VL9 Introduction to Microbial Genomics and Prokaryotic Diversity PDF

Introduction to microbial genomics Mitja Remus-Emsermann KöLu 12-16 Raum 129 [email protected] 1 What is a genome?...CGCGTACTGGTTGTTGAAGACAATGCGTTGTTACGTCACCACCTTAAAGTTCAGATTC AGGATGCTGGTCA...

Introduction to microbial genomics Mitja Remus-Emsermann KöLu 12-16 Raum 129 [email protected] 1 What is a genome?...CGCGTACTGGTTGTTGAAGACAATGCGTTGTTACGTCACCACCTTAAAGTTCAGATTC AGGATGCTGGTCATCAGGTCGATGACGCAGAAGATGCCAAAGAAGCCGTATTATTATCTCA ATGACATATACCGGATATTGCGATTGTCGATCTCGGATTGCCAGACGAGGACGGTCTGTCA CTGATTCGCCGCTGGCGTAGCAACGATGTTTCACTGCCGATTCTGGTATTAACCGCCCGTG AAAGCTGGCAGGACAAAGTCGAAGTATTAAGTGCCGGTGCTGATGATTATGTGACTAAACC GTTTCATATTGAAGAGGTGATGGCGCGAATGCAGGCATTAATGCGGCGTAATAGCGGTCTG GCTTCACAGGTCATTTCGCTCCCCCCGTTTCAGGTTGATCTCTCTCGCCGTGAATTATCTA TTAATGACGAAGTGATCAAACTGACCGCGTTCGAATACACTATTATGGAAACGTTGATACG CAATAATGGCAAAGTGGTCAGCAAAGATTCGTTAATGCTCCAACTCTATCCGGATGCGGAG CTGCGGGAAAGCCATACCATTGATGTACTGATGGGACGTCTGCGCAAAAAAATTCAGGCAC AATATCCCCAAGAAGTGATTACCACCGTTCGCGGCCAGGGCT..... Instruction manual for life  CGCGTACTGGTTGTTGAA GACAATGCGTTGTTACGT CACCACCTTAAAGTTCAG History ATTCAGGATGCTGGTCAT CAGGTCGATGACGCAGAA GATGCCAAAGAAGCCGTA TTATTATCTCAATGACAT ATACCGGATATTGCGATT GTCGATCTCGGATTGCCA GACGAGGACGGTCTGTCA CTGATTCGCCGCTGGCGT Can a genome tell who you are…? AGCAACGATGTTTCACTG CCGATTCTGGTATTAACC GCCCGTGAAAGCTGGCAG GATTCGCCGCTGGCGTAG Health CAACGATGTTTCACTGCC GATTCTGGTATTAACCGC CCGTGAAAGCTGGGATTC GCCGCTGGCGTAGCAACG ATGTTTCACTGCCGATTC Environment/lifestyle TGGTATTAACCGCCCGTG AAAGCTGGGATTCGCCGC TGGCGTAGCAACGATGTT TCACTGCCGATTCTGGTA TTAACCGCCCGTGAAAGC TGGGATTCGCCGCTGGCG TAGCAACGATGTTTCACT GCCGATTCTGGTATTAAC CGCCCGTGAAAGCTGGGA TTCGCCGCTGGCGTAGCA ACGATGTTTCACTGCCGA TTCTGGTATTAACCGCCC GTGAAAGCTGGGATTCGC CGCTGGCGTAGCAACGAT GTTTCACTGCCGATTCTG Behavior GTATTAACCGCCCGTGAA AGCTGGGATTCGCCGCTG GCGTAGCAACGATGTTTC ACTGCCGATTCTGGTATT AACCGCCCGTGAAAGCTG GGATTCGCCGCTGGCGTA GCAACGATGTTTCACTGC CGATTCTGGTATTAACCG CCCGTGAAAGCTGGGATT CGCCGCTGGCGTAGCAAC GATGTTTCACTGCCGATT CTGGTATTAACCGCCCGT GAAAGCTGGGATTCGCCG Appearance CTGGCGTAGCAACGATGT TTCACTGCCGATTCTGGT ATTAACCGCCCGTGAAAG CTGGGATTCGCCGCTGGC GTAGCAACGATGTTTCAC TGCCGATTCTGGTATTAA CCGCCCGTGAAAGCTGG What about E. coli Complete genome = complete understanding ? E. coli is the best characterized model system 34 % of all E. coli genes are not experimentally characterized 24 % have no functional assignment 5000 4000 # genes 3000 2000 1000 0 ed s n ne tio riz ge nc te fu l# ac ta ar d ne To ch ig lly ss ta A en rim pe Ex Genomics “..for the newly developing discipline of (genome) mapping/sequencing (including the analysis of the information, we have adapted the term GENOMICS….. The new discipline is born from a marriage of molecular and cell biology with classical genetics and is fostered by computational science...” GENOMICS 1, 1-2 (1987): A new discipline, a new name, a new journal Genomics studies DNA and how it works Genotype Phenotype Gene expression determines cell physiology and function Adaption Genotype Phenotype There is more: Microheterogeneity Macrophage containing Salmonella The Genomics experiment Researcher Designs and performs experiments, supervises research, provides funding Publications, patents Biological question Technical support staff Bioinformatician Operates machines and runs samples Looks for patterns in biological data Signal transduction How does a cell “know”..? Sensor Where am I MgtC M PhoP V1 1 LPS PmrAB V V2 Salmonella changes its gene regulatory networks after being caught by a macrophage  How does a gene “know” when to be on or off? Regulation of gene expression Constitutive (house keeping) genes Controllable genes Positive regulation (induction/activation) Negative regulation (repression/attenuation) Gene expression can be regulated at During transcription During translation Structure and expression of a bacterial operon Slide adapted from Lecture no. 551-1126-00L Technologies in Molecular Microbiology, Hans-Martin Fischer, ETH Zurich  DNA sequencing: overview Starting material Isolated DNA Library of DNA fragments Sequencing Assembly of reads Generation of ‘contigs’ (contiguous sequences) Target sequence How does assembly look on an “idealised” sequence Input: ACCGTGCTTT CGTGCTTTAT AAATTTACCG CTAAATTTACCGT --------ACCGTGCTTT-- ----------CGTGCTTTAT --AAATTTACCG-------- CTAAATTTACCGT------- |||||||||||||||||||| CTAAATTTACCGTGCTTTAT 40 Kbp) https://www.youtube.com/watch? v=V8aruYOm7p8 (Very) long read technology Oxford nanopore minion Innovative in several respects: Tiny long to ultralong reads (>200 Kbp) https://www.youtube.com/watch? v=Wq35ZXyayuU Pushing the limits of de novo genome assembly for complex prokaryotic genomes harboring very long, near identical repeats We have reads and contigs, what now? Determine open reading frames (ORF) by identifying start codons (mostly ATG sometimes GTG and others) Assign potential functions to ORF by using homology based comparison to coding sequence (CDS) databases Loads of potential options for downstream analysis exist Build metabolic models of the organism under research Use the information to predict ecosystem function of an organism Investigate if antibiotic resistance genes are present/ absent for better patient treatment Functional prediction/ annotation Glimmer Prokka AntiSmash Rast server (http://rast.theseed.org) Metabolic profiling D ExRA ExRC A C ExRB B F E A-F: nutrients extracellular ExR: exchange reaction exchanged compounds flux balance analysis analysis (FBA) predicted exchanged simulation of growth rate output nutrient based on reaction fluxes  Applications of genomics Human Health Agriculture Genomics Biotechnology Natural product design Bioenergy Ecology  Prokaryotic diversity Mitja Remus-Emsermann KöLu 12-16 Raum 129 [email protected]  Pink colour comes from living prokaryotes https://stateimpact.npr.org/texas/files/2012/06/RivercWyman-Meinzer.jpg Croton Creek – oxygen-deprived Major Functional Traits Mapped Across Major Phyla of Bacteria and Archaea Brock Biology of Microorganisms 16th international edition Figure 15.1  Prokaryotes Prokaryotes thrive almost everywhere, including places that are extremely Acidic (acidophiles) Alkaline (alkaliphiles) Salty (halophiles) Cold (psychrophiles) Hot (thermophiles) Without oxygen (anaerobic) Most prokaryotes are microscopic, but what they lack in size they make up for in numbers There are more in a handful of fertile soil than the number of people who have ever lived Prokaryotes are divided into two domains Bacteria Archaea  Prokaryotes Prokaryotes have evolved an amazing array of life-forms that colonize every habitat on Earth, including humans In 2012, the Human Microbiome Project Consortium reported a landmark survey of microbial communities throughout the human body  Prokaryotes Earth’s first organisms were likely prokaryotes Most prokaryotes are unicellular Although some species form colonies Most prokaryotic cells are 0.5 – 5 µm, much smaller than the 10–100 µm of many eukaryotic cells Prokaryotic cells have a variety of shapes The three most common shapes are spheres (cocci), rods (bacilli), and spirals  Prokaryotes An important feature of nearly all prokaryotic cells is their cell wall, which maintains cell shape, protects the cell, and prevents it from bursting in a hypotonic environment Bacterial cell walls contain peptidoglycan - a network of sugar polymers cross- linked by polypeptides Archaea contain polysaccharides and proteins but lack peptidoglycan Eukaryote cell walls are made of cellulose or chitin  Prokaryotes Gram stain used to classify bacteria by cell wall composition Gram-positive bacteria - simpler walls with a large amount of peptidoglycan Gram-negative bacteria - less peptidoglycan and an outer membrane Gram positive vs negative  Prokaryotes Many antibiotics target peptidoglycan and damage bacterial cell walls Gram-negative bacteria are more likely to be antibiotic resistant A polysaccharide or protein layer called a capsule covers many prokaryotes Many prokaryotes form metabolically inactive endospores, which can remain viable in harsh conditions for centuries  Prokaryotes Some prokaryotes have fimbriae, which allow them to stick to their substrate or other individuals in a colony Pili (or sex pili) are longer than fimbriae and allow prokaryotes to exchange DNA  Motility Many bacteria exhibit taxis, the ability to move toward or away from a stimulus Chemotaxis is the movement toward or away from a chemical stimulus Most motile bacteria propel themselves by flagella scattered about the surface or concentrated at one or both ends The mechanism behind this motility is complex: https://naturemicrobiologycommunity.nature.com/users/21217-tam-mignot/videos/12585-myxococcus- xanthus-motility Life Cycle of Myxococcus Brock Biology of Microorganisms 16th international edition Figure 15.42  Rapid mutation and reproduction Prokaryotes reproduce by binary fission, and offspring cells are generally identical Mutation rates during binary fission are low, but because of rapid reproduction, mutations can accumulate rapidly in a population If beneficial, mutations will be fixed in the population Their short generation time allows prokaryotes to evolve quickly Prokaryotes are not “primitive” but are highly evolved  Rapid mutations We call bacterial isolates clonal – is this true? E. coli have a genome size of ~4.5 Mbp E. coli have mutation rates of ~1 in 109 bases / generation If a 100 ml LB culture is inoculated with one cell, it will reach ~109 CFU / ml over night How many different genotypes do you expect in the culture? Adaptation  Nutritional and metabolic adaptations Prokaryotes can be categorised by how they obtain energy and carbon Phototrophs - obtain energy from light Chemotrophs - obtain energy from chemicals Autotrophs - require CO2 as a carbon source Heterotrophs - require an organic nutrient to make organic compounds  Nutritional and metabolic adaptations Energy and carbon sources are combined to give four major modes of nutrition Photoautotrophy Chemoautotrophy Photoheterotrophy Chemoheterotrophy  O2 metabolism Prokaryotic metabolism varies with respect to O2 Obligate aerobes require O2 for cellular respiration Obligate anaerobes are poisoned by O2 and use fermentation or anaerobic respiration Facultative anaerobes can survive with or without O2  N2 metabolism Nitrogen is essential for the production of amino acids and nucleic acids Prokaryotes can metabolize nitrogen in a variety of ways In nitrogen fixation, some prokaryotes convert atmospheric nitrogen (N2) to ammonia (NH3)  Metabolic cooperation Cooperation between prokaryotes allows them to use environmental resources they could not use as individual cells Sulfate-consuming bacteria and methane-consuming bacteria on the ocean floor use each other’s waste products In the cyanobacterium Anabaena, photosynthetic cells and nitrogen-fixing cells called heterocysts (or heterocytes) exchange metabolic products Anabaena  Biofilms Metabolic cooperation occurs between different prokaryotic species in surface- coating colonies called biofilms  Prokaryotic diversity Based on genetic analysis of prokaryotes there are two domains Bacteria Archaea  Proteobacteria These gram-negative bacteria include photoautotrophs, chemoautotrophs, and heterotrophs Some are anaerobic, and others aerobic  Alpha Proteobacteria Rhizobium spp., which forms root nodules in legumes and fixes atmospheric N2 Agrobacterium spp., which produces tumors in plants and is used in genetic engineering  Gamma Proteobacteria Largest subgroup of proteobacteria Contains 14 orders and 28 families Very diverse physiological types Chemoorganotrophs, photolithotrophs, chemolithotrophs, methylotrophs Aerobic and anaerobic Escherichia coli - resides in the intestines of many mammals and is not normally pathogenic Thiomargarita namibiensis – largest bacteria (100 microns in diameter) Chromatium spp. - oxidize sulfur to sulfate  Cyanobacteria Cyanobacteria are the only oxygenic phototrophic prokaryotes Contain chlorophyll and accessory pigments Conduct photosynthesis in thylakoids Fix CO2 in carboxysomes Maintain buoyancy using gas vesicles Many fix N2 in specialized cells called heterocysts  Cyanobacteria Single-celled cyanobacteria include Synechococcus spp. and Prochlorococcus spp. Most abundant phototrophs in oceans Some genera are filamentous Some form colonies  Cyanobacteria Cyanobacteria play key roles in many ecosystems Environmental change may cause the colonial cyanobacteria Trichodesmium to form giant blooms Cyanobacteria share many kinds of mutualism with other bacteria, as well as fungi, protists, plants, and animals  Gram-positive bacteria Gram-positive bacteria comprise two distinct phylogenetic branches: Firmicutes Low-GC species Actinobacteria High-GC species Both groups have thick cell walls that retain the Gram stain - crystal violet Walls are reinforced by teichoic acids  Spore forming Firmicutes Bacillales - large rod shaped cells B. anthrax, B. thuringiensis, B. subtilis Vegetative cells develop inert endospores in times of starvation and stress Released spores germinate in favourable conditions, and then restart vegetative growth  Spore forming Firmicutes Clostridiales Endospore swells, forming a “drumstick.” C. botulinum; C. tetani; C. difficile Botox is used to relax muscle spasms  Non-spore forming Firmicutes Both Bacillales and Clostridiales, as well as other Gram-positive orders, include many non-spore- forming rods and cocci Lactococcus spp., Lactobacillus spp., Leuconostoc spp. – lactic acid bacteria in food production Listeria monocytogenes - Facultative anaerobic rod, found on cheese and sauerkraut and causes listeriosis Staphylococcus spp., Streptococcus spp. - human pathogens  Non-spore forming Firmicutes Mycoplasma spp. - causes pneumonia and meningitis, have pleomorphic cells and “Fried egg”–shaped colonies Mycoplasms - the smallest known cells  Actinomycetes Streptomyces Obligate aerobes Form mycelia that fragment into smaller cells called arthrospores Have linear chromosomes with telomeres  Actinomycetes Mycobacterium Rod-shaped cells Have thick cell walls with mycolic acids and phenolic glycolipids M. tuberculosis - TB M. leprae - leprosy M. smegmatis - a harmless commensal of human skin Detected by the acid-fast stain  Archaea Archaea share certain traits with bacteria and other traits with eukaryotes  Archaea The domain Archaea includes three phyla Crenarchaeota Shows the widest range of temperature Hyperthermophiles, thermophiles, mesophiles, psychrophiles Thaumarchaeota Mesophilic heterotrophs and sulfur oxidizers Ammonia oxidizers Euryarchaeota Shows the greatest range of metabolism Methanogens, halophiles, acidophiles, alkalinophiles Archaea  Archaea Thermophiles and hyperthermophiles commonly grow in hot springs and geysers, such as those of Yellowstone National Park Several features of hot springs and geysers are important for thermophiles: Reduced minerals Low oxygen content Steep temperature gradients Acidity  Archaea - Crenarchaeota The most extreme hyperthermophiles are barophiles adapted to grow near hydrothermal vents at the ocean floor A common feature of thermal vents is the black smoker Vent-adapted crenarchaeotes include: Pyrodictium abyssi Pyrodictium occultum Pyrodictium brockii  Archaea - Crenarchaeota The order Sulfolobales includes species that respire by oxidizing sulfur Sulfolobus grow at 80 - 90°C within hot springs and solfataras (volcanic vents that emit only gases) Sulfolobus solfataricus A “double extremophile” Grows at 80 - 90°C and pH 3 Oxidizes H2S to sulfuric acid  Archaea - Crenarchaeota Crenarchaeotes live in moderate habitats throughout the biosphere The majority are mesophiles, which grow in water or soil, or in association with plant Psychrophilic crenarchaeotes have been isolated from Ace Lake, Antarctica And from the sea ice off Antarctic  Archaea - Thaumarchaeota A more finely tuned analysis showed that some crenarchaeotes branched deeply from the rest These deep-branching archaea were reclassified as a new clade, the Thaumarchaeota Nitrosopumilus maritimus gains energy by aerobically oxidizing ammonia to nitrite Cycles nitrogen and provides a major source of nitrite to marine phytoplankton Can also fix large quantities of CO2 thus contributing to global carbon cycles  Archaea - Euryarchaeotes The euryarchaeotes are dominated by the methanogens Derive energy through reactions producing methane All methanogens are poisoned by molecular oxygen and therefore require complete anaerobiosis Methanogens exist as rods (single or filamentous), cocci, and spirals The methanogens have rigid cell walls made up of pseudopeptidoglycan, proteins, or sulfated sugars  Archaea - Euryarchaeotes Methanogens grow in: Anaerobic soil of wetlands Especially rice paddies Landfills Digestive tracts of animals Termites Cattle Humans Marine benthic sediments  Archaea - Euryarchaeotes The main inhabitants of high-salt environments are members of the class Haloarchaea Most haloarchaea belong to the order Halobacteriales The photopigments of haloarchaea colour salterns, which are used for salt production Most are coloured red by bacterioruberin - protects cells from light Halophilic archaea require at least 1.5M NaCl  Archaea - Lokiarcheota Ribosomal protein- and 16S rRNA gene-based phylogeny of MK-D1. Imachi et al. 2020  Archaea - Lokiarcheota Proposed hypothetical model for eukaryogenesis. Imachi et al. 2020 The new tree of life (2016) Candidate phyla have no representative isolate Red dots indicate lineages without representative isolates Tree is outdated  Trouble in (microbiology) paradise Names are just names, but they hold power In late 2021 the international committee on systematics of prokaryotes (ICSP) changed the nomenclature of prokaryotes This led to many microbiologists to be broken and confused In reality nothing changed – many people mistake nomenclature for taxonomy The next revision is about to happen this summer (?) Why was the change necessary? Let’s discuss https://www.the-scientist.com/news-opinion/newly- renamed-prokaryote-phyla-cause-uproar-69578 http://www.the-icsp.org/bacterial-code