Sismik 4 KTaksonomi Molekuler 2024.pdf

Klasifikasi Molekuler Sistematika Mikrobia #4 1 Dr.rer.nat. Abdul Rahman Siregar, S.Si., M.Biotech. Lab. Mikrobiologi – Fakultas Biologi UGM Karakterisasi Genomik: Analisis Asam nukleat 1. DNA/RNA Fingerprinting (Sidikjari DNA) 2. Nucleic acid Hybridization 3. Phyloge...

Klasifikasi Molekuler Sistematika Mikrobia #4 1 Dr.rer.nat. Abdul Rahman Siregar, S.Si., M.Biotech. Lab. Mikrobiologi – Fakultas Biologi UGM Karakterisasi Genomik: Analisis Asam nukleat 1. DNA/RNA Fingerprinting (Sidikjari DNA) 2. Nucleic acid Hybridization 3. Phylogeny Tree: DNA sequencing Based on information contents, biomolecules fall into 3 categories: Primary semantides: DNA; Secondary semantides: RNA; Tertiary Semantides semantides: Protein. synthesized under the control of tertiary semantides: ATP, Episemantides carotenoids (Chemotaxonomic markers) not produced by the organisms and do not express any of the Asemantides information of the organisms, such as: exogenously supplied vitamins, phosphate ions and oxygen. Semantides (or semantophoretic molecules) are biological macromolecules that carry genetic information or a transcript thereof DNA/RNA Fingerprinting BRENDA (Bacterial Restriction Endonuclease Ribotyping Nucleic acid RFLP RAPD Digest Analysis) (Random (Restriction Fragment Amplified Length Polymorphic ARDRA Plasmid Polymorphism DNA) (Amplified profiles and Ribosomal DNA fingerprinting Restriction Low Analysis) molecular- Oligonucleo weight-RNA tide Probes profiles RFLP for multi purposes Ribotyping (Group 1 – 10) Diagramatic Representative (Group 1 – 10) Clustering (Group 1- 10) Identifikasi mikrobia dengan sidikjari DNA Identifikasi mikrobia dengan 16S rDNA 2. Nucleic acid Hybridization ❑DNA-DNA hybridization: DNA-DNA relatedness → genomic species concept ❑“A species: a group of strains characterized by a high degree of similarity in DNA sequence and phenotypic properties” Kelemahan: ✓Teknik hibridisasi relatif sulit ✓Reprodusibilitas rendah Keunggulan: ✓Obyektif dan dapat dilakukan pada semua strain ✓Mencerminkan similaritas genom secara total Metode hibridisasi DNA DNA-DNA relatedness: ≥ 70% (ΔTm < 5oC) 5’CCGTACCGTA3’ 5’CCGTACCTAG3’ 3’GGCATGGCAT5’ 3’GGCATGGATC5’ Elektroforesis Elektroforesis DNA Southern Blotting Pemindahan pola band DNA pada gel ke membran nilon DNA Hybridization Temp and Hybridization Animasi Hibridisasi DNA dengan Probe DNA hyb method DNA Hybridization method: colony hyb Identifikasi pemilik DNA 3. Phylogeny Tree Phylogeny Tree dan interpretasinya Marker filogenetik Persyaratan marker filogenetik Molekul rRNA sebagai marker filogenetik Struktur molekul rRNA (rDNA) Alignment sequence rRNA (rDNA) Algoritme konstruksi pohon filogeni Validitas topologi pohon filogeni Phylogeny Tree: DNA sequences a. Phylogenetic marker molecules (molecular chronometer) b. Amplifikasi rDNA: Teknik PCR c. DNA sequencing d. Sequence alignment e. Konstruksi Phylogeny tree f. Algoritme Teori Evolusi Evolusi → perubahan frekuensi gen/genotip dalam suatu populasi (Hukum Hardy-Weinberg) Faktor evolusi: Mutasi Seleksi alam Aliran gen Genetic drift Evolusi molekular Genetika populasi a. Phylogenetic marker molecules (molecular chronometer) Ubiquitously distributed and highly conserved Functionally equivalent Homologous “housekeeping” i.e. vital molecules 16S rDNA & 18S rDNA genes (Woese, 1978) Sequences are deposited in database: DDBJ (DNA Data Bank of Japan), EMBL (The European Molecular Biology Laboratory), NCBI (National Center for Biotechnology Information - USA), etc Establish relationship among organisms b. Amplifikasi rDNA: Teknik PCR ❑ PCR: Polymerase Chain Reaction ❑ In vitro replication of DNA Komponen reaksi PCR: ✓ DNA template ✓ Primer (Forward & Reverse) ✓ dNTP (dATP, dGTP, dCTP, dTTP) ✓ Taq polymerase ✓ Mg++ ✓ Buffer ✓ Inkubasi (Thermocycler): siklus PCR ❑ Denaturasi (96oC) → 1 menit ❑ Annealing (54oC) → 1 menit ❑ Extension (72oC) → 2 menit Phylogenetic Classification 1. Isolasi dan purifikasi DNA kromosomal 2. Amplifikasi gen 16S rDNA/18S rDNA (PCR) 3. DNA sequencing : metode dideoksi (Sanger-Coulson) 4. Preparasi data DNA sequences 5. DNA sequences alignment (Clustal-X) 6. Konstruksi Phylogeny Tree (Phylip) 7. Visulaisasi Phylogeny Tree (TreeView) 8. Editing & Presenting Phylogeny Tree (Words) 16S rRNA Molekul 16S rDNA Siklus amplifikasi ruas DNA dengan PCR Siklus Amplifikasi DNA: PCR DNA Amplification: PCR Animasi PCR PCR Product of 16S rDNA Identifikasi Produk PCR c. DNA sequencing: metode dideoksi c. DNA sequencing Metode Dideoksi (Sanger & Coulson) Campuran dNTP dan ddNTP: a. dATP, dGTP, dCTP, dTTP dan ddATP b. dATP, dGTP, dCTP, dTTP dan ddGTP c. dATP, dGTP, dCTP, dTTP dan ddCTP d. dATP, dGTP, dCTP, dTTP dan ddTTP ddNTP: tidak ada OH pada atom C no. 3 sehingga tidak dapat menambahkan nukleotida → berhenti sintesis DNA !!! DNA sequencing: metode dideoksi (Manual) DNA sequencing: metode dideoksi (Manual) DNA sequence chromatogram DNA sequence d. Sequence alignment (Clustal-X) 1. GGGCUACACACGUGCUACAAUGGCGCA 2. GGGCUACACACGUGCUACAAUGGCGCA 3. GGGCUACACACGUGCUACAAUGGCGUA 4. GGGCUACACACGUGCUACAAUGGCGCA 5. GGGCGACACACGCGCUACAAUGGGCGG * * * * 4 * * * ** * * 4 * * * * * * * * * * 4 4 3 4 To align: to ensure that only homologous nucleotides are arranged in columns and consequently are recognized as being identical or different. e. Konstruksi Phylogeny tree 1. Software: Program Phylip (Phylogentic Inference Package) ❑Input: Data sequence DNA (rDNA) yang sudah dialligned ❑Output: Phylogeny Tree ✓ sebagai dasar klasifikasi ✓ sebagai dasar identifikasi 2. Software: Phydit (Phylogenetic Editor: Chun, 2000) ❑Input: alligned DNA sequences ❑Output: nucleotide similarity & difference matrix ✓ sebagai dasar identifikasi f. Algoritme Konstruksi Phylogeny Tree : Phylip 1. Diskrit: ✓Neigbour-joining (Saitou & Nei, 1987) ✓Least square (Fitch & Margoliash, 1967) 2. Non-diskrit: ✓Maximum Likelihood (Kluge & Farris, 1969) ✓Maximum Parsimony (Felsenstein, 1981) Phylogeny Tree Tree of Life: Three Domain Tree of Life: Three Domain Bacterial phylogeny  T S. galbus DSM 40089 (X79852) T S. hygroscopicus subsp. limoneus ATCC 21431 (X79853) T S. cellostaticus DSM 40189 T 52 S. lincolnensis NRRL 2936 (X79854) T S. curacoi DSM 40107 * 97 T S. chartreusis DSM 40085 (AJ 399468) * S.violaceusniger NRRL-ISPT5182 (AJ 391815) S. scabies ATCC 49173 (D63862) T S. bottropensis ATCC 25435 (D63868) T S. neyagawaensis ATCC 27449 (D63869) T S. diastatochromogenes ATCC 12309 (D63867) T S. luteoreticuli ISP 5509 (X53172) T S. acidiscabies ATCC 49003 (D63865) T S. ornatus DSM 40307 (X79326) T S. cyaneus DSM 40108 (AJ 399471) T S. griseus subsp. griseus ATCC 23345 (AF056711) T S. bikiniensis DSM40581 (X79851) T S. clavuligerus DSM 40751 T S. lavendulae IFO 12789 (D85116) T S. lavendulae subsp. lavendulae DSM 2014 (X53173) T 71 S. subrutilus DSM 40445 (X80825) T S. virginiae IFO 12827 (D85123) * T S. lavendulae subsp. fuscus IFO 14028 (D85114) T S. phosalacineus JCM 3340 (U93330) T S. brunneus IFO 14627 (U93314) T S. paracochleatus IFO 14769 (U93328) T S. setae JCM 3304 (U93332) T 100 S. cystargineus JCM 7356 (U93318) T S. aureofaciens NRRL 2209 (Y15504) * T S. kifunensis JCM 9081 (U93322) T S. azaticus IFO 13803 (U93312) T S. purpureus DSM 43460 (X53170) T S. ladakanum DSM 40587 (X53167) T S. baldacci DSM 40845 (X53164) T S. olivoreticuli DSM 40105 (X53166) T S. cinnamoneus ISP 5005 (X53171) T S. abikoensis DSM 40831 (X53168) T S. salmonis DSM 40895 (X53169) T S. griseocarneus DSM 40004 (X99943) T S.. albus subsp. albus DSM 40313 (X53163) T S. violaceusniger NRRL-ISP 5563 (AJ 391823) T S. violaceusniger NRRL B-1476 (AJ 391822) 95 S. violaceusniger NRRL B-1356 (AJ 391812) * S. hygroscopicus NRRL 2339 (AJ 391821) T S. hygroscopicus NRRL 2387 (AJ 391820) S. hygroscopicus NRRL B-1477 (AJ 391819) T 94 S. melanosporofaciens NRRL B-12234 (AJ 391837) Streptomyces sp. strain.76 * S. violaceusniger NRRL B-1865 (AJ 391818) T S. malaysiensis DSM 41697 (AF117304) S. hygroscopicus subsp. geldanus NRRL 3602 (AJ 391824) T S. chrestomyceticus ISP 5545 80 T S. lydicus ATCC 25470 (Y15507) * * S.violaceusniger NRRL 8097 (AJ 391816) T S. mashuensis DSM 40221 (X79323) T S. sparsogenes NRRL 2940 (AJ391817) T S. odorifer DSM 40347 (Z76682) T S. felleus DSM 40130 (Z76681) T 100 S. canescens DSM 40001 (Z76684) T S. albidoflavus DSM 40455 (Z76676) * T 62 S. sampsonii ATCC 25495 (D63871) T S. rutgersensis DSM 40077 (Z76688) * T S. gougerotii DSM 40324 (Z76687) T S. intermedius DSM 40372 (Z76686) T S. diastaticus DSM 40496 (X53161) T S. ambofaciens ATCC 23877 (M27245) T S. tendae ATCC 19812 (D63873) T S. eurythermus ATCC 14975 (D63870) T S. caelestis NRRL 2418 (X80824) T S. brasiliensis DSM 43159 (X53162) 57 S. violaceusniger NRRL 2834 (AJ 391813) *. S. violaceusniger NRRL B-5799 (AJ 391814) 85 T S. thermovulgaris DSM 40444 (Z68094) T * S. alkalitolerans TA 56 (AJ000284) 52 T S. thermogriseus CCTCCAA 97014 (AF056714) T * S. thermoviolaceus DSM 41392 (Z68095) T S. thermoviolaceus subsp. violaceus DSM 40443 (Z68096) T S. thermodiastaticus DSM 40573 (Z68101) T S. bluensis ISP 5569 (X79324) 100 T S. megasporus DSM 41476 (Z68100) T * S. macrosporus DSM 41449 (Z68099) 0.01 Figure 4.4. Neighbour-joining tree (Saitou & Nei, 1987) showing relationships between marker strains and representatives of the genus Streptomyces based on nearly complete 16S rDNA sequences. The asterisks denote the branches that were also recovered using the least-squares (Fitch & Margoliash, 1967), maximum-likelihood ( Felsenstein, 1981) and maximum- parsimony (Kluge & Farris, 1969) treeing algorithms. The numbers at the nodes indicate the levels of bootstrap support (%) based on a neighbour-joining analysis of 1000 resampled data sets. The arrow indicates the estimated root position of the tree. The scale bar indicates one nucleotide substitution per 100 nucleotides in 16S rRNA gene sequences. NT similarity table A B C D A 2/1451 5/1434 9/1356 B 99,98 18/1457 25/1467 C 99,95 99,78 28/1455 D 99,80 99,70 99,65 Phydit: Phylogenetic Editor