Secuenciación de ADN y análisis genómicos 2024 PDF

29/10/2024 CURSO DE BIOINFORMÁTICA 2024 Secuenciación masiva de ADN y análisis de datos de secuenciación Dr. Andrés Marcoleta [email protected] 1...

29/10/2024 CURSO DE BIOINFORMÁTICA 2024 Secuenciación masiva de ADN y análisis de datos de secuenciación Dr. Andrés Marcoleta [email protected] 1 El estudio de las secuencias de ADN busca descifrar la información codificada y usarla para describir a los organismos que la contienen 2 1  29/10/2024 Protein/metabolites Technological developments: the omics revolution High performance liquid chromatography Nucleic acids DNA & RNA sequencing machines Mass spectrometry Gas chromatography 3 4 2  29/10/2024 Genomics and the development of DNA sequencing 5 6 3  29/10/2024 Tecnologías de secuenciación masiva y el desarrollo de la genómica 7 Tecnologías de secuenciación masiva y el desarrollo de la genómica 8 4  29/10/2024 Hardware Capacidad de almacenamiento Capacidad de secuenciación Capacidad de cómputo Genómica Software Desarrollo de herramientas Implementación de de búsqueda y análisis bases de datos 9 10 5  29/10/2024 11 16S rRNA amplicon sequencing (metabarcoding) 12 6  29/10/2024 13 14 7  29/10/2024 First and second generation Third generation 15 16 8  29/10/2024 Short reads with with quality! 17 18 9  29/10/2024 19 Illumina sequencing allows obtaining paired-end reads Library preparation and Sequencing Paired-end reads help during the assembly process 20 10  29/10/2024 Third-generation: Single-molecule sequencing Long reads with limited quality! Pacific Biosciences (PacBio) Oxford Nanopore (MinION) No PCR amplification of the sample (avoid bias associated to PCR amplification) 21 22 11  29/10/2024 23 PacBio library preparation: Two main modes 24 12  29/10/2024 Flow cell with hundreds of micro-wells, each containing a synthetic bilayer perforated by biological nanopores Sequencing is accomplished by measuring characteristic changes in current induced as the bases are threaded through the pore by a motor enzyme Minimal sample preparation Read lenght: mean 6 kbp, up to hundreds of Kbp output: 10 Gb to 20 Gb Relatively high error rates (improved with new chemistry and flowcells) 25 26 13  29/10/2024 27 28 14  29/10/2024 Next-generation sequencing data analysis 29 Example workflow for massive sequencing data analysis (genomics) Assembly Annotation Genbank Pre-processing FastQ FastA 30 15  29/10/2024 Computer tools for DNA sequencing and genomics data analysis CursodeGenóm icaMicrobianayMetagenómica.14-16 dediciembre2021 Repository of open-source computing tools 31 Wrappers and web platforms for (meta)genomic data analysis (public and free) 32 16  29/10/2024 FASTQ format Phred Score (Q) 33 Tipos de Lecturas NanoPore y PacBio® - 10 – 100 kpb - Baja calidad (alta probabilidad de error) - 100 – 250 pb - Alta calidad Illumina® Single-end reads Paired-end reads 34 17  29/10/2024 Fastq Paired-end reads mislecturas_R1.fastq @M02286:19:000000000-AA549:1:1101:12677:1273 1:N:0:23 CCTACGGGTGGCAGCAGTGAGGAATATTGGTCAATGGACGGAAGTCT + ABC8C,:@F:CE8,B-,C,-6-9-C,CE9-CC--C-