Week 1 Evolution of evolution 2024.pdf

Population Genetics & Molecular Evolution Welcome to Population Genetics & Molecular Evolution! David Groth (UC) [email protected] Ayeisha Milligan-Armstrong [email protected] Keea Inder-Smith Keea.Inder-Smith@...

Population Genetics & Molecular Evolution Welcome to Population Genetics & Molecular Evolution! David Groth (UC) [email protected] Ayeisha Milligan-Armstrong [email protected] Keea Inder-Smith [email protected] Ross Graham [email protected] 24:1-19 (2018) Assessments Textbooks  The Impact of New Idea “Man’s mind, once stretched by a new idea, never regains its original dimensions” Oliver Wendell Holmes This unit has many new ideas. Enjoy! Population Genetics & Molecular Evolution The Evolution of Evolution Ross Graham [email protected]  The Universe in Darwin’s Time The Scala Naturae: the scale of nature or natural order (Aristotle) God angels animals plants minerals www.retinalphysician.com/articleviewer.aspx?articleID=100737 http://en.wikipedia.org/wiki/File:BonnetChain.jpg © RM Graham  Linnaeus’ Species Concept Carl Linnaeus: Swedish botanist responsible for modern binomial nomenclature of species en.wikipedia.org/wiki/File:Carl_von_Linné.jpg “Species tot sunt, quot diversas formas ab initio produxit Infinitum Ens, quae formae, secundum generationis inditas leges produxere plures, at sibi semper similes” “species are distinguishable or diagnosable forms, which were from the beginning created by God, reproducing themselves forever in like form” Mallet , Systematics & Biodiversity 1:441-52, 2004 © RM Graham  The Paradox of Linnaeus Linnaeus proposed that species were created anew by God THEREFORE species are independent of each other BUT... He then invented a hierarchical structure based on degrees of similarity best explained by a shared ancestry. © RM Graham  There have been many proponents of Evolution Early Times speculated in history, perhaps even by the Greeks Erasmus Darwin (1731 - 1802) long history of life originating from a common source Jean Baptiste de Lamarck (1744 - 1829) first comprehensive theory of evolution - based on inheritance of acquired characteristics Alfred Russel Wallace (1823 - 1913) Charles Darwin (1809 - 1882) co-proponents of evolution by natural selection © RM Graham  There have been many proponents of Evolution Jean Baptiste de Lamarck (1744 - 1829) first comprehensive theory of evolution - based on inheritance of acquired characteristics 1809: Published Philosophie Zoologique Transmutation: “tendency to progression” blackwellpublishing.com/ridley/a-z/lamarck.asp Each generation improved upon its predecessor, leaving a hole that needed to be filled © RM Graham  There have been many proponents of Evolution Jean Baptiste de Lamarck (1744 - 1829) first comprehensive theory of evolution - based on inheritance of acquired characteristics “Inheritance of acquired characteristics”: characteristics acquired for survival passed on to next generation Many examples of this: Webbed feet / long legs of wading birds Long neck of giraffes blackwellpublishing.com/ridley/a-z/lamarck.asp Legless snakes Lamarckian evolution has been discredited since the time of Darwin, but is now being revisited. © RM Graham  There have been many proponents of Evolution Alfred Russel Wallace (1823 - 1913) Charles Darwin (1809 - 1882) co-proponents of evolution by natural selection http://www.victorianweb.org/science © RM Graham  There have been many proponents of Evolution Alfred Russel Wallace (1823 - 1913) Charles Darwin (1809 - 1882) co-proponents of evolution by natural selection Darwinian evolution is based on three principles 1. All species produce an excess of offspring (under favourable conditions population growth is exponential) 2. Organisms vary in their ability to survive and reproduce (observed in practice) 3.Variation in the ability to survive and reproduce is, at least in part, inherited (ie. genetic; much experimental evidence supporting this premise) © RM Graham  There have been many proponents of Evolution Alfred Russel Wallace (1823 - 1913) Charles Darwin (1809 - 1882) co-proponents of evolution by natural selection All species produce an excess of offspring Organisms vary in their ability to survive and reproduce “As many more individuals of each species are born than can possibly survive, and as consequently there is a frequently recurring struggle for existence, it follows that any being, if it vary in any manner profitable to itself, under the complex and sometimes varying conditions of life, will have a better chance of survival and thus be naturally selected. From the strong principle of inheritance, any selected variety will tend to propagate its new and modified form.” Variation in the ability to survive and reproduce is, at least in part, inherited From: On the Origin of Species, 1859 © RM Graham  Evolution by Natural Selection 1. Populations have the potential to increase exponentially ⎫ ⎬ THEREFORE Only some individuals survive. There is a struggle 2. Population size is relatively constant for existence amongst individuals in a population 3. Natural resources are limited (Malthus) ⎭ + 4. Individuals within a species vary: some variation is inherited (from breeders and observation of variation in natural populations) THEREFORE Favoured individuals (best variations) survive and reproduce (ie. natural selection: A NON RANDOM PROCESS). HENCE Favourable variations accumulate over many generations. This is now called this EVOLUTION BY NATURAL SELECTION © RM Graham  Evolution by Natural Selection Evolution requires inherited variation Results in transmutation of species and is driven by differential reproduction of genotypes of varying fitness. Hence, evolution will NOT PROGRESS unless there is a continuing source of inherited variation to drive it. EVOLUTION The ultimate source of all genetic variation is www.123rf.com/photo_6460289 © RM Graham  Evolution, Fitness and Populations Evolution progresses by the preferential (differential) reproduction of individuals with genotypes manifesting greater fitness. Fitness is measured by the propensity of individuals to produce thriving offspring. Fitness: the relative number of offspring of an individual having a given genotype which survive to reproduce successfully as compared to the number for an individual of some other genotype. Oxford English Dictionary Population: a naturally interbreeding group of individuals of a given species that exists together in time and space. © RM Graham  Evolution in Recent Human History Evolution is simply a change in gene frequencies between generations - but may take many generations to be seen. occurs in the prevailing environment - physical, local, social and cultural. Recent evolutionary changes in humans (≤50,000 years) are many: - disease resistance - increases in fecundity - responses to cultural changes - changes in cognitive behaviour © RM Graham  Somatic Cells v Germ Cells Tissues are made up of SOMATIC cells Human somatic cells have two copies of each chromosome (2 x 23 = 46) Therefore, they are DIPLOID Sperm and ova are GERM CELLS Human germ cells have only one copy of each chromosome (1 x 23 = 23) Therefore, they are HAPLOID © RM Graham  Cell Proliferation Tissues are made up of SOMATIC cells Somatic cells proliferate by mitosis Sperm and ova are GERM CELLS Germ cells are formed by meiosis, which entails two sequential cell divisions Germ cell precursors are diploid and proliferate by mitosis When germ cell precursors undergo division to form germ cells, they undergo meiosis © RM Graham  Recombination of Homologous Chromosomes in Meiosis Recombination of homologous chromosomes is a very important source of genetic diversity in most eukaryotic organisms © RM Graham  Weismann’s Barrier Germ-plasm Theory (1893): only germ cells pass genetic information to the next generation, somatic cells do not. WEISMANN’S BARRIER GERM LINE CELLS (sperm, ova) SOMATIC CELLS flow of genetic information after: J. Weatherall (2012) Weismann’s Barrier Solana J. Evodevo. 2013;4:2. DOI:10.1186/2041-9139-4-2 directs the flow of genetic information © RM Graham  More Definitions Locus: The location of a sequence or place of interest on a chromosome 7q22: TFR2 locus ≠ gene Allele: Each of two or more alternative forms of a gene... Oxford English Dictionary © RM Graham  Mendel’s Laws Gregor Mendel (1822 - 1884) 1. Segregation An offspring receives a random copy of an allele from each of its parents 2. Independent Assortment Genes (on different chromosomes) are transmitted independently https://www.abc.net.au/radionational/programs/scienceshow/celebrating-gregor-mendel-the-father-of-genetics/101797682 © RM Graham  Mendel’s Laws 1. Segregation An offspring receives a random copy of an allele from each of its parents Meiosis: the process by which gametes are produced duplication crossing- segregation over © RM Graham http://php.med.unsw.edu.au/embryology/images/3/38/Mitosis_and_meiosis.jpg  Mendel’s Laws Meiosis © RM Graham  Mendel’s Laws 2. Independent Assortment Genes (on different chromosomes) are transmitted independently E allele: Black eyes (dominant); Red eyes (recessive) Ee Ee Mr Mouse Mrs Mouse after: mathbench.umd.edu/modules/prob-stat_punnett-squares_intro/page13.htm © RM Graham  Dad E e E Mum e Punnett Square © RM Graham  Mendel’s Laws Ee Ee Mr Mouse Mrs Mouse ? ? after: mathbench.umd.edu/modules/prob-stat_punnett-squares_intro/page13.htm © RM Graham  Mendel’s Laws 2. Independent Assortment Genes (on different chromosomes) are transmitted independently E allele: Black eyes (dominant); Red eyes (recessive) T allele: Normal teeth (dominant);Vampire teeth (recessive) EeTt EeTt Mr Mouse Mrs Mouse after: mathbench.umd.edu/modules/prob-stat_punnett-squares_intro/page13.htm © RM Graham  Dad ET Et eT et ET Et Mum eT et © RM Graham  Mendel’s Laws 2. Independent Assortment Genes (on different chromosomes) are transmitted independently E allele: Black eyes (dominant); Red eyes (recessive) T allele: Normal teeth (dominant);Vampire teeth (recessive) EeTt EeTt Mr Mouse Mrs Mouse ? ? ? ? after: mathbench.umd.edu/modules/prob-stat_punnett-squares_intro/page13.htm © RM Graham  Even More Definitions Genotype: 1. the genetic constitution of an organism, esp. as distinguished from its phenotype 2. all of the genes present in an organism or species 3. the specific alleles present at a given locus. Oxford English Dictionary An allele refers to a single copy of a gene A genotype refers to the combination of alleles E and e are alleles. EE, Ee and ee are genotypes. © RM Graham  Even More Definitions Dihybrid: A hybrid that is heterozygous with respect to two independent genes. Oxford English Dictionary “In the dihybrid cases...the two pairs of characters behaved quite independently, in so far as the process of segregation was concerned.” RC Punnett, Mendelism, 2nd ed, 1907 True breeding: Producing offspring whose phenotypes are identical to those of the parents. Homozygous individuals necessarily breed true (unless mutations arise), whereas heterozygotes rarely do so. Oxford Reference © RM Graham  The Critical Step in Biological Inheritance In sexual reproduction, a paternal haploid sperm fertilises a maternal haploid ovum to form a diploid ZYGOTE, which subsequently develops into a new individual. dnalc.org/view/16240-Gallery-8-Sperm-fertilzing-an-egg.html php.med.unsw.edu.au/embryology/index.php? title=File:Human_zygote_two_pronuclei_03.jpg The observable inherited characteristics of progeny (phenotypes) are determined jointly by the genetic inheritance (nature) received from both parents (genotypes) and environmental stimuli (nurture). © RM Graham  Genetic Variation in Species A population is an inter-breeding group of individuals It is observed that alleles (variants of genes) almost always occur within populations The genetic composition of the population is characterised by the alleles present and their frequencies since this determines the proportions of genotypes in the population. Alleles arise by mutation and may subsequently increase in frequency by means of evolution. © RM Graham Population Genetics & Molecular Evolution Genetic Polymorphisms Ross Graham [email protected]  Polymorphisms at the Molecular Level Imagine you are looking down on a collection of human chromosomes with magic glasses You can see the difference between the DNA base sequences at any one place (a locus) These differences are polymorphisms What do they look like? © RM Graham  Size Range Structural Variations submicroscopic microscope-visible CNVs > 3Mb CNVs DNA sequence length 1 10 100 kb Mb Gb Chromosome 21 Chromosome 1 SNP RFLP STRs Genome large CNVs Minisatellites >50 kb small indels © RM Graham  Types of Genetic Polymorphisms Base substitutions SNPs, RFLPs, small indels Copy Number Variations (CNVs) Small size: variable number tandem repeats (VNTRs) Short tandem repeats (STRs; microsatellites) Long terminal repeats (minisatellites) Large size: chromosome fragments some viral insertions dispersed repeats (LINEs and SINEs) © RM Graham  Chromosome Translocations courtesy: Mahony Fenn © RM Graham  Single Nucleotide Polymorphisms aka “SNP” Mutations which arise from a mutation at a specific residue site Usually thought of as a base mutation, but may be an indel (insertion or deletion) Convention says that a mutation becomes a SNP when its frequency is ≥0.01 [This is an arbitrary value] Synonymous and non-synonymous Usually identified (typed) by direct, automated sequencing of a DNA fragment © RM Graham  Single Nucleotide Polymorphisms Observed by comparison of nucleotide sequences of 5 chromosomes. [SNPs are usually di-allelic and codominant.] 5’..GTTAATTTGATGAATGG..3’ 5’..GTTAATTTGATGAATGG..3’ 5’..GTTAATTTGGTGAATGG..3’ 5’..GTTAATTTGGTGAATGG..3’ 5’..GTTAATTTGATGAATGG..3’ © RM Graham  Variable Number Tandem Repeat Polymorphisms Characterised by variation in the number of tandemly repeating sequence motifs present at a given locus. Two main families of VNTRs - Minisatellites (LTRs) and Microsatellites (STRs) Tandem Repeats Dispersed Repeats © RM Graham  Short Tandem Repeats (STRs) aka “microsatellites” STR loci usually manifest extensive polymorphism Characterised by DNA fragment length polymorphism due to variable numbers of tandemly repeating (VNTR) short motifs (1 to ~7 base pairs) } 4 repeat units Chromosome N (haplotype) Diploid 7 repeat units Autosome Chromosome N Genotype (4,7) (haplotype) eg (CTTTC)n pentanucleotide repeat motif © RM Graham eg in NOS2 promoter  Features of STRs Dinucleotide freq > Trinucleotide freq > Tetranucleotide freq > 5, 6, 7 bp etc May be genotyped by PCR with locus specific primers Trinucleotide STRs often cause disease so these are not used as genetic markers Mutation rate for STR loci is HIGH: ~10-3 to 10-4 per meiosis – this follows from their stepwise mutation mechanism STR assays are usually multiplexed – many loci may be genotyped in one assay Polymorphic loci exhibit from 2 to >50 alleles and are the basis of contemporary DNA profiling May be used for disease gene mapping (by linkage analysis) © RM Graham  D1S80 Minisatellite locus 24 repeats of a 16bp motif GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGAATGACTCAGGAGCGTATTCCCCACGCGCCAGCACTGCA TTCAGATAAGCGCTGGCTCAGT GTCAGCCCAAGGAAGA CAGACCACAGGCAAGG AGGACCACCGGAAAGG AAGACCACCGGAAAGG AAGACCACCGGAAAGG AAGACCACAGGCAAGG PCR AMPLIFIABLE (allele length ≈ 200 - 1000bp). AGGACCACCGGAAAGG AAGACCACCGGCAAGG AGGACCACCGGCAAGG Oligonucleotide primers are underlined. AGGACCACCAGGAAGG AGGACCACCAGCAAGG AGGACCACCAGCAAGG The allele shown here has 24 repeats AGGACCACCAGGAAGG AGGACCACCAGGAAGG AGGACCACCGGCAAGG AGGACCACCAGGAAGG AGGACCACCAGGAAGG AGGACCACCGGCAAGG AGGACCACCAGGAAGG AGAACCACCAGGAAGG AGGACCACCAGGAAGG AGGACCACCAGGAAGG AGGACCACTGGCAAGG AAGACCACCGGCAAGC CTGCAAGGGGCACGTGCATCTCCAACAAGAC Kasai et al, J Forensic Sci, 35:1196 (1990) © RM Graham  A short history of VNTR loci 1980: Ray White and David Botstein describe the first highly polymorphic DNA locus now called D2S44. Much later the basis of its polymorphism was shown to be a minisatellite VNTR. 1985: Alec Jeffreys discovers - and patents - the first two DNA probes in the human myoglobin gene that recognise many DISPERSED VNTR loci. Jeffreys coined the term MINISATELLITES for these loci. Jeffreys’ probes were used to generate “DNA fingerprints” 1985: first paper on PCR (Mullis et al) 1991: first paper on microsatellites (short tandem repeats; STRs) by James Weber. © RM Graham  RFLPs Restriction Endonucleases bind to specific nucleotide sequences resulting in reproducible cleavage of the DNA at these sites. The presence or absence of these RE sensitive sites forms the basis of a diallelic, codominant system of genetic variation. The presence or absence of an RE site will result in a DNA digest which has DNA fragments of differing length. RFLPs were observed by a method known as DNA hybridisation following Southern blotting (or Southern blotting for short). Now can perform gel electrophoresis or capillary electrophoresis if no other method available © RM Graham  Locus, Allele & Haplotype LOCUS: a specific place on a chromosome where a DNA sequence resides. ALLELE: the sequence of DNA at a specified locus. An alternative form or variant of a DNA sequence at a given locus. HAPLOTYPE: The combination of loci on a single chromosome, or part of a chromosome. [“Gene” is often used as a synonym for “allele”; however, the term “gene” has been used in many contexts and, today, its use is not precise.] © RM Graham