Molecular technologies I.pdf

Molecular Genetic & Molecular Processes – BMS 23010C Dr. Amel Hamdi Fall Semester 2024 - 2025  Molecular technologies  Eukaryotic transcription and translation are complex and highly regulated processes that are central to gene expression  Advanced tools and techniques to...

Molecular Genetic & Molecular Processes – BMS 23010C Dr. Amel Hamdi Fall Semester 2024 - 2025  Molecular technologies  Eukaryotic transcription and translation are complex and highly regulated processes that are central to gene expression  Advanced tools and techniques to study, manipulate, and understand these processes at the molecular level. Various molecular technologies connect to these key biological functions: Transcriptional Profiling Technologies These methods enable the study of gene expression by focusing on transcription, the process by which DNA is transcribed into RNA. RNA Sequencing (RNA-seq): This is a powerful tool used to analyze the transcriptome—the set of all RNA molecules, including mRNA, in a cell. RNA-seq can quantify gene expression levels, discover new transcripts, and analyze alternative splicing events. It offers high resolution and helps to study transcriptional dynamics in eukaryotes.  Chromatin Immunoprecipitation Sequencing (ChIP-seq): ChIP-seq helps study how transcription factors and other DNA-binding proteins regulate gene expression by binding to specific regions of the genome. By combining this with sequencing, researchers can determine protein-DNA interactions, which is crucial for understanding transcriptional regulation. CRISPR/Cas9 and CRISPRi/a: CRISPR technologies allow for genome editing and transcriptional modulation in eukaryotic cells. CRISPR interference (CRISPRi) can block transcription by targeting gene promoters, while CRISPR activation (CRISPRa) can enhance transcription of specific genes. Gene Transcription and RNA Modification Transcription in Eukaryotes RNA Modification A Comparison of Transcription and RNA Modification in Bacteria and Eukaryotes Translation of mRNA The Genetic Basis for Protein Synthesis Structure and Function of tRNA Ribosome Structure and Assembly Stages of Translation Eukaryotes Have Multiple RNA Polymerases That Are Structurally Similar to the Bacterial Enzyme RNA polymerase I: transcribes all of the genes for ribosomal RNA (rRNA) except for the 5S rRNA. RNA polymerase II: transcribes all protein-encoding genes. Therefore, it is responsible for the synthesis of all mRNAs. It also transcribes the genes for most snRNAs which are needed for RNA splicing and several types of genes that produce other non-coding RNAs RNA polymerase III: transcribes all tRNA genes and the 5S rRNA gene. Eukaryotic Protein-Encoding Genes Have a Core Promoter and Regulatory Elements A common pattern found within the promoter of protein-encoding genes recognized by RNA polymerase II. The start site usually occurs at adenine (A); two pyrimidines (Py: cytosine or thymine) and a cytosine (C) are to the left of this adenine, and five pyrimidines (Py) are to the right. Eukaryotic Protein-Encoding Genes Have a Core Promoter and Regulatory Elements A TATA box is approximately 25 bp upstream from the start site. However, the sequences that constitute eukaryotic promoters are quite diverse, and not all protein-encoding genes have a TATA box. Regulatory elements, such as GC or CAAT boxes, vary in their locations but are often found in the −50 to −100 region. What is the functional role of the TATA box? The TATA box provides a precise starting point for the transcription of eukaryotic protein-encoding genes Regulatory elements: Short DNA sequences that affect the ability of RNA polymerase to recognize the core promoter and begin the process of transcription. These elements are recognized by transcription factors—proteins that influence the rate of transcription. There are two categories of regulatory elements: Activating sequences, known as enhancers (cis-acting elements), are needed to stimulate transcription. In the absence of enhancer sequences, most eukaryotic genes have very low levels of basal transcription. Under certain conditions, it may be necessary to prevent transcription of a given gene. This occurs via silencers—DNA sequences that are recognized by transcription factors that inhibit transcription. When Is Transcription of Eukaryotic Protein-Encoding Genes Initiated Transcription of Eukaryotic Protein-Encoding Genes Is Initiated When RNA Polymerase II and General Transcription Factors Bind to a Promoter Sequence Three categories of proteins are needed for basal transcription at the core promoter: RNA polymerase II General transcription factors (TFIID TFIIB TFIIF TFIIE TFIIH) Complex called mediator  Why is carboxyl terminal domain (CTD) phosphorylation functionally important? The phosphorylation of the CTD allows RNA polymerase to proceed to the elongation phase of transcription Mediator: A multisubunit complex that mediates the effects of regulatory transcription factors on the function of RNA polymerase II. Mediator can influence the ability of TFIIH to phosphorylate CTD, and subunits within mediator itself have the ability to phosphorylate CTD. Because CTD phosphorylation is needed to release RNA polymerase II from TFIIB, mediator plays a key role in the ability of RNA polymerase II to switch from the initiation to the elongation stage of transcription. Transcriptional Termination Occurs After the 3′ End of the Transcript Is Cleaved Near the Polyadenylation Signal Sequence  Eukaryotic mRNAs are modified by cleavage near their 3′ end and the subsequent attachment of a string of adenine nucleotides After RNA polymerase II has transcribed the polyadenylation signal sequence, the RNA is cleaved just downstream from this sequence. This cleavage occurs before transcriptional termination. Two models have been proposed for transcriptional termination: Allosteric model Torpedo model Which RNA polymerase in eukaryotes is responsible for the transcription of genes that encode proteins? 1.RNA polymerase I 2.RNA polymerase II 3.RNA polymerase III 4.All of the above transcribe protein-encoding genes. An enhancer is a _____________ that ___________ the rate of transcription. 1.trans-acting factor, increases 2.trans-acting factor, decreases 3.cis-acting element, increases 4.cis-acting element, decreases The basal transcription apparatus is composed of 1.five general transcription factors. 2.RNA polymerase II. 3.a DNA sequence containing a TATA box and transcriptional start site. 4.all of the above.  RNA Modification RNA modifications are changes that may occur to an RNA transcript after it has been made  During transcription, a pre-mRNA is made, and it corresponds to the entire gene sequence that was transcribed.  To produce a functional, or mature, mRNA, the sequences in the pre-mRNA that correspond to the introns are removed and the exons are connected, or spliced, together. Modifications That May Occur to RNAs Key Differences Between Transcription and RNA Modification in Bacteria and Eukaryotes Many similarities have been noted between bacteria and eukaryotes. However, these processes are more complex in eukaryotes than in their bacterial counterparts Translation of mRNA Translation is the process in which the sequence of codons within mRNA provides the information to synthesize the sequence of amino acids that constitute a polypeptide. One or more polypeptides then fold and assemble to create a functional protein During Translation, the Codons in mRNA Provide the Information to Make a Polypeptide with a Specific Amino Acid Sequence The relationships among the DNA coding sequence, mRNA codons, tRNA anticodons, and amino acids in a polypeptide  What is anticodon ? A three-nucleotide sequence in tRNA that is complementary to a codon in mRNA The codons in mRNA are recognized by the anticodons in transfer RNA (tRNA) molecules  The sequence of nucleotides within DNA is transcribed to make a complementary sequence of nucleotides within mRNA.  This sequence of nucleotides in mRNA is translated into a sequence of amino acids in a polypeptide.  tRNA molecules act as intermediates in this translation process The ability of mRNA to be translated into a specific sequence of amino acids relies on the genetic code The sequence of bases within an mRNA molecule provides coded information that is read in groups of three nucleotides known as codons The sequence of three bases in most codons specifies a particular amino acid. These codons are termed sense codons. For example, the codon AGC specifies the amino acid serine. The codon AUG, which specifies methionine, functions as a start codon; it is usually the first codon that begins a polypeptide sequence. The AUG codon can also be used to specify additional methionines within the coding sequence.  Three codons, UAA, UAG, and UGA, which are known as stop codons, are signals that end the process of translation. Stop codons are also known as termination codons, or nonsense codons. An mRNA molecule also has regions that precede the start codon and follow the stop codon. Because these regions do not encode a polypeptide, they are called the 5′-untranslated region and 3′-untranslated region, respectively  The genetic code is composed of how many codons? 64 different codons  The start codon (AUG) defines the reading frame of an mRNA reading frame: a series of codons determined by reading the bases in groups of three, beginning with the start codon as a frame of reference 5′–AUGCCCGGAGGCACCGUCCAAU–3′ Met–Pro–Gly–Gly–Thr–Val–Gln If we remove one base (C) adjacent to the start codon, this changes the reading frame to produce a different polypeptide sequence: 5′–AUGCCGGAGGCACCGUCCAAU–3′ Met–Pro–Glu–Ala–Pro–Ser–Asn A Polypeptide Has Directionality from Its Amino-Terminus to Its Carboxyl-Terminus  The directionality of amino acids in a polypeptide is from the amino-terminus to the carboxyl-terminus, which corresponds to the 5′ to 3′ orientation of codons in mRNA Structure and Function of tRNA During translation, a tRNA has two functions: (1) It recognizes a three-base codon sequence in mRNA, and (2) it carries an amino acid specific for that codon The Function of a tRNA Depends on the Specificity Between the Amino Acid It Carries and Its Anticodon During mRNA-tRNA recognition, the anticodon in a tRNA molecule binds to a codon in mRNA in an antiparallel manner and according to the AU/GC rule Recognition between tRNAs and mRNA The anticodon in the tRNA binds to a complementary sequence in the mRNA. At its 3′ end, the tRNA carries the amino acid that corresponds to the codon in the mRNA according to the genetic code Common Structural Features Are Shared by All tRNAs cloverleaf pattern because it has three stem-loops. The anticodon is located in the second loop region All tRNA molecules have the sequence CCA at their 3′ ends. These three nucleotides are usually added enzymatically by the enzyme tRNA nucleotidyltransferase after the tRNA is made. Aminoacyl-tRNA Synthetases Charge tRNAs by Attaching the Appropriate Amino Acid To function correctly, each type of tRNA must have the appropriate amino acid attached to its 3′ end How does an amino acid get attached to the correct tRNA? Enzymes in the cell known as aminoacyl-tRNA synthetases catalyze the attachment of amino acids to tRNA molecules Cells produce 20 different aminoacyl-tRNA synthetase enzymes, 1 for each of the 20 distinct amino acids  Catalytic function of aminoacyl-tRNA synthetase  Catalytic function of aminoacyl-tRNA synthetase The anticodon of a tRNA is located in the 1.3′ single-stranded region. 2.loop of the first stem-loop. 3.loop of the second stem-loop. 4.loop of the third stem-loop.