochondrial he sharesmtDart Richard # i Cecily & http://www.le.ac.uk/richardiii/index.html I Skeleton is everything proves that King Richard Peter Falconio and Joanne Lees Australia’s Northern territory, 2001 stopped by the driver of another vehicle Peter taken out of sight; shot Joanne: hands tied escapes, hides in the bush picked up by a truck driver later No body ever found one blood stain no witnesses http://news.bbc.co.uk/go/pr/fr/-/2/hi/asia-pacific/4524084.stm Peter Falconio and Joanne Lees Drug smuggler Bradley Murdoch arrested Can he be linked to the scene? 1. his blood on her tee-shirt 150,000,000,000,000,000:1 of being someone else’s chances were negligible 2. The gear stick of the camper van & his Do was found here 3. the strap: low copy number DNA Joanne Lees Dr Peter Thatcher Bradley Murdoch 100,000,000:1 Peter Falconio and Joanne Lees 1. his blood on her tee-shirt without DNA technology 150,000,000,000,000,000:1 30:1 at best of being someone else’s & : case where he has 2. The gear stick of their camper van I rarest blood type Without DNA - zero 3. the strap: low copy number DNA Joanne Lees Dr Peter Thatcher without DNA technology Bradley Murdoch no use as evidence 100,000,000:1 evidence 2 & 3 absolutely tied Bradley toi crime scene 28+ years in prison without DNA technology no case “One of these things by itself might not have been enough. Put together there was a very damning case” - Rex Wild QC Non-Human DNA: Maricopa Case May of 1992, Denise Johnson: her body dumped at an abandoned factory in Maricopa County, Arizona, U.S. - strangled Suspect: Mark Bogan Denied ever having been at the site where the body was found – his pager was there Seed pods from the palo verde tree were recovered from the back of the suspect's truck. Through DNA typing these were matched to an individual tree at the crime scene under which the victim's body had been found. there is variati betw inde trees DNA Paternity and maternity Changed police work – 9 cells can be a “trace” wPCR DNA databases – solving many cold cases & current cases Familial DNA historical cases ~ mainly mitochondrial DNA non-human DNA