HSI2007 Week 7-12 Alchemy in the Kitchen PDF

Alchemy in the Kitchen Week 7 Lesson outline of Week 7 Topic Lesson Summary of Week 4 Recap- What changes? Extension- What conditions affects the reactions? Putting everythi...

Alchemy in the Kitchen Week 7 Lesson outline of Week 7 Topic Lesson Summary of Week 4 Recap- What changes? Extension- What conditions affects the reactions? Putting everything together Extension- What is the impact on health? Assignment Instructions on Individual Assignment AMA from Week 4 Week 4 Summary  Many things happen with heat Raw Cooking/ cooked Protein Denaturation Watch the video here: https://www.britannica.com/video/180296/food Many things happen with heat Raw Cooking/ cooked Watch the video here: https://www.britannica.com/video/180296/food  Many things happen with heat Raw Cooking/ cooked Starch Gelatinization: Starch granules swells and collapses. Starch within is released. Watch the video here: https://www.britannica.com/video/180296/food The cooking of any food also involves a range of combinations of heat transfer. Surface heating by infrared radiation Surface drying and browning, results in crisp texture and flavour aromas from maillard reaction Internal heating via conduction and convection Starch gelatinization and protein denaturation forms crumb structure and final cake/bread structure Expansion of air bubbles creates cake/bread volume Impact of thermal food processes on sensory properties 1) Protein denaturation Affects texture Raw meat Heat Cooked meat 2) Maillard reaction Impacts flavour, aroma and colour Although there are many methods to manipulate raw ingredients, the use of heat remains the key way to prepare our foods. Proteins can be denatured in many ways. As it gets denatured, it undergoes visible changes. Are all changes equivalent to the changes we see with temperature? What else does heat do? Yohko F Yano 2012 J. Phys.: Condens. Matter 24 503101 Impact of thermal food processes on sensory properties 1) Protein denaturation Affects texture Raw meat Heat Cooked meat 2) Maillard reaction Impacts flavour, aroma and colour  Maillard Reaction What is the Maillard reaction? A form of non-enzymatic browning that is initiated by a chemical reaction between a reducing sugar (carbohydrate) and an amino acid (protein), upon the addition of heat. NOT ALL browning processes are Maillard reactions. Enzymatic browning Caramelisation* Maillard reaction ✗ Requires enzyme  Does not require enzyme  Does not require enzyme (polyphenol oxidase)  Addition of heat  Addition of heat ✗ No heat involved ✗ Absence of amino acids  Presence of both reducing * Breakdown of sugars only sugars and amino acids Reducing Sugars in foods Non-Reducing Sugar in foods Sucrose Lactose Maltose Cooking foods Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black Which of these will turn brown? Volunteers needed to inspect samples, visually and by smell. High Fructose Corn Syrup Alone HFCS + Phenylalanine HFCS + Methionine  Roast Chicken or Steamed Chicken? Same raw ingredient, but different outcomes.  Roast Chicken or Steamed Chicken? Steamed: Chicken submerged in stock, low heat, simmer 30mins. How does these Roast: cooking methods Fry in oil between 130- affect the outcome of 180C until golden brown, the end product? within a few minutes. Yes, roast chicken is actually fried chicken and steamed chicken is actually boiled chicken.  Conditions: Temperature, Moisture Cooking foods Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black Can we replicate this by putting everything together? Amino acids profile of cooked, skinless chicken breast (per 100g) Interaction between Maillard reaction and other reaction pathways Interaction with lipid oxidation/ degradation and vitamin degradation Maillard reaction Adapted from Kosowska et al. (2017)  Conditions: Temperature, Moisture Cooking foods Lipids Thiamine Iron Oxidation Degradation Degradation Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black  Can we replace garlic with yellow onions in chicken rice? What will change? What information do you need to make a decision? https://thewoksoflife.com/hainanese-chicken-rice/ Amino acid profiles of Onions and Garlic Odor profiles of amino acids heated with glucose Wong et al 2008 Int J Food Sci Tech 43 1512  Conditions: Temperature, Moisture, Types of amino acids and reducing sugars, Cooking foods Lipids Thiamine Iron Oxidation Degradation Degradation Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black Which of these will turn brown? High Fructose Corn Syrup Alone HFCS + Cysteine HFCS + Isoleucine What additional controls should I include in this investigation? USDA guidelines indicates cooking temperatures. You will notice that the cooking temperature is also well above the temperature where key pathogens are destroyed. Effects of Temperature on microbes Hence, storing food at room temperature for too long is not advisable. Many microbes that cause food Cooking and other food processing methods at high poisoning or food spoilage thrive at temperature can improve food safety and delay food temperatures between 15-45˚C. spoilage (extend shelf-life). Effects of Thermal Food Processes on Microbial Activity in food Dehydration Pasteurization Baking Blanching Sterilization Roasting Freezing Chilling Smoking Heat + Heat others Cold Kills some microbes but Kills all microbes Kills all microbes Decrease Decrease microbial microbial require further growth growth processing e.g. chilling Reduce water Reduce water activity activity Effects of Thermal Food Processes on Sensory Quality in food Dehydration Pasteurization Baking Blanching Sterilization Roasting Freezing Chilling Smoking Heat + Heat others Cold Slight or no Large detectable Large No No detectable changes detectable detectable detectable changes, changes, changes changes sometimes desirable to undesirable create flavours Process-generated compounds Acrylamide – carcinogenic Commonly found in fried, baked and roasted starchy foods Formed from asparagine and sugars Heterocyclic amines (HCAs) – mutagens, carcinogens Frying, grilling, roasting, BBQ of fish and meat foods Formed from reactions between amino acids, sugars and creatine (meat) at high temperatures Polycyclic aromatic hydrocarbons (PAHs) – mutagens, carcinogens Smoking or BBQ Formed from smoke and flames of open fire Process generated compounds Asparagine + Glucose Acrylamide Other compounds Amino acids + sugars Intermediates + Creatine HCAs Organic materials Intermediates PAHs  The quintessential under-cooked, burnt chicken wings of every BBQ you have ever Putting gone to. everything together Week 7 Everyone has some experience eating under-cooked BBQ chicken wings that are burnt on the outside. Compared to a well-cooked chicken wing, these chicken wings likely contains _________. From Maillard reaction too but not a major The quintessential under- concern in meats, as not a high starch cooked, burnt chicken food. wings of every BBQ you have ever gone to. From Maillard reaction, many charred bits From cooking fuels This roundworm is a recognized threat in pork but not other animals. This will be higher risk if it is a BBQ pork chop. But less so in chicken wings. Can we reduce the amount of HCAs in your favorite BBQ? Which of these herbs must be included in your marinate? Puangsombat et al 2011 J Food Sci 76 T175  Conditions: Temperature, Moisture, Types of amino acids and reducing sugars Cooking foods Lipids Thiamine Iron Oxidation Degradation Degradation Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins HCAs Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black The recipe says so. Plain Salt Baking Soda Baking Powder Baking Soda Brine https://www.seriouseats.com/the-best-buffalo-wings-oven-fried-wings-recipe  Conditions: Temperature, Moisture, Types of amino acids and reducing sugars, pH Cooking foods Lipids Thiamine Iron Oxidation Degradation Degradation Maillard reaction Further degradation Reducing Sugars Sugar condensation and/or hetero-cyclization & degradation Aldols Aldehydes Melanoidins Amino Acids Amino acid degradation Flavours Colors Aromas Shades of brown to black Which charcoal do you use? White Charcoal Black Charcoal Extruded Charcoal 2.5kg, $29 3kg, $8 3kg, $5 Can we reduce the amount of PAH in your favorite BBQ? What further conclusions can you make? Kim et al 2021 Food Chemistry 343 128453 Which these processed generated compounds can be banned? Trans-fat Acrylamide HCA PAH Summary Components in foods provide us with nutrients. They also participate in various reactions to create the characteristics of cooked foods. Kitchen While they provide us desirable characteristics, they also bring about undesirable Acrylamide characteristics or compounds which have HCA effects on health. PAH … However, not all undesirable compounds can be reduced or removed. Trans-fat Industry It is important to understand where the undesirable compounds originate from. This means it is important to understand food compositions and the process of making the end product. Acrylamide is in Group 2A. Different PAHs and HCAs are in Group 2A, 2B or 1. Cheers Biodiversity in the Supermarket Week 8 Lesson outline of Week 8 Topic Lesson Summary of Concepts from Week 5 Conditions for microbial growth Healthier or Still Junk? A Natural Debate- The NOVA Classification Individual Assignment Putting everything together Summary Week 5 Food processing improves food safety. This is mainly achieved with temperature. All types of microbes, both good and bad ones, and their growth rate are determined by: Temperature pH Water and/or lack of water (Water Activity) Salt and sugar binds water, making it unavailable for some types of micro- organism Oxygen and/or lack of oxygen Nutrients available Effects of Thermal Food Processes on Microbial Activity in food Dehydration Pasteurization Baking Blanching Sterilization Roasting Freezing Chilling Smoking Heat + Heat others Cold Kills some microbes but Kills all microbes Kills all microbes Decrease Decrease microbial microbial require further growth growth processing e.g. chilling Reduce water Reduce water activity activity  Principles of Processing Methods Major aim is to ensure food safety by either killing all, reducing, slowing down or inhibiting microbial growth. Methods Types Principle Effects on pathogens and spoilage microbes Physical Milling, chopping etc Size reduction - Blanching, Pasteurization Mild Heat Reduce microbes (Kills most but not all) Sterilization, dehydration, baking, roasting, smoking High Heat Kill all microbes Chilling, freezing Reduced Temperature Slow down microbial growth Physical HPP Pressure Reduce microbes (Novel) PEF Electric Field Reduce microbes Irradiation Radioactivity Reduce or kills all microbes, dose-dependent Chemical Preservatives Chemical Inhibit microbial growth Biological Fermentation Microbial Inhibit specific types of microbial growth Enzymes Enzymatic - Some types of food processing methods also improves the sensory and nutrition quality of foods. All types of microbes, both good and bad ones, and their growth rate are determined by: Temperature pH Water and/or lack of water (Water Activity) Salt and sugar binds water, making it unavailable for some types of micro- organism Oxygen and/or lack of oxygen Nutrients available Common sauces (eg. fish sauce, soy sauce, vinegar) used in Asian cuisines Different raw materials (different nutrients + Microbes available) produce different Asian sauces. In + Time some, only microbes (biological) are added. In others, microbes and sugar (chemical) are added together. + Salt + Salt + Microbes + Microbes + Time + Time  Whether a food product is made through chemical and/ or biological methods, it is dependent on the ingredients used at the start and whether the Chemical and/or Biological production of product requires time. Raw Material End product Main Method(s) + Sugar Jam Chemical + Microbes + Sugar Fermented Biological + Time strawberries Chemical + Microbes Strawberry Biological Vinegar + Time What types of Physical, non- thermal processing steps Physical, thermal are used in making soy sauce? Biological Chemical  Processing methods at home and at-scale There is a lot of overlap of methods used at home Industry and at-scale. However, when at-scale, the industrial equipment design will look very different from what Home we have at home. This is because the industrial equipment is designed to be time and cost efficient Microwave Size reduction Smoking HPP too. Size of equipment is not usually a constraint. Blanching Chilling PEF Pasteurization Freezing Irradiation The methods of processing foods at industrial scale Sterilization Preservatives Methods driven are mostly well accepted because they have been Dehydration Fermentation by current done at home and through history. Consumers are technology familiar with it. However, novel processing methods Baking Enzymes advancement originating from the food industry through Roasting advancement of technology is not readily found at home. This is due to the lack of familiarity (or fear) of the method and practical considerations such as the size of equipment. Homemade vs Commercial Will you choose to use either Yakult or homemade kombucha for the maintenance of good gut health? Students should consider each choice based on its safety and efficacy. Safety based on potential microbial contamination. Yakult is safer. Efficacy based on effects on gut health. Can implicate the concept of probiotics and its criteria. Yakult potentially has more efficacy because it has known number of live, beneficial microbes. Not all things homemade are good. Because of the strict food regulations and need to ensure consumer safety, commercial products may sometimes contain less hidden threats or false benefits. Minimally processed (Natural) vs Processed foods Hidden ingredients Based on consumer demands and perceptions of products, food manufacturers are making changes to the way they use ingredients. What used to be common in foods eg. high fructose corn syrup, monosodium glutamate (MSG) seems to have disappeared or replaced. However, some of these ingredients have prominent roles in ensuring the taste of foods. How do the food industry ensure taste is maintained while meeting the every changing demands of consumers? https://7news.com.au/lifestyle/food/anger-as-secret- ingredient-in-kfcs-famous-seasoning-is-revealed-prompting- social-media-backlash-c-8243534 16/09/2022 What is MSG? Monosodium glutamate (MSG) is the sodium salt of glutamic acid. Glutamic acid is a non-essential amino acid found in all types of plant or animal proteins. Glutamic acid can also crystalize and form glutamate compounds such as MSG. Glutamate is naturally found in many types of foods. While sugar activates the sweet receptors on our tongue, glutamate activates the umami receptors. Umami taste is distinct from salty taste, which is activated by sodium chloride (common salt). Besides glutamate, inosinate and guanylate also activates the umami receptor and gives us the distinct profiles of savoury foods. Some also believe that MSG causes the ‘Chinese Restaurant Syndrome’ which consists of headaches and numbness of the limbs from the consumption of Chinese food, which is presumably high in MSG. Based on the infographics here, what types of cuisines may equally be high in MSG? https://www.ajinomoto.com/aboutus/umami/5-facts  When seasoning powders claim No Added MSG ‘No MSG added’, what provides the umami flavors in seasoning powder? Is there MSG in here? https://www.sfa.gov.sg/tools-and-resources/food-additives-search Also check out: https://www.cnb.gov.sg/educational-resources/myths-and-facts-about-drugs/cannabis/faqs-about-hemp-and-cbd-oil-products How are food additives regulated in Singapore Food additives are assessed for safety and compliance with Singapore Food Regulations by Singapore Food Agency (SFA). This is to ensure that food additives are only used when: There is technological justification for their use; There are no health risks involved; Their use does not mislead consumers. 25 Bhang is an edible preparation made from the leaves of the cannabis plant originating from the Indian subcontinent. It has been used in food and drink as early as 1000 BC in ancient India. Bhang is traditionally distributed during the spring festival of Maha Shivaratri and Holi. Healthier Choice Symbol (HCS) A symbol in Singapore that consumers can relate to for healthier packaged foods. It is a part of the Nutrition Labelling Programme by the Health Promotion Board (HPB) and is intended to provide point-of-sale information to help people make informed food choices. “Food products may carry the HCS if they meet nutritional standards set by HPB. Evaluation will be based on the nutritional values; particularly fat, saturated fat, sugar, sodium and dietary fibre, as well as the contribution of that product towards a balanced diet.” Sweeteners Sweeteners can be nutritive or non-nutritive. It can be natural or synthetic. Nutritive sweeteners provide calories eg. glucose, fructose while non-nutritive or low-calorie sweeteners do not provide calories eg. aspartame, saccharine, Acesulfame-K. Some non-nutritive sweeteners are natural eg. stevia, monk fruit extract while other non-nutritive sweeteners are synthetic. The Healthier Choice logo The Healthier Choice logo is designed to affect food choices. In the category of beverages, you will often find healthier choice labels. Read the fine prints to know what they really mean. Lower sugar means it contains added sugar but in lesser amounts to other similar beverages. No added sugar means it contains sugar (eg. naturally present) but no additional sugar is added. It does not mean it is sugar free. Sugar-free means it does not contain free sugars. Free sugars, under the definition of HPB guidelines, include monosaccharides and disaccharides added to foods by the manufacturer; or sugars naturally present in honey, syrups and fruit juices, including fruit juice concentrates. This allows sweetening agents (as defined by SFA), sucralose and acesulfame-K, to be used in products such as coca-cola zero. Thus, the healthier choice logo for Sugar Free is valid. Sweeteners (general term) vs Sweetening agents (as defined by SFA) Calories Source Sweeteners Nutritive Non-nutritive Natural Artificial/ Sweetening Synthetic agents Glucose Fructose Sucrose Maltose High Fructose corn syrup Corn Syrup Honey Fruit juice concentrates Aspartame Sucralose Acesulfame-K Stevia Which one of the products is healthier? Which one of the products is healthier? Which one of the products is healthier? Tasty Flakes is higher in added sugar. Sugar is also second on the ingredients list. While Tasty Flakes carries a whole grains label, it is not healthier than Yummy Flakes. The label also only indicates the presence of whole grains and is not an indicator of healthiness. Gluten Sensitivity There is an increasing demand for gluten-free products. However, many consumers who demand gluten-free products often may not require such products in the first place. Celiac disease is a well defined, serious illness where the body’s immune system attacks itself when gluten is eaten. This causes damage to the lining of the gut and means that the body cannot properly absorb nutrients from food. Celiac disease is not a food allergy or intolerance, it is an autoimmune disease. Wheat allergy is a reaction to proteins found in wheat, triggered by the immune system and usually occurs within seconds or minutes of eating. Non-celiac gluten sensitivity is when symptoms similar to celiac disease are experienced, but it is not clear how the immune system might be involved because no antibodies are produced, and there does not appear to be damage to the gut lining. (In other words, very hard to diagnosed!) https://www.coeliac.org.uk Minimally processed (Natural) vs Processed foods Foods that are safe and/healthy may not always correlated to whether it is processed or not. Sometimes it is a perception created by regulations, labels or even social opinion/trend. Minimally processed (Natural) vs Processed foods vs Ultra-processed foods The debate continues. Sigh. Which of these term(s) are considered clean? Cane Sugar Sucrose Sugar On an ingredients list, these three terms mean the same thing. Cane Sugar Sucrose Sugar But only cane sugar and sugar are perceived as clean. And cane sugar more clean than sugar.  Clean labels Consumers’ definition of the naturalness of food ingredients is subjective and not entirely based on the chemical composition of the ingredient, nor the source of the ingredient. The naturalness of an ingredient can be decided by consumers based on how the ingredient is being named, the types of background information consumers are exposed to and familiarity with the ingredient. This also changes with time and trends. Maruyama et al (2021) Food Quality and Preference 104062  https://link.springer.com/article/10.1007/s00394-024-03458-z NOVA Food Classification Groups all foods according to the nature, extent and purposes of the industrial processes they undergo. These involved physical, chemical and biological techniques used after foods are separated from nature and before they are made into dishes and meals.  While NOVA is not based solely on the nutrients of foods, it is often used to Bread categorize foods and Vegetables https://link.springer.com/article/10.1007/s00394-024-03458-z correlate it to chronic diseases. Soy sauce? NOVA is largely based on Fish balls? processes and ingredients (and most goes beyond nutrients.) Putting everything together Individual Project Each student will submit an individual essay (1,000-1,500 words) which carries out an inquiry, through comparisons, of a food product. The comparison can be between a food product that is mass-produced (at the supermarket) versus its traditional/ artisanal produced form. Or versus a ‘futuristic’ form. Examine the two food products from a de-constructed angle, based on how it is being produced, its ingredients or other qualities (eg. food labels and claims). Consider the multi-factorial impact of these two food products which are the same, yet different. With this comparison of tradition vs current or current vs the future, make an informed position on whether the product you picked from the supermarket have a place in your food system. Steps to do this Download Assignment 2 Instructions+Worksheet and read that in detail. Pick one product of interest. Supermarket products provide inspiration but you can get the inspiration from anywhere. Read up on this product. From the product website or general sources of information on such products. Compare this to a similar product that is traditionally or artisanal-made, what is the difference in their impact on health, environment or society. eg. supermarket sourdough bread vs artisanal sourdough bread, chicken nuggets vs chicken, plant-based nuggets vs chicken nuggets Pick one or more aspect that you are most interested to examine. Don’t have to cover all Do one or both products have a place in your food system? Why? (Optional) Use Assignment 2 Worksheet as a storyboard for your essay, if required. Naturally brewed $3.95 $2.00 Brewed vs Chemical Naturally brewed $28 500ml $2.00 640ml Artisanal and Mass market soy sauce Comparisons on Foods: Health- Compare nutrition and ingredient labels. Processing method- Compare the time, cost, effort in producing the product. Comparison on the impact of food characteristics: Occasion of use- Discuss impact on culinary outcomes Culture- Traditional know-how Analysis: Personal and Food system viewpoint- Compare the types of people who would prefer one type over the other type. Compare the situations where the use of one specific type is better than the other. What would be the impact if one of these two products are not available? Conclusion: Both type should exist in the food system or one particular type will be sufficient? The eco-agri- food system and you To download the full policy paper: https://www.research gate.net/publication/ 331375280_Systems_ thinking_an_approac h_for_understanding _'eco-agri- food_systems'_In_TE EB_for_Agriculture_F ood_Scientific_and_E conomic_Foundations _Geneva_UN_Environ ment_Chapter_2_17- 55 Summary Food safety is of utmost importance in commercial products made by the food industry. Some consumers may have a negative impression of processed foods. However, the presence of certain ingredients may be required to ensure the safety of the product. This may not affect the healthiness of the food product. Food regulations is not the same in different countries and may be affected by general perception. General perception may also be shaped by food regulations! The current NOVA Food Classification is limited. Deconstructing Food Growing Foods Dr. LIU Mei Hui Department of Food Science and Technology Learning Objectives Describe genetically modified foods. Compare and contrast conventional and genetic engineered methods of crop breeding Evaluate different ways of growing foods. Genetically Modified Foods Foods derived from organisms whose genetic material (DNA) has been modified in a way that does not occur naturally Increase crop yield by introducing resistance to plant disease and tolerance of herbicides No international consensus on labelling laws Food products in Singapore can be voluntarily labelled if it is factual and not misleading Types of Genetically Altered Crops Transgenic Cisgenic CRISPR-cas Introduction of genes from Introduction of genes Deletion, change, or exogenous species from the same species alteration of existing gene Source: Bt Corn. Source: Pinkglow Pineapple. Source: Silician Rogue Tomoatoes. https://sanatech- https://www.isaaa.org/kc/cropbiotechupdate/article/default.asp?ID https://www.isaaa.org/kc/cropbiotechupdate/article/default.asp?ID seed.co.jp/en/horticultural-seeds/tomato/product/sr- =17928 Accessed on 13 September 2024 =18398 Accessed on 13 September 2024 enAccessed on 13 September 2024 Bt Crops (Transgenic) Bacillus thuringiensis (Bt): bacteria with natural insecticidal capability, used as a pest control tool for nearly a century Widely accepted as a natural bio-pesticide but engineering of Bt genes into major crops remains controversial despite Bt crops being highly effective at combating pests Source: Timeline of Bacillus Thuringiensis discovery and use. https://sitn.hms.harvard.edu/flash/2015/insecticidal-plants/ Accessed on 13 September 2024 Flavr Savr Tomato (Cisgenic) World’s first commercially marketed GM crop Developed by isolation of the gene associated with the polygalacturonase (PG) enzyme PG gene is reintroduced to the tomato in reverse orientation that reduces amount of PG produced PG breaks down cell wall pectin that is a setting agent in ripe fruits  less PG = thicker tomato paste & longer shelf-life Source: Cover Page of “First Fruit: The Creation of the Flavr Savr Tomato and the Birth of Biotech Foods” https://www.goodreads.com/book/show/1125991.First_Fruit Accessed on 13 September 2024 Cisgenic Modifications Source: Pinkglow Pineapple. https://www.isaaa.org/kc/cropbiotechupdate/article/default.asp?ID =18398 Accessed on 13 September 2024 Source: Arctic Apples. https://www.amazon.com/stores/page/E59D212A-663E-4108- AA38-D5CF77287C24 Accessed on 13 September 2024 Source: Development of Pinkglow Pineapples and Artctic Apples https://academic.oup.com/hr/article/doi/10.1038/s41438-021-00601-3/6446744 Accessed on 13 September 2024 Silician Rogue (CRISPR-cas) CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats Cas = CRISPR-associated protein 9  locate targeted genetic sequence in an organism’s DNA  cut the sequence in half Source: Use of CRISPR to disable the gene for an enzyme that degrades the cell wall in fruits. https://sitn.hms.harvard.edu/flash/2015/insecticidal-plants/ Accessed on 13 September 2024 “Silent Spring”, published in 1962, presents a view of nature compromised by synthetic pesticides, especially DDT. Once these pesticides entered the biosphere, Carson argued, they not only killed bugs but also made their way up the food chain to threaten bird and fish populations and could eventually sicken children. Organic Farming Holistic production management system Protects biological cycles, biodiversity, and soil biological activity Source: Official USDA Organic Symbol. https://www.usda.gov/topics/organic Accessed on 13 September 2024 Core Principles  No chemical residue  No pesticide residue  Use animal manure as fertilizer  Use of chlorine-containing compounds within limits of residual chlorine Organic vs Conventional Farming Chemical Residue Nutritional Value Organic produce has lower Produce are nutritionally amounts of pesticide residue equivalent regardless of farming method Still present – not in line with consumer expectation of “zero pesticide residue” Adapted from Source: Dwaidy, J., Cheaib, D., Jammoul, A., El Darra, N. and Al Khatib, A. (2021). Nutrition & Food Science, 51(8), 1207-1223. Adapted from Source: P. Cressey, R. Vannoort, and C. Malcolm (2009). Food Additives & Contaminants: Part B, 2(1), 21–26. Organic vs Conventional Farming Microbiological Impact Environmental Impact Use of animal manure as fertilizers Better soil: higher organic matter results in pathogen load content and lower nitrate leeching Foodborne disease outbreaks Less CO2 emissions due to organic food produce Higher biodiversity: greater species diversity and abundance Urban Farming Cultivating plants in city areas  generates extra income and food is given to local population Sustainable and productive agricultural activity in city areas Examples: indoor, rooftop, vertical, and community farming Vertical Farming Multi-layer, indoor crop production Conditions are precisely controlled  Temperature  Controlled light  Water  Relative Humidity  Carbon dioxide concentration Uses artificial lights or sunlight, and irrigated by hydroponics or aeroponics Technologies in Vertical Farming Hydroponics/Aeroponics LED Technology Use of liquid nutrient medium in Use visible light spectrum to place of soil to grow crops mimic sunlight in indoor farms Hydroponics: roots submerged in the liquid nutrient medium Aeroponics: liquid nutrient medium applied to roots in mist form Effect of Light on Plants Photons in light act as fuel for photosynthesis and plant growth Influences plant shape, cell expansion, and color Light quality affects synthesis of anthocyanin pigments in Adapted from Source: S. H. van Delden et. al. (2021). Nature Food, 2, 944-956. leaf color Summary Genetically Altered Crops and techniques have their benefits. However, their acceptance by consumers vary. While Organic farming is widely accepted and viewed in a positive light, there are some misconceptions associated with it. The rise of urban farming methods, especially vertical farming, may provide an alternative solution to challenges in food security. Deconstructing Food Making Food Dr. LIU Mei Hui Department of Food Science and Technology Learning Objectives 1. Describe different alternative proteins and their respective challenges 2. Compare the sustainability and nutritive value of alternative proteins with animal proteins Alternative Proteins Produced from low environmental impact sources to replace established proteins Current methods to generate established proteins raises concerns about health, environment, and animal welfare Growing consumer interest in alternative proteins aligned with sustainability efforts Source: Lab Grown Beef. https://www.sciencefocus.com/science/what-is-lab- grown-meat-a-scientist-explains-the-taste-production-and-safety-of-artificial- foods Accessed on 15 September 2024 Alternative proteins includes sources from plants, insects, fungi, algae and cultured cells. Plant Proteins Oilseeds Soybeans, Different proportion of soluble & peanuts, linseeds insoluble proteins based on plant source Cereals Requires less land space, emits less Wheat, corn, greenhouse gases than conventional rice, oats meal production, and causes less Legumes aquatic nutrient pollution Beans, chickpeas, lentils, peas Challenge: species-specific flavors are still derived from animal fat Leaves Alfalfa, sugar beets, clovers Plant Proteins – Technology a) Tissue b) Protein c) Protein d) Protein 1. Extraction Disruption Solubilisation Precipitation Concentration 2. Extrusion: produces texturized proteins to mimic meat fibers 3. 3D-printing: purees printed in layers to recreate species- specific structures of meat https://www.sciencedirect.com/science/article/abs/pii/S0268005X23001108?via%3Dihub Case Study- Impossible Foods Based on soy and potato proteins, coconut and sunflower oil, yeast extract, salt, gums, and vitamin B’s Red color and “bleeding”: using soy leghaemoglobin produced from genetically engineered yeast Source: Impossible Burger Patties. https://impossiblefoods.com/ Accessed on 15 September 2024 Insect Proteins Contains 35-60% protein (dry weight) Crickets & Grasshopper Insects live in high density  less space needed Efficient conversion of feed into edible weight Mealworm  Insects: 2.3 kg feed  1 kg live insect weight  Pork: 5 kg feed  1 kg live animal weight  Beef: 8.8 kg feed  1 kg live animal weight Larvae Can be extracted like plant proteins but are usually sold whole / as milled flour without extraction  Insect Proteins - Challenges 1. Flavor & Texture: unfamiliar taste, Exploring the potential of insect texture, and aroma  influences protein in ‘recognizable’ foods consumer acceptance 2. Safety Concerns: potentially allergenic especially to those with shellfish allergies Source: Buffalo worm burger https://www.test.de/Insektenburger-von-Bugfoundation- Buffalowurm-statt-Rindfleisch-5336829-0/ Accessed on 15 September 2024 Mycoproteins Based on Fursarium venenatum: food- grade filamentous fungus cultivated via fermentation Processed without protein extraction Complete source of protein, high in fibre, and lower in fat than animal Less greenhouse gas emission and requires less water and land Adapted from Source: Quorn Mycroprotein-based Products https://www.quorn.sg/products/ Accessed on 15 September 2024 Mycoproteins Techniques Challenges 1. Texture: steaming, chilling, freezing, 1. Flavor: lacks species-specific and addition of eggs achieves texture meat flavor like chicken breasts 2. Safety: lack of research on 2. Flavor: addition of eggs (sulfur- potential allergens containing amino acids) 3. Safety: heat treatment to reduce ribonucleic acid (RNA) content Case Study – Quorn Only commercial alternative protein made from mycoprotein Fermentation requires food grade carbohydrates and nutrients to stimulate fungal growth Source: Meyer et. al. (2020). Fungal Biol Biotechnol 7, 5. Source: Quorn Meat-free Pieces. https://www.quorn.sg/products/meat-free- pieces Accessed on 15 September 2024 Algae Proteins Classified as macroalgae (seaweed) or microalgae (unicellular organisms) Macroalgae (Lectins) Brown, green, and red seaweed Complete protein source with protein levels comparable to traditional meats 5-10x growth rate of conventional crops, requires little space and minimal freshwater needs Source: Microalgae. https://theconversation.com/microalgae-is-natures-green-gold-our-pioneering- project-to-feed-the-world-more-sustainably-170158 Accessed on 15 September 2024 Microalgae (Phycobiliproteins) Fishy aroma and undesirable taste Green, golden, and blue-green microalgae Algae Proteins - Technology Can be extracted like plant proteins Open Raceway Ponds Photobioreactors Fermentation Tanks Adapted from Source: V. Kumar, S. Mohan Jain Source: Photobioreactors. https://freshbydesign.com.au/aquaponic- Source: Fermentation Tanks. https://brightgreenpartners.com/microbial- (2014). Emir. J. Food Agric. 26(8), 679-692. aquaculture-products/algae-systems/varicon-aqua-algal- proteins/ Accessed on 15 September 2024 photobioreactors-2/ Accessed on 15 September 2024 Cultured Meat Produced through tissue culture in bioreactors using animal cells grown in oxygen-rich culture mediums Growth mediums: amino acids, Source: Cultured meat. https://www.labiotech.eu/in-depth/cultured-meat-industry/ glucose, vitamins, inorganic salts, Accessed on 15 September 2024 proteins, and other growth factors More humane Reduces greenhouse gas emissions and requires less land space Source: Lab Grown Beef. https://www.sciencefocus.com/science/what-is-lab-grown- meat-a-scientist-explains-the-taste-production-and-safety-of-artificial-foods Accessed on 15 September 2024 Cultured Meat 1. Extraction of stem cells from animal muscle tissue 2. Changes in medium composition to trigger the differentiation of immature cells  skeletal muscle tissues  fat tissues  connective tissues Source: Cultured meat production. https://www.four-paws.org/campaigns-topics/topics/nutrition/cultivated-meat- food-innovation/what-is-cultivated-meat Accessed on 15 September 2024 Cultured Meat – Challenges 1. Flavor & Texture  Requires texture development and fat cell inclusion to mimic slaughtered animal meats Source: Eat Just lab-grown chicken. https://mothership.sg/2020/12/eat-just-lab-grown- chicken/ Accessed on 15 September 2024 2. Production  Need to determine suitability of different cells for large-scale manufacturing and creation of specific product types Source: Shiok Meat lab-grown Siew Mai. https://shiokmeats.com/ Accessed on 15 September 2024 Environmental Sustainability Evaluating environmental impact  Carbon emissions  Waste production  Water consumption  Aquatic eutrophication Source: Rubio, N.R., Xiang, N. & Kaplan, D.L. (2020). Nat Commun 11, 6276 Green Washing Making unsubstantiated or misleading claims about environmental benefits of a product, technology, or practice Makes companies appear more environmentally friendly than they are in reality Adapted from Source: Sins of Green Washing. https://blancliving.co/blogs/news/what-is- greenwashing-and-how-to-stop-it/ Accessed on 15 September 2024 Nutrition of Alternative Proteins Protein digestibility-corrected amino acid score (PDCAAS): method to evaluate quality of protein  Amino acid requirements of humans  Digestibility of the protein 1 0.8 0.6 PDCAAS 0.4 0.2 0 Egg Milk Whey protein Soy protein Mycoprotein Soy flour Beef Cultured meat Chicken Pea protein Chickpea Cricket protein Yellow split Seaweed Wheat Wheat gluten isolate concentrate pea Adapted from Source: Backenridge et. al. (2020). Animal Frontiers 10(4), 53-64 and De Bhowmick G, Hayes M (2022). Foods 11(3), 289 Nutrition of Alternative Proteins Generally regarded that plant-based proteins are lower in proteins, vitamin B12, iron and zinc True of traditional plant- based meats Novel plant-based meats have overcome the limitation Source: Rubio, N.R., Xiang, N. & Kaplan, D.L. (2020). Nat Commun 11, 6276 Summary We have a diverse source of alternative proteins to explore. There are challenges to their adoption. Some of these are common and some are unique to the protein source. It is important that we ask critical questions to avoid being greenwashed. Deconstructing Food Eating Food Dr. LIU Mei Hui Department of Food Science and Technology Learning Objectives 1. Understand the significance of food beyond a sustenance and nutrition 2. Explore the influence of culture on the foods people decide to eat 3. Describe food neophobia Significance of Food​ Food can be defined as any nutritious substance that people consume but can have significance beyond sustenance Can act as a marker for national, social, and cultural identity Carries a sense of community, and relays customs, habits, and values Consumer Acceptance Culture: different cultural values that influence people’s attitudes and behaviors Source: Fried grasshoppers. https://www.scmp.com/news/asia/southeast- asia/article/3269657/singapore-approves-16-insect-species-food-including- Neophobia: rejection of unfamiliar foods grasshoppers-silkworms-crickets Accessed on 16 September 2024 (food neophobia) and novel food technologies (food technology neophobia) Disgust Sensitivity: feelings of disgust when food has indication of the presence of pathogens or contamination Source: Hair on foods. https://www.livestrong.com/article/13777882-hair-in- food/ Accessed on 16 September 2024 Insects as Food Insects consumed by billions of people, but only practiced in specific locations Lack of incorporation into diets despite being tried and tested food source Increasingly incorporated in ‘recognizable’ foods to raise consumer acceptance Adapted from Source: Global insect consumption infographic. https://ensia.com/infographics/can-insects-feed-a- hungry-planet/ Accessed on 16 September 2024 Insects as Food Insects consumed by billions of people, but only practiced in specific locations Lack of incorporation into diets despite being tried and tested food source Increasingly incorporated in ‘recognizable’ foods to Source: Insect food products. https://www.foodnavigator.com/Article/2019/06/19/Vegan-trend-boosts-potential-for- insect-protein-in-food-products Accessed on 16 September 2024 raise consumer acceptance Nuggets as Food Invented by Prof. Robert Baker to make eating chicken convenient and reduce unsold or unused parts of the chicken Source: Quorn Nuggets. https://www.quorn.sg/products/crispy- Essential representation of nuggets Accessed on 16 September 2024 western fast food Now become a common way to introduce alternative proteins Source: Insecta Schnitzel https://www.standaard.be/cnt/dmf20140917_01272593 Accessed on 16 September 2024 into people’s diets Source: Impossible Nuggets. https://impossiblefoods.com/products/ chicken/frozen-nuggets Accessed on 16 September 2024 Food and Culture Though popular, nuggets are not the only foods we consume Alternative proteins in the form of whole cut meats or in forms better suited for applications in various food cultures is required for better adoption Source: Buxton, Eat Just Partners with Singapore Hawkers To Bring Heritage and the Future of Food Together, https://www.greenqueen.com.hk/eat-just-singapore-hawkers/ Summary Food goes beyond sustenance Understanding factors that affect consumer acceptance of novel foods and food technologies may help us encourage future uptake of such foods. Credits Producer Dr. LIU Mei Hui Production Assistants Mr. NEO Teng Whay Blended Learning Team Enabler Mr. Benedict CHIA Mr. Terence LIM Visuals and Graphics used from Freepik and Canva.com  The Meaning of Food Week 10 Top row: escargots, sardines, and fava beans (Crete); naan in salty yak-milk tea (Afghanistan); fried geranium leaves (Crete); boiled crab (Malaysia); raw beetroot and oranges (Crete); chapati, yak butter, and rock salt (Pakistan). Middle row: dried-apricot soup (Pakistan); boiled plantains (Bolivia); fried coral reef fish (Malaysia); bulgur, boiled eggs, and parsley (Tajikistan); stewed-seaweed salad (Malaysia); boiled ptarmigan (Greenland). Bottom row: grilled tuna (Malaysia); cooked potatoes, tomatoes, and fava beans in olive oil (Crete); rice with melted yak butter (Afghanistan); fried fish with tamarind (Malaysia); dried apricots (Pakistan); grilled impala (Tanzania) https://www.nationalgeographic.com/foodfeatures/evolution-of-diet/  The Meaning of Food? https://www.temasek.com.sg/en/news-and-resources/stories/future/the-next-food-revolution/catalysing-lab-to-table-solutions Lesson outline of Week 10 Topic Lesson Summary of Concepts from Week 10 Food Choices Putting it together Instructions for Week 11 Peer feedback for own group members & Learning Survey Our DNA- A book of instructions Our book of instructions contains 3 billion characters (3 billion bases long). There are only 4 characters used to write this book. These characters, know as bases, are Adenine, Thymine, Guanine, Cytosine.  Does not code for gene Code for gene Genes …ATCGTTCGGCTAGTATACTATGAGCCCGCGCGTATGTCGATGAG… … … are parts of our DNA which contain the …TAGCAAGCCGATCATATGATACTCGGGCGCGCATACAGCTACTC… … … instructions to produce specific proteins Gene Identical twins Messenger RNA have the same set of DNA sequences. https://www.nationalgeogr aphic.com/magazine/article /identical-twins-science- Protein dna-portraits Biological process or pathway Gene variant Alteration in normal sequence of bases in a gene Different forms of the same genes Effect may be positive or negative, harmful or harmless These gene variants makes us different. Blue eyes, Variant at Asian Flush, Variants Lactose intolerance, OCA2 gene at ALDH2 gene Variants at Lactase gene A simplified example of gene variant on eye color: …AGTATACTATGAGCCCGCGCGTATGTCGATGAG… …AGTATACTATGAGCCCGCGCGTCTGTCGATGAG… …TCATATGATACTCGGGCGCGCATACAGCTACTC… …TCATATGATACTCGGGCGCGCAGACAGCTACTC… OCA2 OCA2 Messenger RNA Messenger RNA OCA2 Protein OCA2 Protein Pigmentation pathways Pigmentation pathways Selective Breeding of Brassica oleracea Selective Breeding of two Brassica species White cabbage and Chinese cabbage originate from two different Brassica species used and domesticated by farmers on two different continents. An accumulation of variants on different proteins makes us look different from one another. Genetic variation also happens to crops and livestock too. Worldwide, broccoli (Brassica oleracea var. italica) is among the most economically important, nutritionally rich, and widely-grown vegetable crops. To explore the genomic basis of the dramatic changes in broccoli morphology in the last century, 109 broccoli or broccoli/cauliflower intermediates for 24 horticultural traits were examined. Presented here are the heading structures of different broccoli studied in the trial. https://www.nature.com/articles/s41438-020-00375-0  Summary of Genetic Alteration methods on crops Conventional Breeding Genetic modification Genome editing Crossing Mutagenesis Protoplast fusion Trans-genesis Cis-genesis CRISPR-Cas9 Chemical and/or radiation X Many rounds of back- crossing Selection Elite Variety with Desirable Traits Trans-GMO Cis-GMO Genetically Edited Crop Natural (?) GMO Non-GMO  Domestication of Maize Meyer & Purugganan (2013) Nature Reviews Genetics 14:840 Genetically Altered Crops- Is this a new term? Steinwand and Ronald (2020) Nature Food 1:273 https://non-gmoreport.com/gmo-pink-pineapple- https://www.newscientist.com/article/mg23831790- launched-at-49-each-wont-be-labeled-gm/ 400-pink-pineapples-and-healthy-fries-the-new-gm- foods-made-for-you/ Food Choices  https://roadsandkingdoms.com/2019/a-history-of- https://www.nytimes.com/2022/11/03/t- singapore-in-10-dishes/ magazine/singapore-peranakan-cuisine.html  Food and Culture The answer to the question is no, not yet. Alternative proteins in the form of whole cut meats and in the form that is suitable for applications in specific food cultures are required for better adoption. https://www.youtube.com/watch?v=a6QNyPw4A-c The Fake Food Buffet (Food Decisions) Hartman et al (2021) Appetite 167:105622 Perceptions affect Food Decisions Information Perceptions Decision making processing Stinky tofu is a fermented dish enjoyed in various Chinese cultures. However, other cultures would consider it as spoilt and unfit for consumption. It all depends on the local food culture, and what is deemed suitable for consumption. Heuristics We make more food decisions than most, if not all, other species. However, the decisions are made based mainly on a heuristic process, not on elaborate information processing. It is still unclear whether the use of heuristics results in poor or smart decisions. Eg. Adoption of GMO. GMO is perceived differently across countries. Most lay people lack knowledge on GMO and hence, they rely on the affect, trust or naturalness heuristics to evaluate GM food. 1. Affect When asked to evaluate the risk or benefit of an item, people rely on the feelings that they associate this item to, to make decisions. Eg. When GMO foods are mentioned, some people associate them with Frankenstien foods. This perception gives a negative feeling. However, some people may have a positive feeling towards GMO due to their association of GMO foods with ‘Golden Rice’, a rice variety genetically modified to produce beta-carotene, the precursor of Vitamin A, in the rice grain. 2. Trust How do food companies build social trust? When people rely on trust to evaluate an item, they substitute a target attribute with cues that indicate trust in the source of this information. Trust can be divided into social trust and confidence. In social trust, people tend to trust institutions with similar values as theirs. Confidence is based on past experiences or perceived competencies. Eg. Someone may have confidence in the food industry’s competencies to produce safe foods but they may lack social trust in the food industry because they believe that it values profits more than customer’s health. 3. Naturalness Natural is almost always perceived as better. Natural foods is also perceived to be healthier, tastier and better for the environment. This means that naturalness of foods is highly regarded in food decisions. Perceived naturalness is driven by absence of processing steps or chemicals/additives. Which is more natural? The preference for natural foods is mainly driven by instrumental (eg. health) reasons. Thus, it is possible to influence preferences towards foods they perceive as less natural, if tangible benefits are provided. For example, functional foods with fortified nutrients affects people’s perceived naturalness because of the health benefits it can deliver. When risks are compared side-by-side, natural risk is of less concern than perceived man-made risks. Eg. even though irradiation can reduce the risk of food poisoning in foods, consumers generally have less concerns on the hazards of foodborne microorganisms than concerns on the effects of irradiation on foods eg. chemicals or perceived radioactivity generated. Minimally processed (Natural) vs Processed foods vs Ultra-processed foods Framing perspectives Post et al (2020) Nature Food 1:403 Willingness to consume cell cultured meat varies with time, place and also the terms used in the question to describe the product. https://www.fooddive.com/news/cell-based-cultivated-meat-comments-usda/623028/ Sorted comments: “cell- based meat,” “cellular meat,” “clean meat,” https://www.fooddive.com/news/cell-based-cultivated-meat-comments-tracker-usda/623608/ “cultured meat,” “slaughter-free meat,” “cruelty free Actual regulations: meat,” “sustainable meat”, “artificial meat”, “fake https://www.regulations.gov/document/FSIS-2020-0036-0001 meat” What people in Singapore think Chong et al (2023) Effects of framing, nomenclature, and aversion to tampering with nature on consumer acceptance of cultivated meat in Singapore. Journal of Environmental Psychology 91:102140 How much of these dishes contain chicken? Which of the following statement is likely true? Singapore Food Regulation, Meat and Meat Products: Hamburgers or beef burgers and similar products 65.—(1) Hamburgers or beef burgers shall be minced meat comprising a minimum of 90% meat, with or without the addition of cereal, flavouring substances, salt, spices, herbs, sugar, vinegar, sodium caseinate or other foodstuffs. Hamburgers or beef burgers shall contain not less than 15% protein (total nitrogen x 6.25) combination and not more than 30% fat. (2) Any prepacked minced meat other than beef which resembles hamburgers or beef burgers shall be labelled as follows: “(here state name of meat) burger”. It shall comply with the standards laid down for hamburgers or beef burgers. (3) In these Regulations, “hamburgers”, “beef burgers” and other type of “meat burgers” do not include any separable bakery product or other separable food that may enclose or be enclosed with the minced meat product. Sausage meat No definition of what a chicken nugget is. 66.—(1) Sausage meat shall be chopped or comminuted meat. It may contain salt, sugar, There is also no minimum amount of chicken spices, herbs and wholesome farinaceous substances. (2) Sausage meat shall contain not more than 6% starch and in the case of pork sausage required in a chicken nugget. meat and beef sausage meat not less than 65% and 50% meat respectively, and not more than 40% of the meat content shall be fat. (3) Sausage meat may contain potassium or sodium nitrite, potassium or sodium nitrate, alone or in combination, provided that the amount of nitrites and nitrates present in the final product does not exceed the permitted levels specified in Part I of the Fourth Schedule. Instructions for Week 11 Peer evaluation of groupmates Learning survey Instructions for Peer Evaluation of groupmates Design Rationale: Emphasize the importance and value of teamwork. Everyone is busy. Every team member has a busy schedule. Not just you. When everyone does their part and do it in a timely manner, it benefits the whole team. Everyone has priorities. If your priorities is not in the group project, it is your choice and there has to be some mechanism to reward those members who have to take more responsibilities just to get the project delivered on time and of good quality. Everyone has chances to contribute. Some students, for various reasons, were unable to participate well in the group project. They will have other chances eg. tutorial discussion to contribute. Everyone has a chance to present their POV. There will be a field in the survey to allow you to self-evaluate your contribution and also another field to explain why you grade your teammates in a certain way. This provides me with both sides of the story. Suggested ways to evaluate team members in the Qualtrics form A study on student learning Consent needed. Must answer Yes or No. External use, within NUS. Students survey data linked to grades and de- identified. Only those who consent for linking. Compared with Link to grades other faculties Learning surveys on case-studies and draft-final Internal use. All students survey data analyzed. Not link to grades. Survey data Inform design of analyzed to inform next semester’s on usefulness of class case-studies Summary (It’s a wrap) Week 12 Exam Matters, sometimes 28 Nov 2024, 5-6 pm, UTOWN-AUD2 30 MCQ (30marks), 1 short answer question (20 marks). 1 hour. 50 marks in total. Closed book, EXAMSOFT/EXAMPLIFY. A cheat sheet of information will be provided soon. This will also be provided during the exams. You do not need to print it out. Attend Mass Zoom Briefing by CTLT on 20 Nov 10-11am, if you need. Meeting Passcode: 159627 Join URL with encrypted passcode: https://nus-sg.zoom.us/j/83160286333?pwd=lm2yxjRE2ECSxpLmPJiaTSusLbCoAx.1  HSI2007 Deconstructing Food Print, Media, Product Source of information Food Law Statements about food Social Opinion Nutritious? Natural? Safe? Sustainable? Science behind food processes Processing at Processing in Raw Nutrition home the industry materials  SI1 to SI2 to IDC Established Tutorial science & ‘The Blood Type Diet’ and pseudoscience behind a best selling Tutorial diet that’s printed over 8 million copies, 16 different languages. Ongoing science ‘Ah Mah’s biscuits and cancer’ Cooking processes that contributes more than flavor and taste to food. But does it cause cancer? Health & Pseudoscience Demo- Tasting Crackers Demo- Cooking in the lecture theatre Food Nutrition ‘Pressure Cooker experiment’ to investigate key components ‘The Cracker Test’ to investigate pseudoscience claims on Chemistry of the mallard reaction and to tell fact from magic! carbohydrate metabolism Demo- Smelling soya sauce Demo- Tasting alternative foods Novel Food ‘Alternative foods’ to examine personal acceptance of Food Processing ‘Soya sauce connoisseur’ to examine different food processing methods and what is natural vs artificial. alternative forms of foods. Familiar vs Novel Natural vs Processed Tutorial Tutorial ‘Insect Chips’ to examine whether alternatives foods can be the ‘Gluten Free Bread is better’ to examine different food solution to our food challenges. processing methods and what is natural vs artificial. Deconstructing Food With any given food, you should be able to have a general understanding on: 1. What does my food do to me when I eat it? 2. What happens to my food when I cook it? 3. How is my food made? 4. How is my food determined to be safe? 5. Why do I choose to eat this food? When you deconstruct any food you eat, you will realize that food is not just a sum of all its original parts. Many changes happen from the farm to fork to human. Some changes is due to natural phenomenon, some due to human factors. Source: https://www.pinterest.com/dribbble/ Assignment (Group work) Assignment (Individual Essay) Design considerations: Design considerations: An assignment that maintains the elements of Demonstrate the ability to apply knowledge scientific inquiry that they can apply in daily life. in this module to make food decisions. Allow student to think beyond their primary Allow people from different disciplines to see the discipline. relevance of their discipline in the topic. Relate personal food decisions in relation to Project work the food system. Design Pose 1-2 Provide case study related answers to related to Compare a Examine impact of questions. questions. Examine their food food product these two food characteristics with a product variants in the food A relatable Asking questions. Use content. variant. system. scenario of Using reliable sources of knowledge to arrived interest. information for context. at a scientific response. Relatable Applying Relate personal Reflections products of module food decisions to interest. knowledge. the food system. Eg. Plant based Eg. processing AI use Feedback Use Eg. environment, cheese vs cheese, steps, culture, social etc handmade fishball ingredients vs mass produced etc fishball etc  The way we make food does not get replaced easily with the advancement of technology Food is not just a means to an end only. If it is, everyone can be given a packet of nutrient supplements for sustenance. Food has inter-disciplinary impact and also multi- disciplinary impact too. The meaning of food is also different for individuals and collectively shape how we view food and our food choices. Siegrist & Hartmann (2020) Nature Food 1:343-350 Before the mid-1800s, ice was harvested from nature and transported by horse carts and ships from temperate countries. There was a high demand for ice to be transported to tropical countries for cooling and for the transportation of fresh food over long distances by sea. Cooled drinks and ice cream were also very costly delicacies reserved for the very rich. However, with the invention of the very first ice machines and further improvements thereafter, ‘artificial ice’ can be eventually produced anywhere and at a much lower cost. Despite not coming from nature, ‘artificial ice’ made from machines was readily accepted during its introduction. What do you think was/ were the major heuristic(s) which played a role in its acceptance? Images from: https://www.reddyice.com/the-chilling-history-of-ice/ Feedback on answers Affect: Positive affect, appeals to a need/ demand, linked to positive attributes like status and positive experiences Trust Naturalness Heuristics We make more food decisions than most, if not all, other species. However, the decisions are made based mainly on a heuristic process, not on elaborate information processing. It is still unclear whether the use of heuristics results in poor or smart decisions. Eg. Adoption of GMO. GMO is perceived differently across countries. Most lay people lack knowledge on GMO and hence, they rely on the affect, trust or naturalness heuristics to evaluate GM food. Feedback on answers a) No. When a product is described as gene-edited, it uses the CRISPR-cas method. Under most current definitions, a product using CRISPR-cas method are not categorized as GMO. b) As the gene has been edited, the amount of asparagine produced can be accurately measured in the plant. The reduction in acrylamide is variable because the amount of acrylamide produced through the mallard reaction is dependent on many factors, not just on asparagine. For example, a bakery product that requires a longer baking time will produce more acrylamide, compared to a bakery product that was backed with a shorter time. Other examples of conditions affect the mallard reaction is acceptable.  Singapore Water Story NEWater is now 20 years old! Urban Law & planning Technology Trade The Singapore Water Story first started from a political need to find alternative sources of water. This pushed us to explore new ways to increase our own water supply. Science & Technology allowed us to find new ways to generate water, such as NEWater. The water generated was safe for consumption. However, social opinion will affect the acceptance of NEWater and there were huge efforts made to change opinion. While our local opinion changed, most of the rest of the world did not change until the need to find alternative ways to make clean water due to global warming.  Singapore Food Story “30 by 30” To produce 30% of our nutritional needs locally by 2030. To be Singapore currently imports more than met within our land constraints of less than 1% of it is 90% of our food from more than 170 designated for agricultural use. countries and regions. Vulnerable to emerging trends on global Grow more with less. demand for food, climate change and international instability. To strengthen Singapore’s food security, the Singapore Food Agency (SFA) has three broad strategies called the 3 Food Baskets: Diversify import sources Grow local Grow overseas Source: https://www.sfa.gov.sg/food-farming/singapore-food-story/r- and-d-programme  Food farming systems are at risk to biotic, abiotic and institutional risks factors. These, can be partially reduced by future food farming designs or new food sources. How will vertical farming reduce such risks? ASF- Animal source food PSF- Plant source food Tzachor et al (2021) Nature Food 2:326  Global adoption (%) of genetically modified crops (maize, cotton, soybean, eggplant) with insect-resistance traits in 2017. https://www.sciencedirect.com/science/article/pii/S1049964418305103?via%3Dihub Further reading: https://www.scientificamerican.com/article/how-biotech-crops-can-crash-and-still-never-fail/ https://academic.oup.com/ae/article/67/3/52/6366651 Source: https://www.frontiersin.org/articles/10.3389/fpls.2021.605937/full Source: https://allianceforscience.org/wp-content/uploads/2023/02/Summary-GMO-misinformation-in-the-Kenyan-media-summary.pdf Science works. But. How do we influence minds? Ideas matter. Science matter too! Then Mark originally argued that GMO’s were “living pollution” and ultimately unhealthy for people and the environment. He argued that GMOs meant increased pesticide usage and more pesticides meant an ecological crisis. Now Lynas made a final plea that, “The GMO debate is over, it is finished, we no longer need to discuss whether or not it’s not safe…there has been a substantial amount of meals that have caused no harm”. Feedback on answers a) Affect: Evoke disgust; Trust: Publishing in a research journal, using science; Naturalness: not natural to have such tumors and of such size. b) How many mice were used? Where was the control? What was the dose? How long was the exposure? c) Human studies. Specifically, observational because intervention studies would be unethical. The eco-agri- food system and you To download the full policy paper: https://www.research gate.net/publication/ 331375280_Systems_ thinking_an_approac h_for_understanding _'eco-agri- food_systems'_In_TE EB_for_Agriculture_F ood_Scientific_and_E conomic_Foundations _Geneva_UN_Environ ment_Chapter_2_17- 55 The Flavr Savr tomato is a tomato which contains a gene insertion from the same tomato species. The gene insertion made was a tiny fragment of the same gene, from the same species, inserted in a reverse manner. The tomato is a GMO product. At the point of purchase at the supermarket, do you consider this tomato as a natural product? Explain your viewpoint(s). (20 marks)  Flavr Savr tomatoes: Yay or Nay? The Science Gene inserted came from the same tomato species. Genetic material is natural. Chances of genetic material being inserted in a reverse manner occurring naturally/ randomly is very low, we do not have data to say that it will never happen either. So on this ground, it is natural. GMO foods are around for over 20 years. No adverse effects to health reported. The Heuristics Tomato looks like a tomato and is grown from the ground. My concept of naturalness can further be extended to my understanding at the scientific level. They agree and are not conflicted. The tomato extends shelf-life. This is beneficial and I have a positive affect to towards this. I know where to find reliable information and trust my sources of information. But for some others, their concept of naturalness may be between GMO and non-GMO labels. They have trusted sources of information but these ones may contain misinformation which provide negative affects through claims on health, fertility etc. these are not supported by scientific evidence. So for some people, flavrsavr is artificial. Feedback on answers The question’s purpose is not to test you about your ability to identify what is GMO. It being a GMO product is mentioned in the question. With an understanding of the science behind food products, your food choices will naturally present some conflict between your food literacy, food law/definitions and the heuristics that drive your food choices. I complicate things by presenting to you a fresh produce, a tomato. Students need to demonstrate considerations of several dimensions in their final standpoint: 1. There is no need to label foods that are GMO by law, so you will be presented with two scenarios. One where it is labelled GMO at the point of purchase and one where there are no GMO labels. 2. There are several interpretations of Natural. One is whether there is any genetic modification, another on whether it is minimally processed and somewhat clean labelled and finally, one on whether it is organic or not. There are several contradictions. Almost all tomatoes are cultivated. The wild tomatoes that some of you speak of might be called heirloom tomatoes in a Michelin Star Restaurant. With cultivation, all methods involved human intervention. If the parameter is s