Nucleic Acids - 2024/2025 Biochemistry I - University of Babylon PDF

Republic of Iraq Ministry of Higher Education and Scientific Research University of Babylon College of Pharmacy Department of Laboratory and Clinical Sciences Biochemistry I For...

Republic of Iraq Ministry of Higher Education and Scientific Research University of Babylon College of Pharmacy Department of Laboratory and Clinical Sciences Biochemistry I For 3rd Year Pharmacy Students/ Semester I-2024/2025 Nucleic acid By Lec. Dr. Zeyad H. Nafaee 1  Course Information  Title of the course: Biochemistry I  Course number: 314  Level: 3rd Class, 1st Semester  Credit hours/week : Theory (Lectures) 3 credits, Practical (Laboratory) 1 credit  Reference text book : Harper’s Illustrated Biochemistry, 26th Edition  University of Babylon /College of Pharmacy  Name of the lecturer: Lecturer Dr. Zeyad Hasan A. Nafaee  Name of the Lecture: Nucleic acids Objectives  To integrate key concepts describing the traditional core topics of Biochemistry: structure and metabolism.  At the end of the semester, the students should be able to understand;  Chemical structure, function of all biomolecules present in the living organisms. 2 University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year Introduction  Nucleic Acids is polynucleotide molecules  Polymeric molecule composed of only four types of monomeric units called nucleotide,  Genetic information(the genetic code) is coded along the length of this polymeric molecule.  Nucleic acid is Deoxyribonucleic acid (DNA), ribonucleic acid (RNA).  Basic information pathway is that DNA directs the synthesis of RNA, which in turn directs protein synthesis.  DNA Transcription mRNA Translation Protein  Genes do not function autonomously; their replication and function are controlled by various gene. products, often in collaboration with components of various signal transduction pathways. 3 University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year  Chemical Properties  Structures  Functions  Building blocks  Replication  Transcription  Translation 4 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Nucleic Acid Importance  Knowledge of the structure and function of nucleic acids is essential in understanding genetics, many aspects of pathophysiology and the genetic basis of disease.  In many cases, the resulting double-stranded DNA transcript is integrated into the host genome and subsequently serves as a template for gene expression and from which new viral RNA genomes can be transcribed.  Genetic material for some animal and plant viruses is RNA rather than DNA. Although some RNA viruses never have their information transcribed into a DNA molecule, many animal RNA viruses specifically, the retroviruses (e.g HIV virus) are transcribed by an RNA-dependent DNA polymerase, the so-called reverse transcriptase, to produce a double- stranded DNA copy of their RNA genome.  Synthetic purine and pyrimidine analogs that contain halogens, thiols, or additional nitrogen are employed for chemotherapy of cancer either by inhibiting an enzyme of nucleotide biosynthesis or by being incorporated into DNA or RNA and AIDS and as suppressors of the immune response during organ transplantation.. 5 University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year Antibiotic target sites 6 Reference: Madigan and Martinko, 2006) University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year History  In 1871 Miescher isolated a phosphorous containing material from the cell nucleus.  He supposed that this „nuclein” is needed for cell division process.  He predicted that the knowledge of the interactions between the materials from the nucleus, proteins and their direct metabolic products will gradually enlighten the internal processes of the cells.  The attention of the researchers towards deoxyribonucleic acids (DNA) was postponed until 1944.  In 1944 , Avery, MacLeod, and McCarty were first made a series of experiments demonstrating that DNA contained the genetic information.  Avery and coworkers discovered that this material (instead of proteins) is responsible for the heredity of various properties in bacteria. 7 University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year History  Watson and Crick published the structure of the DNA double helix in 1953 (Nobel-prize in medicine, 1962)  Rosalind Elsie Franklin was an English chemist and X-ray crystallographer.  She made contributions to the understanding of the molecular structures of DNA (deoxyribonucleic acid), RNA (ribonucleic acid), viruses, coal, and graphite.  Consequently, DNA persists for considerable periods and has been detected even in fossils. 8 University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year Single Strand DNA Single Strand RNA Pyrimidines Pyrimidines Purines Purines Sugar (ribose) Sugar (ribose) Phosphate Phosphate 9 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Purines and pyrimidines  Purines and pyrimidines are nitrogen-containing heterocycles, cyclic compounds whose rings contain both carbon and other elements (hetero atoms).  Note that the smaller pyrimidine has the longer name and the larger purine the shorter name and that their six-atom rings are numbered in opposite directions.  Planar character of purines and pyrimidines facilitates their close association, or “stacking,” which stabilizes double-stranded DNA.  Oxo and amino groups of purines and pyrimidines exhibit keto-enol and amine-imine tautomerism but physiologic conditions strongly favor the amino and oxo forms. Tautomerism of the oxo and amino Note: atoms are numbered according to the international system. 10 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Purines and pyrimidines (C) (U) (T) (A) (G) 11 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Nucleosides & Nucleotides  Nucleosides are derivatives of purines and pyrimidines that have a sugar linked to a ring nitrogen.  Numerals with a prime (eg, 2′ or 3′) distinguish atoms of the sugar from those of the heterocyclic base.  Sugar in ribonucleosides is D-ribose, and in deoxyribonucleosides it is 2-deoxy-D-ribose.  Sugar is linked to the heterocyclic base via a -N-glycosidic bond, almost always to N-1 of a pyrimidine or to N-9 of a purine.  Both syn or anti conformers occur in nature, anti conformers predominate 12 University of Babylon /College of Pharmacy Nucleosides & Nucleotides 2024-2025/ Semester I/ 3rd year  Mononucleotides are nucleosides with a phosphoryl group esterified to a hydroxyl group of the sugar. The 3′- and 5′-nucleotides are nucleosides with a phosphoryl group on the 3′- or 5′-hydroxyl group of the sugar, respectively.  Nucleotides are the monomer units or building blocks of nucleic acids.  Since most nucleotides are 5′-, the prefix “5′-” is usually omitted when naming them.  UMP and dAMP thus represent nucleotides with a phosphoryl group on C-5 of the pentose.  Additional phosphoryl groups linked by acid anhydride bonds to the phosphoryl group of a mononucleotide form nucleoside diphosphates and triphosphates.  Steric hindrance by the base restricts rotation about the β-N-glycosidic bond of nucleosides and nucleotides. 13 University of Babylon /College of Pharmacy Nucleosides & Nucleotides 2024-2025/ Semester I/ 3rd year  Single-letter abbreviations are used to identify adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), whether free or present in nucleosides or nucleotides. The prefix “d” (deoxy) indicates that the sugar is 2′-deoxy-D-ribose (eg, dGTP). 14 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Nucleic acids  5′-phosphoryl group of a mononucleotide can esterify a second -OH group, forming a phosphodiester. Most commonly, this second -OH group is the 3′-OH of the pentose of a second nucleotide.  Most nucleosides contain D-ribose or 2-deoxy-Dribose linked to N-1 of a pyrimidine or to N-9 of a purine by a β-glycosidic bond whose syn conformers predominate.  This forms a dinucleotide in which the pentose moieties are linked by a 3′ → 5′ phosphodiester bond to form the “backbone” of RNA and DNA.  While formation of a dinucleotide may be represented as the elimination of water between two monomers, the reaction in fact strongly favors phosphodiester hydrolysis.  Phosphodiesterase bonds rapidly catalyze the hydrolysis of phosphodiester bonds whose spontaneous hydrolysis is an extremely slow process.  RNAs are far less stable than DNA since the 2′-hydroxyl group of RNA (absent from DNA) functions as a nucleophile during hydrolysis of the 3′,5′-phosphodiester bond. 15 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year  (A) nucleotides equals that of thymidine (T) nucleotides (A = T), while the concentration of deoxyguanosine (G) nucleotides equals that of deoxycytidine (C) nucleotides (G = C), led Watson, Crick, and Wilkins to propose in the early 1950s a model of a double- stranded DNA molecule.  Two strands of this double-stranded helix are held in register by hydrogen bonds between the purine and pyrimidine bases of the respective linear molecules.  Pairings between the purine and pyrimidine nucleotides on the opposite strands are very specific and are dependent upon hydrogen bonding of A with T and G with C.  Phosphodiester bond is represented by P or p, bases by a single letter, and pentoses by a vertical line.  Where all the phosphodiester bonds are 5′ → 3′, a more compact notation is possible: pGpGpApTpCpA  Representation indicates that the 5′-hydroxyl— but not the 3′-hydroxyl—is phosphorylated.  Most compact representation shows only the base sequence with the 5′- end on the left and the 3′- end on the right. The phosphoryl groups are assumed but not shown: GGATCA 16 University of Babylon /College of Pharmacy DNA 2024-2025/ Semester I/ 3rd year 17 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Chemical structure of Nucleic acids 18 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Exercise Q/ Give the complement strand of the following DNA strands? 1/ 5′ AGTTCTGTTCCAGGCC 3′ 2/ 3′ TTTTTTGCGGCAT 5′ 3/ 3′ ATACACTATTCTCAG 5′ 19 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year DNA  DNA consists of four bases A, G, C, and T which are held in linear array by phosphodiester bonds through the 3′ and 5′ positions of adjacent deoxyribose moieties.  These strands form a double helix around a central axis.  The 3 × 109 base pairs of DNA in humans are organized into the haploid complement of 23 chromosomes.  The exact sequence of these 3 billion nucleotides defines the uniqueness of each individual.  DNA provides a template for its own replication and thus maintenance of the genotype and for the transcription of the 30,000–50,000 genes into a variety of RNA molecules.  If a distance between two nucleotides was 1 mm, then the length of the entire human genome would be ~ 3200 kms.  Length of an average gene would be ~300 m, while that of the coding sequence ~ 1 m. 20 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Nucleic Acid 21 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year DNA Conformations  Common form of DNA is right handed because as one looks down the double helix the base residues form a spiral in a clockwise direction.  Two strands of the double-helical molecule, each of which possesses a polarity, are antiparallel; ie, one strand runs in the 5′ to 3′ direction and the other in the 3′ to 5′ direction.  Opposite strand is considered the coding strand because it matches the RNA transcript that encodes the protein.  The two strands, in which opposing bases are held together by hydrogen bonds, wind around a central axis in the form of a double helix.  Double-stranded DNA exists in at least six forms (A–E and Z).  B form is usually found under physiologic conditions (low salt, high degree of hydration). A single turn of B-DNA about the axis of the molecule contains ten base pairs.  Distance spanned by one turn of B-DNA is 3.4 nm.  Width (helical diameter) of the double helix in B-DNA is 2 nm. 22 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year DNA Conformations  B-DNA double helix is built up from two antiparallel, complementary strands by Watson-Crick type base pairing. Further DNA structures, such as the A- or Z-DNA are also known.  Base pairing (hybridization): A-T, two hydrogen bonds G-C, three hydrogen bonds 23 University of Babylon /College of Pharmacy DNA 2024-2025/ Semester I/ 3rd year 24 University of Babylon /College of Pharmacy RNA 2024-2025/ Semester I/ 3rd year  Ribonucleic acid (RNA) is a polymer of purine and pyrimidine ribonucleotides linked together by 3′,5′- phosphodiester bridges analogous to those in DNA.  Information within the single strand of RNA is contained in its sequence (“primary structure”) of purine and pyrimidine nucleotides within the polymer.  Sequence is complementary to the template strand of the gene from which it was transcribed.  Because of this complementarity, an RNA molecule can bind specifically via the base-pairing rules to its template DNA strand; it will not bind (“hybridize”) with the other (coding) strand of its gene.  The sequence of the RNA molecule (except for U replacing T) is the same as that of the coding strand of the gene.  Nearly all of the several species of RNA are involved in some aspect of protein synthesis.  In eukaryotic cells, including mammalian cells, is degraded within the nucleus, and it never serves as either a structural or an informational entity within the cellular cytoplasm. 25 University of Babylon /College of Pharmacy RNA Structure 2024-2025/ Semester I/ 3rd year  RNA exists in several different single-stranded structures, most of which are involved in protein synthesis.  The linear array of nucleotides in RNA consists of A, G, C, and U, and the sugar moiety is ribose.  RNA is organized in several unique structures  Diagrammatic representation of the secondary structure of a single-stranded RNA molecule in which a stem loop, or “hairpin,” has been formed and is dependent upon the intramolecular base pairing.  Note that A forms hydrogen bonds with U in RNA. 26 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Types of RNAs  In all prokaryotic and eukaryotic organisms, three main classes of RNA molecules exist:  messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA(rRNA).  Each differs from the others by size, function, and general stability.  ribosomal RNAs; rRNAs have structural roles wherein they con-tribute to the formation and function of ribosomes (the organellar machinery for protein synthesis) or serve as adapter molecules  transfer RNAs; tRNAs for the translation of RNA information into specific sequences of polymerized amino acids.  Some RNA molecules have intrinsic catalytic activity.  The activity of these ribozymes often involves the cleavage of a nucleic acid.  Those cytoplasmic RNA molecules that serve as templates for protein synthesis (ie, that transfer genetic information from DNA to the protein-synthesizing machinery) are designated messenger RNAs, or mRNAs.  In all eukaryotic cells there are small nuclear RNA (snRNA) species that are not directly involved in protein synthesis but play pivotal roles in RNA processing.These relatively small molecules vary in size from 90 to about 300 nucleotides. 27 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Chemical Properties of Nucleic acids  Nucleic acids depicted possesses a polarity; one end has a 5′-hydroxyl or phosphate terminal while the other has a 3′-phosphate or hydroxyl terminal.  Nucleosides or free purine or pyrimidine bases are uncharged at physiologic pH. By contrast, the primary phosphoryl groups (pK about 1.0) and secondary phosphoryl groups (pK about 6.2) of nucleotides ensure that they bear a negative charge at physiologic pH.  Nucleotides can act as proton donors or acceptors at pH values two or more units above or below neutrality.  Conjugated double bonds of purine and pyrimidine derivatives absorb ultraviolet light.  Mutagenic effect of ultraviolet light results from its absorption by nucleotides in DNA with accompanying chemical changes.  Abs. spectra are pH-dependent, at pH 7.0 all the common nucleotides absorb light at a wavelength close to 260 nm.  The concentration of nucleotides and nucleic acids thus often is expressed in terms of “absorbance at 260 nm.” 28 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Exercise Ex/ Draw the structures of the dTTP and the ADP from the bellow structures showing the bonds between the new connected molecules. 29 University of Babylon /College of Pharmacy Nucleosides & Nucleotides 2024-2025/ Semester I/ 3rd year Nucleotides serve multiple additional functions  They form a part of many coenzymes and serve as donors of phosphoryl groups (eg, ATP or GTP), of sugars (eg, UDP- or GDP-sugars), or of lipid (eg, CDP-acylglycerol).  Regulatory nucleotides include the second messengers cAMP and cGMP, the control by ADP of oxidative phosphorylation, and allosteric regulation of enzyme activity by ATP, AMP, and CTP.  Synthetic purine and pyrimidine analogs that contain halogens, thiols, or additional nitrogen are employed for chemotherapy of cancer and AIDS and as suppressors of the immune response during organ transplantation. 30 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Additional purines and pyrimidines  Small quantities of additional purines and pyrimidines occur in DNA and RNAs.  Examples include 5-methylcytosine of bacterial and human DNA, 5-hydroxymethylcytosine of bacterial and viral nucleic acids, and mono- and di-N-methylated adenine and guanine of mammalian messenger RNAs These atypical bases function in oligonucleotide recognition and in regulating the half-lives of RNAs.  Free nucleotides include hypoxanthine, xanthine, and uric acid intermediates in the catabolism of adenine and guanine.  Methylated heterocyclic bases of plants include the xanthine derivatives caffeine of coffee, theophylline of tea, and theobromine of cocoa.  Posttranslational modification of preformed polynucleotides can generate additional bases such as pseudouridine, in which D-ribose is linked to C-5 of uracil by a carbon-to-carbon bond rather than by a β-N- glycosidic bond.  Nucleotide pseudouridylic acid Ψ arises by rearrangement of UMP of a preformed tRNA.  Similarly, methylation by S-adenosylmethionine of a UMP of preformed tRNA forms TMP (thymidine 31 monophosphate), which contains ribose rather than deoxyribose. University of Babylon /College of Pharmacy Nucleic Acid 2024-2025/ Semester I/ 3rd year  Nucleic acids contain, in addition to A, G, C, T, and U, traces of 5-methylcytosine, 5-hydroxymethylcytosine, pseudouridine (Ψ), or N-methylated bases.  A primed numeral locates the position of the phosphate on the sugars of mononucleotides (eg, 3′- GMP, 5′-dCMP). Additional phosphoryl groups linked to the first by acid anhydride bonds form nucleoside diphosphates and triphosphates.  Nucleoside triphosphates have high group transfer potential and participate in covalent bond syntheses.  Mononucleotides linked by 3′ → 5′-phosphodiester bonds form polynucleotides, directional macromolecules with distinct 3′- and 5′- ends. 32 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Additional purines and pyrimidines 33 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Synthetic nucleotide analogs used in chemotherapy  Synthetic analogs of purines, pyrimidines, nucleosides, and nucleotides altered in either the heterocyclic ring or the sugar moiety have numerous applications in clinical medicine.  Their toxic effects reflect either inhibition of enzymes essential for nucleic acid synthesis or their incorporation into nucleic acids with resulting disruption of base-pairing.  Oncologists employ 5-fluoro- or 5- iodouracil, 3-deoxyuridine, 6-thioguanine and 6-mercaptopurine, 5- or 6- azauridine, 5- or 6-azacytidine, and 8-azaguanine which are incorporated into DNA prior to cell division.  Purine analog allopurinol, used in treatment of hyperuricemia and gout, inhibits purine biosynthesis and xanthine oxidase activity.  Cytarabine is used in chemotherapy of cancer.  Azathioprine, which is catabolized to 6-mercaptopurine, is employed during organ transplantation to suppress immunologic rejection. 34 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Synthetic nucleotide analogs used in chemotherapy 35 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Nucleotides Serve Diverse Physiologic Functions  Nucleotides participate in reactions that fulfill physiologic functions as diverse as protein synthesis, nucleic acid synthesis, regulatory cascades, and signal transduction pathways.  Acid anhydrides, unlike phosphate esters, have high group transfer potential.  ΔG for the hydrolysis of each of the terminal phosphates of nucleoside triphosphates is about −7 kcal/mol (−30 kJ/mol).  High group transfer potential of purine and pyrimidine nucleoside triphosphates permits them to function as group transfer reagents.  Cleavage of an acid anhydride bond typically is coupled with a highly endergonic process such as covalent bond synthesis eg, polymerization of nucleoside triphosphates to form a nucleic acid.  In addition to their roles as precursors of nucleic acids, ATP, GTP, UTP, CTP, and their derivatives each serve unique physiologic functions discussed in other chapters. For examples include: i. Role of ATP as the principal biologic transducer of free energy. ii. Second messenger cAMP. iii. Adenosine 3′-phosphate-5′-phosphosulfate, sulfate donor for sulfated proteoglycans and for sulfate conjugates of 36 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Denaturation (Melting) of DNA  Double-stranded structure of DNA can be separated into two component strands (melted) in solution by increasing the temperature or decreasing the salt concentration.  Not only do the two stacks of bases pull apart but the bases themselves unstack while still connected in the polymer by the phosphodiester backbone.  Concomitant with this denaturation of the DNA molecule is an increase in the optical absorbance of the purine and pyrimidine bases a phenomenon referred to as hyperchromicity of denaturation.  Because of the stacking of the bases and the hydrogen bonding between the stacks, the double-stranded DNA molecule exhibits properties of a rigid rod and in solution is a viscous material that loses its viscosity upon denaturation.  Strands of a given molecule of DNA separate over a temperature range. The midpoint is called the melting temperature, or Tm. The Tm is influenced by the base composition of the DNA and by the salt concentration of the solution. 37 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Denaturation (Melting) of DNA  DNA rich in G–C pairs, which have three hydrogen bonds, melts at a higher temperature than that rich in A–T pairs, which have two hydrogen bonds. G–C bonds are much more resistant to denaturation, or “melting,” than A–T-rich regions.  A tenfold increase of monovalent cation concentration increases the Tm by 16.6 °C.  Formamide, which is commonly used in recombinant DNA experiments, destabilizes hydrogen bonding between bases, thereby lowering the Tm.  This allows the strands of DNA or DNA-RNA hybrids to be separated at much lower temperatures and minimizes the phosphodiester bond breakage that occurs at high temperatures. 38 University of Babylon /College of Pharmacy Differences between DNA, and RNA 2024-2025/ Semester I/ 3rd year  Sugar moiety to which the phosphates and purine and pyrimidine bases are attached, in RNA is ribose, while in DNA is 2′-deoxyribose.  Pyrimidine components of RNA differ from those of DNA; (i) RNA contains the ribonucleotides of A, G, C, and U, while (ii) DNA contains the ribonucleotides of A, G, C, and T.  RNA exists as a single strand, whereas DNA exists as a double-stranded helical molecule (complementary base sequence with opposite polarity). However, single strand of RNA is capable of folding back on itself like a hairpin and thus acquiring double stranded characteristics.  Since the RNA molecule is a single strand complementary to only one of the two strands of a gene, its guanine content does not necessarily equal its cytosine content, nor does its adenine content necessarily equal its uracil content.  RNA can be hydrolyzed by alkali to 2′,3′ cyclic diesters of the mononucleotides, compounds that cannot be formed from alkali-treated DNA because of the absence of a 2′-hydroxyl group.  Alkali lability of RNA is useful both diagnostically and analytically. 39 University of Babylon /College of Pharmacy Replication 2024-2025/ Semester I/ 3rd year  DNA replication is the process by which the genome's DNA is copied in cells. Before a cell divides, it must first copy (or replicate) its entire genome so that each resulting daughter cell ends up with its own complete genome.  These events are divided into four major stages: initiation, unwinding, primer synthesis, and elongation. 40 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Replication 41 University of Babylon /College of Pharmacy PCR 2024-2025/ Semester I/ 3rd year  Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing (amplifying) millions to billions of copies of a specific segment of DNA, which can then be studied in greater detail.  PCR involves using short synthetic DNA fragments called primers to select a segment of the genome to be amplified, and then multiple rounds of DNA synthesis to amplify that segment.  The reaction consists of cycles, each of which can be divided into three steps: 1. The separation of the two strands of the double stranded template dsDNA (denaturation, 94–97 °C). 2. The primers hybridize to the template strands at their complementary sequences (annealing, 50–70 °C), and by this the multipliable section is determined. 3. The DNA polymerase builds up the new strands using the dNTP building blocks (extention, 72 °C). 42 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year PCR Substances required for PCR:  A double-stranded DNA template (e.g. from the studied cell).  The synthetic oligonucleotide primers in excess amounts. By hybrdization to their complementary sequences, they will determine the termini of the newly synthesized DNA section.  DNA „building blocks” - dNTP-s (dCTP, dATP, dGTP and dTTP ) in equal amounts.  A buffer and Mg(II) ions to ensure the optimal reaction conditions.  Heat-stable DNA polymerase (the Taq polymerase DNA synthesizing enzyme originates from the Thermus aquaticus bacteria that live in thermal water).  There are about 37 types of PCR, The common PCR types are Real-Time PCR (Quantitative PCR (qPCR)); Repetitive sequence-based PCR; Reverse Transcriptase PCR (RT-PCR); Reverse-Transcriptase Real-Time PCR (RT-qPCR) 43 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Transcription  DNA transcription produces a single-stranded RNA molecule that is complementary to one strand of DNA.  Transcription is performed by enzymes called RNA polymerases, which link nucleotides to form an RNA strand (using a DNA strand as a template). 44  Transcription has three stages: initiation, elongation, and termination University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Translation  Translation is the way genetic code contained in mRNA is decoded to produce a specific sequence of amino acids in a polypeptide chain.  In this process, the ribosome translates the mRNA produced from DNA into a chain of specific amino acids.  This chain of amino acids leads to protein synthesis 45 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Translation 46 University of Babylon /College of Pharmacy 2024-2025/ Semester I/ 3rd year Exercise Q/ transcript and translate the following DNA strand using the table of the codon in the lecture? 1/ 5′ ATGTATTCTCCGCTCTGTCTCACCCAGGATTGA 3′ 2/ 3′ TACTGCCACTTTTGGAGACTGTGTACGTCGAGGACC 5′ 47