Transcription of the Genetic Code: The Biosynthesis of RNA PDF

# Chapter Eleven: Transcription of the Genetic Code: The Biosynthesis of RNA ## Transcription ### General Features of RNA Synthesis 1. RNA is initially synthesized using a DNA template; the enzyme that catalyzes the process is DNA-dependent RNA polymerase. 2. All four ribonucleoside triphosphates...

# Chapter Eleven: Transcription of the Genetic Code: The Biosynthesis of RNA ## Transcription ### General Features of RNA Synthesis 1. RNA is initially synthesized using a DNA template; the enzyme that catalyzes the process is DNA-dependent RNA polymerase. 2. All four ribonucleoside triphosphates (ATP, GTP, CTP, and UTP) are required, as is Mg²⁺. 3. A primer is not needed in RNA synthesis, but a DNA template is required. 4. As is the case with DNA biosynthesis, the RNA chain grows from the 5' to the 3' end. The nucleotide at the 5' end of the chain retains its triphosphate group (abbreviated ppp). 5. The enzyme uses one strand of the DNA as the template for RNA synthesis. The base sequence of the DNA contains signals for initiation and termination of RNA synthesis. The enzyme binds to the template stand and moves along it in the 3'-to-5' direction. 6. The template is unchanged. ## Transcription in Prokaryotes - *E. coli* RNA Polymerase: - Molecular weight about 500,000 - Four different types of subunits: α, β, β', and σ - The core enzyme is α₂ββ' - The holoenzyme is α₂ββ'σ - The role of the σ subunit is recognition of the promoter locus; the σ subunit is released after transcription begins - Of the two DNA strands, the one that serves as the template for RNA synthesis is called the template strand or antisense strand; the other is called the coding (or nontemplate) strand or sense strand - The holoenzyme binds to and transcribes only the template strand ## The Basics of Transcription - A diagram depicting the DNA strands: coding strand and template strand, the transcription of the template strand by RNA polymerase to form an RNA transcript, and its translation to form a protein consisting of amino acid chain ## Promoter Sequence - Simplest of organisms contain a lot of DNA that is not transcribed. - RNA polymerase needs to know which strand is template strand, which part to transcribe, and where the first nucleotide of the gene to be transcribed is. - **Promoters** - DNA sequence that provides direction for RNA polymerase ### Promoter Sequence Table | Gene | -35 region | Pribnow box (-10 region) | Transcription start site (TSS) (+1) | |-----------|-------------------------------------------|-------------------------|----------------------------------------------| | *araBAD* | GGATCCTACCTGACGCTTTTTATCGCААСТСТСTACTGTTТТСТССАTACCCGTTTTT | TACTGTTТТСТССАТА | CCCGTTTTT | | *araC* | GCCGTGATTATAGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCGCTTTG | TTACGCGTTTTTGTCAT | GGCTTTGGTCCCGCTTTG | | *bioA* | TTCCAAAACGTGTTTTTTGTTGTTAATTCGGTGTAGACTTGTAAАССТАААТСТТТТ | TTGAAAAGATTTAGGTT | ACAAGTCTACACCGAAT | | *bioB* | CATAATCGACTTGTAAACCAAATTGAAAAGATTTAGGTTTACAAGTCTACACCGAAT | TACAAGTCTACACCGA | AT | | *galP2* | ATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATTTCATACCAT | ATGCTATGGTTATTTCA | TACCAT | | *lac* | ACCCCAGGCTTTАСАСТТТATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGG | ATGCTTCCGGCTCGTA | TGTTGTGTGGAATTGTGAGCGG | | *lack* | CCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTC | ATGGCATGATAGCGCC | CCGGAAGAGAGTC | | *rrnAl* | AAAATAAATGCTTGACTCTGTAGCGGGAAGGCGTATTATCACACCCCCGCGCCGCTG | ATGTTATCACACCCCC | GCCGCTG | | *rrnDI* | CAAAAAААТАСТTGTGCAAAAAATTGGGATСССТАТAATGCGCCTCCGTTGAGACGA | AATGCGCCTCCGTTGA | GACGA | | *rrnEl* | CAATTTТТСТАТTGCGGCC TGCGGAGAACTСССТАТAATGCGCCTCCATCGACACGG | AATGCGCCTCCATCG | ACACGG | | *tRNAT* | CAACGTAACACTTTACAG C G G C G CGTCATTTGATATGATGCGCCCCGCTTCCCGATA | GATATGATGCGCCCC | GCTTCCCGATA | | *trp* | AAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCAAGTTCACGTA | ACTAGTACGCAAGTT | CACGTA | | *Consensus sequence* | TCTTGACAT [11-15 bp] TATAAT [5-8 bp] A | | | | *% occurrence of indicated base* | 42, 38, 82, 84, 79, 64, 53, 45, 41 | 79, 95, 44, 59, 51, 96 | 51 | ## Chain Initiation - The first phase of transcription is initiation. - Initiation begins when RNA polymerase binds to promoter and forms closed complex. - After this, DNA unwinds at promoter to form open complex, which is required for chain initiation. ## Initiation and Elongation in Transcription - A diagram that shows the following steps in initiation and elongation in transcription: - Recognition of promoter by σ; binding of polymerase holoenzyme to DNA:migration to promoter - Formation of an RNA polymerase closed promoter complex - Unwinding of DNA at promoter and formation of open promoter complex - RNA polymerase initiates mRNA synthesis, almost always with a purine RNA polymerase holoenzyme catalyzes elongation of mRNA by about 4 more nucleotides - Release of σ-subunit as core RNA polymerase proceeds down the template, elongating RNA transcript ## Chain Elongation - After strands separated, transcription bubble of ~17 bp moves down the DNA sequence to be transcribed. - RNA polymerase catalyzes formation of phosphodiester bonds between the incorp. ribonucleotides. - **Topoisomerases** relax supercoils in front of and behind transcription bubble ## Chain Termination - Two types of termination mechanisms: - **Intrinsic termination**- controlled by specific sequences, termination sites - Termination sites characterized by two inverted repeats ## Chain Termination (Cont'd) - Another type of termination involves **rho (ρ) protein** - **Rho-dependent termination** sequences cause hairpin loop to form. - A diagram showing the mechanism of rho-dependent transcription termination ## Transcription Regulation in Prokaryotes - In prokaryotes, transcription regulated by: - Alternative σ factors - Enhancers - Operons - Transcription attenuation - **Alternative σ factors: ** - Viruses and bacteria exert control over which genes are expressed by producing different σ-subunits that direct the RNA polymerase to different genes. ## Control by Different σ Subunits - A diagram depicting the following steps in control by different σ subunits: - Early transcription: specificity factor: host σ - Middle transcription:specificity factor: gp28 - Late transcription: specificity factor: gp33 and gp34 ## Enhancers - Certain genes include sequences upstream of extended promoter region - These genes for ribosomal production have 3 upstream sites, Fis sites - Class of DNA sequences that do this are called **enhancers** - Bound by proteins called **transcription factors** ## Elements of a Bacterial Promoter - A diagram showing the elements of a bacterial promoter: - Fis sites - UP element - Core promoter - Transcription start ## Operon - **Operon** - a group of operator, promoter, and structural genes that codes for proteins - The control sites, promoter, and operator genes are physically adjacent to the structural gene in the DNA - The regulatory gene can be quite far from the operon - Operons are usually not transcribed all the time - **β-Galactosidase** - an inducible protein - Coded for by a structural gene, lacZ - Structural gene *lacy* codes for lactose permease - Structural gene *lacA* codes for transacetylase - Expression of these three structural genes is controlled by the regulatory gene *lacl* that codes for a repressor. ## How Does Repression Work - **Repressor protein** - made by *lacl* gene - Forms tetramer when it is translated - **Repressor protein** then binds to operator portion of operon. - **Operator** and **promoter** together are the control sites. - A diagram to show how a repressor protein works. ## Binding Sites On the *lac* operon - *Lac* operon is induced when *E. coli* has lactose as the carbon source. - *Lac* protein synthesis repressed by glucose (**catabolite repression**) - *E. coli* recognizes presence of glucose by promoter as it has 2 regions: RNA polymerase binding site, catabolite activator protein **(CAP)** binding site. ## Catabolite Repression - **CAP** forms complex with **CAMP**. - Complex binds at **CAP site**. - **RNA polymerase** binds at available binding site, and transcription occurs. - A diagram showing the mechanism of catabolite repression ## Binding Sites On *lac* operon (Cont'd) - A diagram depicting the binding sites on the *lac* operon: - CAP binding site - RNA polymerase binding site - Repressor binding site ## Basic Control Mechanisms in Gene Control - Control may be inducible or repressive, and these may be negatively or positively controlled. - A diagram showing 4 basic control mechanisms in gene control: - Lac operon (negative control) - Catabolite repression (positive control) - Tryptophan operon (negative control) - Tryptophan operon (positive control) ## Control of the *trp* operon - **Trp operon** codes for a leader sequence (*trpL*) and five polypeptides. - The five proteins make up 4 different enzymes that catalyze the multistep process that converts chorisimate to tryptophan. - A diagram of the *trp* operon showing DNA, control sites, mRNA, attenuator, and the polypeptides that result from transcription. ## Alternative 2° Structures Can Form in *trp* Operon - These structures can form in the leader sequence. - **Pause structure**- binding between regions 1 and 2 - **Terminator loop**- binding between regions 3 and 4 - **Antiterminator structure**- Alternative binding between regions 2 and 3 - A diagram showing the alternative 2° structures that can form in the *trp* operon: - Pause structure, between regions 1 and 2 - Terminator structure, between regions 3 and 4 - Antiterminator structure, between regions 2 and 3 ## Attenuation in the *trp* operon - **Pause structure** forms when ribosome passes over Trp codons when Trp levels are high. - **Ribosome** stalls at the Trp codon when trp levels are low and antiterminator loop forms. - A diagram explaining attenuation in the *trp* operon ## Transcription in Eukaryotes - Three RNA polymerases are known; each transcribes a different set of genes and recognizes a different set of promoters: - **RNA Polymerase I**- found in the nucleolus and synthesizes precursors of most rRNAs - **RNA Polymerase II**- found in the nucleoplasm and synthesize mRNA precursors - **RNA Polymerase III**- found in the nucleoplasm and synthesizes tRNAs, other RNA molecules involved in mRNA processing and protein transport ## How Does Pol II Recognize the Correct DNA? - Four elements of the **Pol II promoter** allow for this phenomenon: - Upstream element - TATA - Inr - Downstream element ## Transcription Order of Events - Less is known about eukaryotes than prokaryotes. - The phosphorylated Pol II synthesizes RNA and leaves the promoter region behind. - GTFs are left at the promoter or dissociate from Pol II. - A diagram showing the transcription order of events in eukaryotes ## General Transcription Initiation Factors | Factor | Subunits | Size (kDa) | Function | |-----------|----------|------------|--------------------------------------------------------------------------------------| | TFIID-TBP | 1 | 27 | TATA box recognition, positioning of TATA box DNA around TFIIB and Pol II | | TFIID-TAFIS | 14 | 15-250 | Core promoter recognition (non-TATA elements), positive and negative regulation | | TFIIA | 3 | 12, 19, 35 | Stabilization of TBP binding; stabilization of TAF-DNA binding | | TFIIB | 1 | 38 | Recruitment of Pol II and TFIIF; start-site recognition for Pol II | | TFIIF | 3 | 156 total | Promoter targeting of Pol II | | TFIIE | 2 | 92 total | TFIIH recruitment; modulation of TFIIH helicase ATPase, and kinase activities; promoter melting| | TFIIH | 9 | 525 total | Promoter melting; promoter clearance via phosphorylation of CTD | ## Elongation and Termination - **Elongation** is controlled by: - **pause sites**, where RNA Pol will hesitate - **anti-termination**, which proceeds past the normal termination point - **positive transcription elongation factor (P-TEF)** and **negative transcription elongation factor (N-TEF)** - **Termination:** - Begins by stopping RNA Pol; the eukaryotic consensus sequence for termination is AAUAAA. ## Gene Regulation - **Enhancers and silencers** - regulatory sequences that augment or diminish transcription, respectively. - **DNA looping** brings enhancers into contact with transcription factors and polymerase. - A diagram showing DNA looping mechanism ## Eukaryotic Gene Regulation - **Response elements** are enhancers that respond to certain metabolic factors - Heat shock element (HSE) - Glucocorticoid response element (GRE) - Metal response element (MRE) - Cyclic-AMP response element (CRE) - Response elements all bind proteins (transcription factors) that are produced under certain cell conditions ## Response Elements | Response Element | Physiological Signal | Consensus Sequence | Transcription Factor | Size (kDa) | |-------------------|-----------------------------------------------------------------------------|---------------------|-----------------------------------|------------| | CRE | cAMP-dependent activation of protein kinase A | TGACGTCA | CREB, CREM, ATF1 | 43 | | GRE | Presence of glucocorticoids | TGGTACAAA | Glucocorticoid receptor | 94 | | HSE | Heat shock | CNNGAANNT | HSTF | 93 | | MRE | Presence of cadmium | CGNCCCGGN | ? | ? | | | | CNC* | | | | | *N stands for any nucleotide.* | | | | ## Non-Coding RNAs - As much as 98% of transcriptional output from human genomes may be comprised of non-coding RNAs (ncRNA) - Linked to: regular transcription, gene silencing, replication, processing of RNA, RNA modification, translation, protein stabilization, protein translocation - Two main types: **Micro RNA (miRNA)**, and **Small Interfering RNA (siRNA)** ## Posttranscriptional Modification of tRNA Precursor - A diagram showing the posttranscriptional modification of tRNA precursor showing: - transferase enzyme puts -CA on 3' end - exonuclease trims -U from 3' end - exouclease trims UAA from 5' end - transferase enzyme putting -CCA on 5' end - final base modification - endonuclease action at two sites shown by arrows ## SiRNAs are formed in away similar miRNA - A diagram of the formation of SiRNAs and miRNAs ## Structural Motifs in DNA-Binding Proteins - Most proteins that activate or inhibit RNA Pol II have two functional domains: - DNA-binding domain - Transcription-activation domain - DNA-Binding domains have domains that are either: - Helix-Turn-Helix (HTH) - Zinc fingers - Basic-region leucine zipper - A diagram showing a DNA-binding protein ## Helix-Turn-Helix Motif - Hydrogen bonding between amino acids and DNA. - A diagram showing hydrogen bonding between glutamine and adenine, and hydrogen bonding between arginine and guanine. ## Basic Region Leucine Zipper Motif - Many transcription factors contain this motif, such as **CREB** (Biochemical Connections, page 309) - Half of the protein composed of basic region of conserved Lys, Arg, and His. - Half contains series of Leu. - Leu line up on one side, forming hydrophobic pocket. ## Post Transcriptional RNA Modification - **tRNA, rRNA, and mRNA** are all modified after transcription to give the functional form. - The initial size of the RNA transcript is greater than the final size because of the leader sequences at the 5' end and the trailer sequences at the 3' end. - The types of processing in prokaryotes can differ greatly from that in eukaryotes, especially for mRNA - **Modifications** - Trimming of leader and trailer sequences - Addition of terminal sequences (after transcription) - Modification of the structure of specific bases (particularly in tRNA) ## Modification of tRNA - **Transfer RNA**- the precursor of several tRNAs is can be transcribed as one long polynucleotide sequence - Trimming, addition of terminal sequences, and base modification all take place. - Methylation and substitution of sulfur for oxygen are the two most usual types of base modification - A diagram showing the ribose moieties of a nucleotide ## Modification of rRNA - **Ribosomal RNA**- Processing of rRNA is primarily a matter of methylation and trimming to the proper size. - In prokaryotes, 3 rRNAs in one intact ribosome. - In Eukaryotes, ribosomes have 80s, 60s, and 40s subunits. - Base modification in both prokaryotes and eukaryotes is primarily by methylation. ## Modification of mRNA - Includes the capping of the 5' end with an N-methylated guanine that is bonded to the next residue by a 5' -> 5' triphosphate. - Also, 2'-O-methylation of terminal ribose(s). - A diagram showing the structure of the 7-methylguanosine cap ## mRNA Modification - A polyadenylate "tail” that is usually100-200 nucleotides long, is added to the 3' end before the mRNA leaves the nucleus - This tail protects the mRNA from nucleases and phosphatases. - Eukaryote genes frequently contain intervening base sequences that do not appear in the final mRNA of that gene product - Expressed DNA sequences are called **exons**. . Intervening DNA sequences that are not expressed are called **introns**. - These genes are often referred to as **split genes**. ## Organization of Split Genes in Eukaryotes - A diagram showing the organization of split genes in eukaryotes ## The Splicing Reaction - **Exons** are separated by intervening intron. - When the exons are spliced together, a **lariat** forms in the intron. - A diagram of the splicing reaction ## Ribozymes - The first ribozymes discovered included those that catalyze their own self-splicing. - More recently, ribozymes have been discovered that are involved in protein synthesis. - **Group I ribozymes:** - Require an external guanosine. - Example: pre-rRNA of the protozoan Tetrahymena (next screen) - **Group II ribozymes:** - Display a lariat mechanism similar to mRNA splicing. - No requirement for an external nucleotide.